ID: 954708776

View in Genome Browser
Species Human (GRCh38)
Location 3:52494875-52494897
Sequence CTAGTGAGGGGATGTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954708768_954708776 1 Left 954708768 3:52494851-52494873 CCAGCGGCTCAGGAGTGGCTGGG 0: 1
1: 0
2: 0
3: 34
4: 922
Right 954708776 3:52494875-52494897 CTAGTGAGGGGATGTGGGTCTGG 0: 1
1: 1
2: 0
3: 13
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954708776 Original CRISPR CTAGTGAGGGGATGTGGGTC TGG Intergenic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
901199237 1:7457417-7457439 CAGGTGAGGGGAGGTGGGTGGGG + Intronic
901530891 1:9851862-9851884 CCAGGGAGGGGCTGTGGGCCAGG + Intronic
903081972 1:20817814-20817836 CAAGTGTGGTGGTGTGGGTCTGG - Intronic
903144553 1:21362571-21362593 CTGCTGAGGGGCTGTGGGTGGGG + Intergenic
903994642 1:27298123-27298145 CTGCAGAGGGGATCTGGGTCAGG + Intronic
904257694 1:29266569-29266591 CTAGTGAAGGGGTCTGGGTCAGG + Intronic
904556334 1:31367261-31367283 CAAGAGAGTGGTTGTGGGTCAGG - Intronic
904971593 1:34423344-34423366 CCAGGGAGGGTATGTAGGTCAGG - Intergenic
905261026 1:36719423-36719445 CTTGTGAGGGAATGTGGGGGAGG - Intergenic
906885718 1:49645574-49645596 CTAATGAAGGCATGTGGGCCTGG - Intronic
907048022 1:51311932-51311954 CTAGTGAGGGTGTGGGGGGCAGG - Intronic
908916854 1:69138170-69138192 TTGGTAAGGGGATGGGGGTCAGG + Intergenic
909606823 1:77516313-77516335 GAAGTGAGGAGATGTGGTTCTGG + Intronic
910026791 1:82664973-82664995 ATAGTGAGGGGAAGTGGATAAGG + Intergenic
911192315 1:94960303-94960325 CTACTGAGGGGATCTGGGACAGG + Intergenic
915870620 1:159556153-159556175 CTTGTCAGGGGATGGGGGGCTGG + Intergenic
915981322 1:160421720-160421742 CTAATGAGGGGATGGGAGTCTGG + Intronic
917009435 1:170454452-170454474 CTTGGGAGGGTATGTGTGTCCGG + Intergenic
917173323 1:172201827-172201849 CTAGTGAGGAGATATGGGAACGG + Intronic
920373757 1:205495412-205495434 CTTGGGAGGGGATTTGGGACAGG - Intergenic
922390627 1:225137963-225137985 CTAGTGAGGAGGAGTGAGTCGGG + Intronic
922705430 1:227788060-227788082 CGAGGGAGGGGCTGTGGGTGTGG + Intergenic
922914141 1:229241651-229241673 CTTGAGATGGGATGTGGGTGGGG - Intergenic
923731235 1:236552508-236552530 CCAGTCAGGGGCTGTGGGTGAGG - Exonic
1070671143 10:78378164-78378186 CTAGAGAGGGAATGTTGGCCTGG - Intergenic
1070922058 10:80194274-80194296 CTAGTGAGGGGCCGTGGGAGGGG - Intronic
1070933177 10:80274933-80274955 TGAGTGAGGGGATGTTGGCCCGG - Intronic
1073249569 10:102113614-102113636 CTAGTTGGGGGATGAGGGCCAGG - Intronic
1075479662 10:122769063-122769085 CCACAGAGGGGATGTGGCTCAGG - Intergenic
1076172777 10:128336626-128336648 CTTGGGAGTGGATGTGGGTGAGG + Intergenic
1076539869 10:131207140-131207162 CAAGTGAGGGGATTGGGGTGGGG - Intronic
1076995624 11:296253-296275 GTGGAGAGGGGCTGTGGGTCAGG + Intergenic
1076995645 11:296334-296356 GTGGAGAGGGGCTGTGGGTCAGG + Intergenic
1077378373 11:2216067-2216089 ATAGTGGGGGGATCTGGGCCGGG - Intergenic
1080162809 11:29198626-29198648 ATAGTGAGGGGAAGGGGGTGAGG + Intergenic
1080327013 11:31087000-31087022 CTAGTGAAGTAATCTGGGTCTGG + Intronic
1080699891 11:34635824-34635846 CTAGTGAGAGGAAGAGGGACAGG + Intronic
1083878699 11:65537873-65537895 CTAGTCAGGTGAGCTGGGTCTGG + Exonic
1087771969 11:102220638-102220660 CTAGTAAGGAGAGATGGGTCTGG + Intronic
1088215809 11:107507796-107507818 GTAGTGAAGGGATGTGGCACAGG + Intronic
1089293247 11:117451018-117451040 TTAGTAAGGGGGTGAGGGTCAGG - Intronic
1090106166 11:123855167-123855189 CCAGTAAGGAGAAGTGGGTCGGG - Intergenic
1092682923 12:11007735-11007757 CTAGTGTGGGGATGTGCTTGTGG - Intronic
1093414718 12:18907062-18907084 AGAGAGAGGGGATGTGGTTCAGG - Intergenic
1094482420 12:30895392-30895414 CTAGAGTGGGCATGTGAGTCTGG - Intergenic
1095417224 12:41990179-41990201 GTAGGGAGGGGCTGTGGCTCAGG - Intergenic
1095821809 12:46486701-46486723 CTAGCCAGGGCATGTGGGTGGGG + Intergenic
1095830572 12:46582009-46582031 CTGGTCAGGGGGTGGGGGTCTGG - Intergenic
1097462709 12:59882341-59882363 CTAATGAGGTAATGAGGGTCTGG + Intergenic
1100819682 12:98419856-98419878 GGAGTGAGTGGATGTGGGGCAGG - Intergenic
1101909478 12:108850684-108850706 CTAGGGAGGGGATTTGGGGGAGG + Intronic
1103609992 12:122117435-122117457 CTAGTCCTGGGATGTGGGCCTGG - Intronic
1106544838 13:30721469-30721491 TTAGTGAGGGGTTGGGGGTAAGG - Intronic
1108479294 13:50851921-50851943 CCAGTGAGGGGTTGGGGGTGGGG - Intergenic
1112703230 13:102036045-102036067 CTGGAGAGGGGATGTGGGAGTGG + Intronic
1113474753 13:110572361-110572383 CTTGGGAGGGGATGTGTCTCAGG - Intergenic
1113987954 13:114334166-114334188 TTACTGAGGGGATTTGGGTTTGG - Intergenic
1115928829 14:38467711-38467733 CTAGTGAGGAGGGATGGGTCAGG + Intergenic
1115968151 14:38915343-38915365 CTTGGGAGGGTATGTGTGTCCGG - Intergenic
1116472722 14:45305135-45305157 CTGGGGAGAGGATGTGGGTCAGG + Intergenic
1122919566 14:104874457-104874479 CCAGGGAGGGCATGTGGGGCAGG + Intronic
1123000740 14:105292855-105292877 CTGGGGAGGGGATGTGGGCCTGG - Intronic
1127851440 15:62915575-62915597 CCAGTGAAGGCATCTGGGTCTGG - Intergenic
1128133089 15:65243692-65243714 CTAGTGAAGGCATCTGGGCCTGG + Intronic
1128540699 15:68528744-68528766 CTAGTGAGTTCATCTGGGTCTGG + Intergenic
1128560918 15:68667190-68667212 CTGGTGAGGGCAGGTGAGTCAGG - Intronic
1129934403 15:79437555-79437577 TTAGTGAGTGGGTGTGGGTGTGG + Intronic
1129934893 15:79439311-79439333 GTAGTGATGAGATGTGGGTGGGG + Intronic
1129934911 15:79439400-79439422 GTAGTGATGAGATGTGGGTGGGG + Intronic
1129971347 15:79780507-79780529 CTAGTGAGGAGAAATGGATCCGG - Intergenic
1131054933 15:89369458-89369480 AGGGTGAGGGGATGGGGGTCAGG - Intergenic
1134592204 16:15463726-15463748 CTGGGGTGGGGATGGGGGTCAGG - Intronic
1137496161 16:48970986-48971008 CTGGGGATGGGATGTGGTTCAGG + Intergenic
1137722135 16:50633529-50633551 CTAGGGAGGGGAGGAGGGCCGGG - Exonic
1141201093 16:81898424-81898446 CTAGTAAGGGTGTGTGGATCAGG + Intronic
1141526175 16:84613502-84613524 CTAGAGAGGAGATATGGGTGGGG + Intronic
1141618106 16:85221610-85221632 CTCGTCAGGGGATGTGGGTAGGG - Intergenic
1141664729 16:85460115-85460137 CTGGTCAAGGGATGTGGGCCAGG - Intergenic
1142096106 16:88240823-88240845 CTGGGGAGGGGAAGTGGGCCGGG - Intergenic
1142141285 16:88473874-88473896 CCAGGGATGGGATGTGGGTGGGG - Intronic
1142818031 17:2443335-2443357 CTAGTGAAGTGACTTGGGTCTGG - Intronic
1143181721 17:4987705-4987727 CAATTAAGGGGATGAGGGTCAGG + Intergenic
1143575752 17:7792229-7792251 CTAAGGAGGGCATGTAGGTCAGG - Intronic
1144690452 17:17259031-17259053 CTAGAGAAGAGAGGTGGGTCGGG - Intronic
1146395366 17:32460870-32460892 AAAGTGAGGGCATGTGAGTCGGG + Intronic
1147716879 17:42514458-42514480 CTGGTGAGGGGCAGTGGGGCAGG + Exonic
1148166925 17:45490398-45490420 CTGGTGAGGGGATGCGGGCGCGG + Intronic
1148842039 17:50505164-50505186 ATTGTTAGGGGATGGGGGTCGGG + Intergenic
1148853714 17:50567259-50567281 CTTGTGAGGGGGTGGGGGTTAGG + Intronic
1150132764 17:62678284-62678306 CTGGTCAGGGGATGGGGCTCAGG + Intronic
1150398104 17:64836802-64836824 CTGGTGAGGGGATGCGGGCGCGG + Intergenic
1151179203 17:72313513-72313535 CAAGAGAGGGGATGGGGATCAGG - Intergenic
1151529866 17:74697324-74697346 CTAGGGCAGGGATGTGGGGCTGG - Intronic
1151674182 17:75589362-75589384 CGAGCGAGGGGACGAGGGTCGGG + Intergenic
1151890256 17:76947326-76947348 CAGGTGAGGGGGTGAGGGTCAGG + Intronic
1153969786 18:10215766-10215788 CCAGTGAGGGGATGGGAGTGGGG - Intergenic
1155429837 18:25743843-25743865 CTGGTGAGGGGGGATGGGTCAGG - Intergenic
1156529996 18:37805977-37805999 CCAGTGAGGAGGTATGGGTCAGG + Intergenic
1157271751 18:46281682-46281704 CTAGACTGGGCATGTGGGTCCGG + Intergenic
1157881099 18:51321707-51321729 CTAATGGGGGGATGTGGGCAAGG + Intergenic
1158391162 18:57046390-57046412 CTGGTGAGGGGAGGTGGGAAGGG + Intergenic
1160176063 18:76595340-76595362 GTAGTCAGGGGATGGGGGTAGGG + Intergenic
1160768959 19:821895-821917 CAGGTGAGGGGCTGTGGGGCTGG - Exonic
1163718054 19:18883886-18883908 CTGAGGAGGGGATGTGGGCCCGG - Intronic
1163949659 19:20571891-20571913 CCAGTGAGGAGAGATGGGTCAGG + Intronic
1164254771 19:23517928-23517950 CTGGTGAGGGGCATTGGGTCAGG + Intergenic
1166430729 19:42724685-42724707 CCTGTGAGGGAATGTGGGGCAGG - Intronic
1166451195 19:42902720-42902742 CCTGTGAGGGAATGTGGGGCAGG - Intronic
1166463438 19:43010701-43010723 CCTGTGAGGGAATGTGGGGCAGG - Intronic
1167002316 19:46753272-46753294 GTAGAGACGGGATGTTGGTCAGG - Intronic
926108015 2:10164672-10164694 CTAGGGGAGGGATGTGGGTGTGG + Intronic
926305302 2:11633764-11633786 CTAGTGAGGAGGGGTGGGGCTGG - Intronic
926453862 2:13040384-13040406 CCAGTGAGGGGGAGTGGATCAGG - Intergenic
926923102 2:17958899-17958921 ATGGTGAGAGGATGTGGGTCAGG + Intronic
927032887 2:19140900-19140922 CTAGAAAGGGGAGGTGGGTAAGG + Intergenic
927769369 2:25845711-25845733 GTAGTGAAGGGATGTGGGGATGG - Intronic
929318092 2:40505203-40505225 GTAGTTAGGGGATGTGGGGAAGG + Intronic
930766521 2:55090838-55090860 CAACTGAGTGGATGTGGGGCTGG - Intronic
931560417 2:63555253-63555275 CTAGTGAGGAGGGATGGGTCAGG - Intronic
931578171 2:63742512-63742534 TTAGTGAGAGGATATGGATCAGG - Intronic
932417161 2:71580373-71580395 GAAGTGCAGGGATGTGGGTCAGG + Intronic
932620915 2:73264564-73264586 CTGGTGTGGGGATGTGTGTGGGG + Intronic
932821856 2:74908376-74908398 ATTGTGAGGGGATGTGGGCGGGG - Intergenic
933609844 2:84422420-84422442 CTGGGGAGGGGATGTGAGTTGGG - Intergenic
935586814 2:104807992-104808014 TTAGTGAGGGTATGGGGGCCAGG + Intergenic
935828424 2:106974417-106974439 CTAGGGAGGGGGTGTGGCCCTGG + Intergenic
935834648 2:107037239-107037261 CCAGTGAGGGGATATGGGAAAGG - Intergenic
941304921 2:163852051-163852073 TTAGTGAAGGTATCTGGGTCTGG - Intergenic
943250739 2:185518653-185518675 CCAGTGAGGGGGCATGGGTCAGG + Intergenic
943968701 2:194374412-194374434 CTAGTGAGTGGATGTGGATGGGG - Intergenic
944667049 2:201967371-201967393 CTAGCCAGGGGATGTGGGCAAGG - Intergenic
946970431 2:225084753-225084775 CTAGTGGGGCGATGTGGGGAAGG - Intergenic
947992631 2:234498526-234498548 CTACTGAGTGGATTTGGGGCTGG + Intergenic
948802614 2:240439735-240439757 CTGGTGAGGGGCTGTGTGCCAGG - Intronic
948818931 2:240528679-240528701 CTGGTGGGGGGATGTGGCTGGGG - Intronic
1169076474 20:2762928-2762950 CAGATGAGGGGATGTGGGTGGGG + Intergenic
1172887098 20:38238836-38238858 CTGCTGAGGGGATCTGGGTTTGG - Intronic
1173178397 20:40783013-40783035 CAAGTTAGGGTAAGTGGGTCAGG + Intergenic
1174148431 20:48468794-48468816 CAGGTGAGGGCAAGTGGGTCAGG - Intergenic
1174973561 20:55305641-55305663 CCAGTGAGGAGAGATGGGTCAGG - Intergenic
1175404458 20:58717430-58717452 CCAGGGAGGGGGTGTGGGTGGGG - Intronic
1175782221 20:61689994-61690016 CTGGTGAGGTGATGTGGATTCGG + Intronic
1176413400 21:6461132-6461154 CCAGGGAGGGGTTGCGGGTCTGG - Intergenic
1179540236 21:42079118-42079140 CTAGTGAGGGGAGGAGGCCCTGG + Intronic
1179688897 21:43069455-43069477 CCAGGGAGGGGTTGCGGGTCTGG - Intronic
1180185034 21:46135282-46135304 CTGGTGAGGGGATGCTGGTGTGG - Intergenic
1181644930 22:24225992-24226014 CAAGTGAGGGGACATGGGGCTGG + Intronic
1181956756 22:26592821-26592843 CCAGAGAGGGGATGTGGGCATGG + Intronic
1182668343 22:31975031-31975053 CTGGTGGAGGGATGTGGGTAGGG + Intergenic
