ID: 954707880

View in Genome Browser
Species Human (GRCh38)
Location 3:52490675-52490697
Sequence ATGGAGAAAGGGACAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5153
Summary {0: 1, 1: 0, 2: 48, 3: 614, 4: 4490}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954707880_954707885 -8 Left 954707880 3:52490675-52490697 CCTCCCTCTGTCCCTTTCTCCAT 0: 1
1: 0
2: 48
3: 614
4: 4490
Right 954707885 3:52490690-52490712 TTCTCCATCACACAGATTTCTGG 0: 1
1: 0
2: 1
3: 29
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954707880 Original CRISPR ATGGAGAAAGGGACAGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr