ID: 954709405

View in Genome Browser
Species Human (GRCh38)
Location 3:52497871-52497893
Sequence CAACAGGACTGGAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954709402_954709405 -5 Left 954709402 3:52497853-52497875 CCTGTTCAGTAAGGGCAGCAACA 0: 1
1: 0
2: 0
3: 13
4: 119
Right 954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG 0: 1
1: 0
2: 3
3: 24
4: 267
954709398_954709405 4 Left 954709398 3:52497844-52497866 CCCGGGTAACCTGTTCAGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG 0: 1
1: 0
2: 3
3: 24
4: 267
954709400_954709405 3 Left 954709400 3:52497845-52497867 CCGGGTAACCTGTTCAGTAAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG 0: 1
1: 0
2: 3
3: 24
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954709405 Original CRISPR CAACAGGACTGGAGTGAAGA TGG Intronic
900509788 1:3053132-3053154 CCACTGGACTGGAGGGACGAGGG + Intergenic
900819845 1:4878259-4878281 ACACAGGTGTGGAGTGAAGAGGG + Intergenic
902071885 1:13747082-13747104 CAACTGCAGTGGAGTGAACAGGG + Intronic
902121455 1:14169491-14169513 CAACTGGAGTGGAGTGAAGAGGG + Intergenic
902290839 1:15433664-15433686 CACCAGGCCTGGAGTCAGGAGGG + Intergenic
904405552 1:30285954-30285976 CAAGAGGCCAGGAGGGAAGACGG + Intergenic
904534461 1:31190081-31190103 CAACAGAAGAGGAGAGAAGAGGG + Intronic
905485459 1:38292763-38292785 CAACAGCACAGGAGTGCAAAAGG - Intergenic
905987195 1:42296800-42296822 AAACAGCACTGGAGTGCATATGG - Intronic
906682430 1:47738488-47738510 AAACAGAACTGGAGAGAAGAAGG + Intergenic
906685532 1:47760939-47760961 CAGCAGGACTGGGATGAAGGGGG + Exonic
913446652 1:118957368-118957390 GACCAGGACTGGAGTGAGGTGGG + Intronic
915207661 1:154282664-154282686 GAACAGTACTGCAGTGAACATGG - Intergenic
917043056 1:170827810-170827832 GTGCAGGACTGGAGTGAGGAAGG + Intergenic
918051480 1:180976600-180976622 CAACAGGACTGCAAAGAGGATGG + Exonic
919035760 1:192307408-192307430 GAACAGGACTGTGGTGATGAAGG - Intergenic
919338000 1:196265106-196265128 CAACAGGACTGGATTTGGGATGG + Intronic
919797104 1:201327462-201327484 CAACAGCACTGCATTGAAGATGG + Intronic
919865572 1:201780398-201780420 CTACAGGACAGGAGAGATGAAGG - Intronic
920708813 1:208275628-208275650 GCACAGGAATGGAGGGAAGAAGG - Intergenic
921774782 1:219084403-219084425 TAATATGACTGGAGTGAAGTGGG - Intergenic
921824336 1:219655288-219655310 CAACACAGCTGGAGTGCAGAAGG + Intergenic
922157972 1:223054652-223054674 CAACTGCACAGGACTGAAGAAGG + Intergenic
922975792 1:229782365-229782387 AAACAGGAGTGGCGGGAAGAGGG + Intergenic
923900162 1:238317450-238317472 GCACAGAACTCGAGTGAAGAAGG - Intergenic
1063494033 10:6490263-6490285 GAACAGGATTGGGATGAAGAAGG + Intronic
1063497575 10:6524715-6524737 CACCAGTACTGATGTGAAGAAGG + Intronic
1063989022 10:11539298-11539320 CATCAGATCTGGAGTGAAAAGGG - Intronic
1065701527 10:28430501-28430523 CCACAGAATTGGAGAGAAGAGGG - Intergenic
1066177774 10:32927304-32927326 CAACAGGAGTGGAGAGAAGCAGG + Intronic
1067928984 10:50540669-50540691 CACCATGACTGGATTGAAGAGGG + Intronic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1070526162 10:77297796-77297818 AAACATGACAGGAGTGGAGAAGG + Intronic
1071087137 10:81876469-81876491 CAGCAGGTCTGCAGTGAGGAGGG - Intronic
1072067459 10:91884761-91884783 GAACAGGAATTGAGAGAAGAGGG + Intergenic
1072552646 10:96491002-96491024 CGACATGGCTGTAGTGAAGAGGG + Intronic
1073637065 10:105210088-105210110 CAACAGGAATGAAGGGGAGAGGG - Intronic
1074039623 10:109775396-109775418 AACCAAGACAGGAGTGAAGATGG + Intergenic
1074107612 10:110400234-110400256 CACCTGGAGTGGATTGAAGAAGG - Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075597648 10:123743799-123743821 AGACAGGACTGGAGAGAAGCAGG + Intronic
1075665135 10:124224437-124224459 CAACAGGGCTGGGGTGGAGTGGG + Intergenic
1075859540 10:125662595-125662617 AAACAGGACTGGGCAGAAGAGGG + Intronic
1077758889 11:5068701-5068723 CAACAGATCTGAAATGAAGAGGG + Intergenic
1078406780 11:11077057-11077079 CAACAGTGCTGGAGTGAAAGAGG - Intergenic
1079997300 11:27307586-27307608 CAACATGACTGGAATGATTATGG + Intergenic
1080788682 11:35499671-35499693 AAACAGTAATGGAGTAAAGAGGG - Intronic
1080882488 11:36335531-36335553 AAACAGGACTGGTGTGCAGCAGG + Intronic
1085374944 11:76051980-76052002 CAACAGAACTGGACTGAAGGAGG - Intronic
1088325459 11:108596239-108596261 CAAGAAGAGTAGAGTGAAGATGG + Intergenic
1088456492 11:110038115-110038137 CCACAGGTCTGGAATGAAGTGGG - Intergenic
1088760357 11:112923463-112923485 CAACAGGACTTGCGGGAGGAGGG + Intergenic
1089640813 11:119846032-119846054 CAACAGGTCTGCTGTGAAGCCGG + Intergenic
1091038580 11:132255823-132255845 CAACAGGACGGCAGTGGAGCAGG - Intronic
1091494872 12:963853-963875 CAGCAGAACTAGAGTGACGAGGG + Intronic
1094150866 12:27281442-27281464 CAACAGCTCTAGAGTGAACAGGG + Intronic
1094452459 12:30597081-30597103 CAGCAGGCATTGAGTGAAGAAGG + Intergenic
1096265630 12:50120296-50120318 CAACAGGACTAGAGCGTTGATGG + Exonic
1096362699 12:51001906-51001928 CAAAAGGACTCAAGGGAAGATGG + Intronic
1097054538 12:56241819-56241841 AAACTGGGCTGGAGTGAAGAGGG - Exonic
1097860573 12:64514557-64514579 CATCAGGTCTGGACTGCAGAGGG + Intergenic
1099046586 12:77728171-77728193 TAACAGGACTGGAGTGAGCTGGG - Intergenic
1099671479 12:85699798-85699820 CAAAGGGAATGGAGTTAAGAGGG - Intergenic
1101521574 12:105487053-105487075 TAACAGGATTGTAGTCAAGATGG + Intergenic
1103832470 12:123790749-123790771 AAAGAGGACAGGAGTGAGGAAGG + Intronic
1103855008 12:123961315-123961337 AATAAGGACTGGAGTGAAAAAGG + Intronic
1103880189 12:124160040-124160062 CAACAGCACTCCAGTGATGATGG + Intronic