1182927595 22:34140118-34140140 CTACTCAGGGGGTGGGGGTCAGG + Intergenic
1182967839 22:34539213-34539235 CTAGTGAGAGGTTGTGGCACAGG - Intergenic
949159144 3:859521-859543 CTAGTGTGAGGGTGTGGATCTGG - Intergenic
949592741 3:5510727-5510749 CCAGTGAGGGGAGACGGGTCAGG - Intergenic
951432863 3:22628241-22628263 CCAGTGAGGGGGGATGGGTCAGG + Intergenic
952463322 3:33552854-33552876 CTAATGAGGGGATGTGGAATGGG - Intronic
953196508 3:40739200-40739222 GAAGTAAGGGGATGTGGGTAAGG + Intergenic
954038864 3:47869134-47869156 CAAGAGAGGGCATGTGGCTCAGG + Intronic
954330756 3:49888994-49889016 CTGGTGAGGGGATGTGAGCTTGG - Intronic
954708776 3:52494875-52494897 CTAGTGAGGGGATGTGGGTCTGG + Intergenic
955225589 3:57057609-57057631 CTTGTGTGGGGGTGTGGGTGTGG - Intronic
955749190 3:62170052-62170074 TTAGTGAGGAGAAGTGAGTCAGG + Intronic
961190855 3:124960216-124960238 TTAGTGAGGTCATGTGGGCCAGG - Intergenic
961458241 3:127034689-127034711 CTATGGAGGGGCTGTGGGCCAGG + Exonic
966931567 3:184678913-184678935 CTGGAGAGGGGGTGTGGGGCTGG - Intronic
967221031 3:187248299-187248321 CTAGTGAGGGGATTGGGTTGGGG + Intronic
968375500 4:37073-37095 TTACTGAGGGGATTTGGGTTTGG + Intergenic
969071357 4:4541971-4541993 CTAGTGTGGGGCTGAGGGTGCGG - Exonic
971329019 4:25667008-25667030 CTGGTCAGGGGCTGTGGCTCAGG - Intronic
971452151 4:26810234-26810256 GGAGTGAGGGGAAATGGGTCAGG - Intergenic
972235416 4:37127669-37127691 CCAGTGAGGGCATCTGGGCCTGG - Intergenic
972300375 4:37779972-37779994 CTTATTAGGGGATTTGGGTCAGG + Intergenic
972979575 4:44678945-44678967 CTAGTGAGGAGTGGAGGGTCGGG - Intronic
974090600 4:57306503-57306525 CTAGTGTGGGGGTGAGGGGCAGG + Intergenic
974400405 4:61397415-61397437 CAAGTGTGGGGATGTGGGGTGGG + Intronic
975815915 4:78216806-78216828 AGAGTGAGAGGAAGTGGGTCAGG + Intronic
978270634 4:106885354-106885376 CCTGTCAGGGGGTGTGGGTCTGG + Intergenic
980661604 4:135866601-135866623 CTAGTGAGTGGAAGTTGGTGGGG - Intergenic
981001589 4:139833796-139833818 CTACTGATGGGATGGGGGTGGGG + Intronic
982063721 4:151631483-151631505 CCAGTGAGGCCATCTGGGTCTGG - Intronic
987540326 5:19246555-19246577 CTATTGGGGGGTTGTGGGTGAGG + Intergenic
992506871 5:77395727-77395749 CTGGTGAGGGGGTGGGGGTGGGG - Intronic
992630529 5:78675835-78675857 CTGAGGAGGGGATGTGGGTGGGG + Intronic
992752147 5:79871650-79871672 CTAGGGAGGGGAACTGGGTGAGG - Intergenic
993036494 5:82763318-82763340 CTAGTGAAGCCATCTGGGTCTGG + Intergenic
993950224 5:94165860-94165882 GTAGTGAGGGGCTGAGGGTGAGG + Intronic
996485093 5:124024289-124024311 CTAGAGAGGGCAGCTGGGTCAGG - Intergenic
997363541 5:133310910-133310932 TCAGTGAGGGGAGGTGGGTGGGG + Intronic
998006597 5:138661349-138661371 CAAGTCAGGGGGTGTGGGTTGGG + Intronic
1000254872 5:159527846-159527868 CTAGTGGTGTGATGTGGGTGGGG + Intergenic
1000508022 5:162146149-162146171 CTGGGGAGGTGATATGGGTCTGG - Intronic
1000655522 5:163873945-163873967 CCTGTCAGGGGATGGGGGTCTGG + Intergenic
1001912852 5:175535281-175535303 CCAGTCAGGGGGTGTGGGGCTGG - Intergenic
1002369700 5:178741930-178741952 CTAGTGTTGGGAGGTGGGCCTGG - Intergenic
1004008324 6:11657306-11657328 TTAGTGAGGGGATGTGGGTCTGG + Intergenic
1006145745 6:31958732-31958754 CTAGCGAGGGTAGGGGGGTCGGG - Intronic
1006360455 6:33584357-33584379 CAAGTGAGGGGTTGTGGATGGGG + Intergenic
1006602908 6:35237708-35237730 CTTGTGAGGGGATGGGGGTTGGG + Intronic
1006651756 6:35557431-35557453 CAAGTTAGGGGAAGTGGGTCTGG + Intergenic
1007258174 6:40542986-40543008 TAAGTGACGGGATGTGGGACTGG - Intronic
1007350072 6:41265883-41265905 AGAGTGAGGGGATGGGGGTGGGG + Intergenic
1008899058 6:56590697-56590719 CTAGGGAGATGATGTGGGCCAGG - Intronic
1009888742 6:69655771-69655793 CCAGTGAGGAGAAGTGGATCAGG - Intergenic
1014207866 6:118676333-118676355 CTAGAGAGGGGATGAGGGTAGGG - Intronic
1014619792 6:123652676-123652698 CAAGTGAAGGTATCTGGGTCTGG - Intergenic
1016211864 6:141546266-141546288 CTAGTGAATTTATGTGGGTCTGG + Intergenic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1021574139 7:22092206-22092228 CTAGTCAGGAGAGGTGGGCCAGG + Intergenic
1022113898 7:27246681-27246703 CTGGTGGGGGGCGGTGGGTCCGG - Intronic
1024533510 7:50411476-50411498 CTAGAGAAGGGCTGTGGGGCAGG + Intergenic
1024631988 7:51256582-51256604 CGATTGAGTGGATGTGGATCCGG - Intronic
1026067600 7:67089163-67089185 CGAGGGAGGGGTTGTGGGGCTGG - Intronic
1026709326 7:72723168-72723190 CGAGGGAGGGGTTGTGGGGCTGG + Intronic
1027135173 7:75618798-75618820 CTAGTGCTGGGATGTGGCTGGGG - Intronic
1027234913 7:76292392-76292414 GTGGTGAGGGGATGGGGGACAGG - Intergenic
1028177072 7:87671952-87671974 CCAGTGAGGAGAAGTGGGACTGG + Intronic
1028644149 7:93076772-93076794 CCAGTGAGGAGATATGGGTCAGG - Intergenic
1029730672 7:102435921-102435943 AAGGTAAGGGGATGTGGGTCAGG - Intronic
1031739995 7:125418177-125418199 ATAGTGAGGGGATGGTGTTCAGG - Intergenic
1032095616 7:128937347-128937369 GTAGTGAGAGGAGGTGGGACAGG + Intergenic
1034520751 7:151617380-151617402 CGAGTGTGGGGAAGTGGGTGAGG + Intronic
1037206263 8:16323256-16323278 CCTGTCAGGGGATGGGGGTCTGG + Intronic
1037764708 8:21765404-21765426 CAAGAAAGGGGAAGTGGGTCAGG - Intronic
1038878364 8:31577971-31577993 TGACTGAGGTGATGTGGGTCAGG + Intergenic
1039912802 8:41838137-41838159 AAAGTGAGGGGATGGGTGTCTGG - Intronic
1040530317 8:48261318-48261340 CCAGTCAGGGGGTGTGGGACAGG + Intergenic
1042309111 8:67362512-67362534 GTATTGAGGGGAGGAGGGTCTGG + Intergenic
1046038601 8:108874872-108874894 CTAGGGAAGGGATATGAGTCAGG - Intergenic
1046641183 8:116733437-116733459 CTAATGAGGTGATTTAGGTCAGG - Intronic
1048223634 8:132565187-132565209 CCACTGAGGAGATGTGAGTCTGG - Intergenic
1048571697 8:135662287-135662309 CTCCTGAGAGGCTGTGGGTCAGG - Intergenic
1048847056 8:138611815-138611837 CTAGAGAGGGGGTGTGTGGCAGG - Intronic
1050398151 9:5222293-5222315 CTAGAGAGGAGGAGTGGGTCAGG - Intergenic
1050934888 9:11383209-11383231 GTAGTGAGGGGGTGTGGGCATGG + Intergenic
1051884191 9:21872876-21872898 CTCGGGAGGGAATGTGAGTCTGG + Intronic
1052856089 9:33407627-33407649 CTGGTCAGGGGCTGTGGGTCGGG + Intergenic
1054628492 9:67422360-67422382 CTGGGAAGGGCATGTGGGTCAGG - Intergenic
1055208372 9:73761371-73761393 CTAGTGTGGGGGTGTGTGTGTGG + Intergenic
1058045567 9:100353149-100353171 CAACTTAGGGGATGTGGGCCTGG + Intergenic
1058417313 9:104802456-104802478 CTCGTGTGTGAATGTGGGTCTGG + Intronic
1058572164 9:106358637-106358659 CAAGTGAGTGGATGTTGGTGGGG + Intergenic
1059576417 9:115493655-115493677 CTAGAGAGGGGATGTGTGAGTGG - Intergenic
1060554115 9:124499619-124499641 CTAGTGTTGGGAAGGGGGTCCGG - Intronic
1061867130 9:133498243-133498265 CTAGTGAGGGGCTGTGGAGGAGG + Intergenic
1062157679 9:135062489-135062511 CTCGTGAGGTGATGTGGGATCGG + Intergenic
1062483552 9:136763327-136763349 CCAGTGCGGGGAGGTGGGACAGG + Intronic
1203573727 Un_KI270744v1:157071-157093 TTACTGAGGGGATTTGGGTTTGG - Intergenic
1203672236 Un_KI270755v1:26294-26316 CCAATGAGAGGATGTGGGTGGGG + Intergenic
1188099923 X:26071257-26071279 CTGGTGAGGAGGTGTGGATCAGG + Intergenic
1190530901 X:51375009-51375031 GTAGTGAGGGTATGGGGGTGGGG + Intergenic
1192203970 X:69084081-69084103 CTGGTGAGTGGAGGTGGGTGAGG - Intergenic
1193762863 X:85488969-85488991 CCAGTGAGGGGCTATGGATCAGG + Intergenic
1195094620 X:101492179-101492201 CTAGTGAGGGGACCTGGGCTGGG + Exonic
1195105806 X:101600612-101600634 CCAGTCAGGGGATGAGGGGCAGG - Intergenic
1195107077 X:101613155-101613177 CCAGTCAGGGGATGAGGGGCAGG + Intergenic
1195148682 X:102043814-102043836 CCAGTGAGTGGATGTAGGACAGG - Intergenic
1195309921 X:103622334-103622356 CTAGTGAAGACATCTGGGTCTGG - Intronic
1197954725 X:131933493-131933515 CTAATGAGGGCATCTGGGTATGG - Intergenic
1198513511 X:137378852-137378874 GTAGTCAGGGGATGTGATTCTGG - Intergenic
1199499996 X:148498443-148498465 CCAGTGAGGTGATGGGGGGCTGG + Intergenic
1199746560 X:150775549-150775571 CTAGTAAAGGGTGGTGGGTCGGG + Intronic
1199773337 X:150989265-150989287 CCAGTGAGGGTATGTGGGATGGG + Exonic
1200243288 X:154508711-154508733 CAAGTAGGGGGATGTGGCTCAGG + Intronic
1202270936 Y:23073416-23073438 CTAGTGTGGGAAGGAGGGTCAGG + Intergenic
1202295090 Y:23347266-23347288 CTAGTGTGGGAAGGAGGGTCAGG - Intergenic
1202423931 Y:24707160-24707182 CTAGTGTGGGAAGGAGGGTCAGG + Intergenic
1202446858 Y:24962925-24962947 CTAGTGTGGGAAGGAGGGTCAGG - Intergenic