1104241820 12:126997497-126997519 CAACTTGACTGGATTGAAGGAGG + Intergenic
1110030886 13:70611861-70611883 CCACTGGACAGGAGTGTAGAGGG - Intergenic
1111796504 13:92927333-92927355 CACCCAGACTGGAGTGAAGTGGG - Intergenic
1112497252 13:99915090-99915112 GCACAGGACGGGAGTGAAGCTGG - Intergenic
1113440464 13:110324364-110324386 CAGCAGGACAGGTGTCAAGAAGG - Intronic
1113587779 13:111477016-111477038 CAAGAGGAATAGAGTGAAGGGGG - Intergenic
1116495812 14:45558911-45558933 CAACAGGAAAGGTTTGAAGAAGG - Intergenic
1117838914 14:59836824-59836846 GAAAAGGAAGGGAGTGAAGAGGG + Intronic
1117894390 14:60465640-60465662 TAGCAGGATTGGATTGAAGAGGG - Intronic
1119034020 14:71215018-71215040 CAACAGGACACGAGTAGAGACGG + Intergenic
1119092844 14:71800888-71800910 CAACAGGATTGTTGTGAGGAAGG + Intergenic
1120515165 14:85461991-85462013 CACCAGGACTGGAAAGAACAAGG + Intergenic
1120731770 14:88011275-88011297 CAACATGACAGCATTGAAGATGG - Exonic
1121485868 14:94313888-94313910 CAGCAGGATTGTGGTGAAGATGG + Intronic
1121557572 14:94849928-94849950 AAACAGGCCTGGAGTAAAGACGG + Intergenic
1122444468 14:101759383-101759405 CTACAGGACTGGGGTGAGGGGGG - Intergenic
1122521731 14:102348863-102348885 CAACAGCACTGAGGGGAAGAAGG + Intronic
1123420216 15:20125127-20125149 GGACAGGACTGGAGAGGAGAAGG + Intergenic
1123445645 15:20328405-20328427 GGACAGGACTGGAGAGGAGAAGG - Intergenic
1123529440 15:21131663-21131685 GGACAGGACTGGAGAGGAGAAGG + Intergenic
1125612226 15:40979342-40979364 CAGCAGGAGTGAGGTGAAGAGGG - Exonic
1126148891 15:45504034-45504056 CAAATGGTCTGGAGTGAAGAAGG - Intronic
1130036103 15:80362995-80363017 AAACAGGAGGGGATTGAAGAAGG + Intronic
1130079730 15:80722059-80722081 TAACAGGGCTGCAGGGAAGATGG - Intronic
1130326201 15:82882278-82882300 CCACAGGCCTGGAGAGAAGGTGG + Intronic
1130391855 15:83463696-83463718 AAATAGGACAGGGGTGAAGAGGG - Intronic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1136629610 16:31482153-31482175 GCACAGGACTGGATTCAAGAAGG - Intergenic
1137493758 16:48953062-48953084 CAACCTGTTTGGAGTGAAGATGG - Intergenic
1138219192 16:55236619-55236641 CAGCAGGGATGGAGTGAAAAAGG + Intergenic
1138531141 16:57635050-57635072 GAAGAGGACTGGAGTGAACAGGG + Intronic
1138836460 16:60441946-60441968 CTACAGAACTGGATAGAAGAAGG - Intergenic
1140145393 16:72301841-72301863 CAACAGCACAGGGATGAAGAGGG - Intergenic
1140161514 16:72500132-72500154 ACACAAGACAGGAGTGAAGAAGG - Intergenic
1140264402 16:73408019-73408041 CAAGAGGAGGGGAGTGAAAAGGG + Intergenic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1145236099 17:21209367-21209389 CCAGAGGACTGCAGTGAAGATGG + Intronic
1145855344 17:28151144-28151166 CAACAGACCTGGAGTGATGCAGG + Intronic
1146963294 17:37003514-37003536 CACCAGGGCTGGAGTGCAGTGGG + Intronic
1148835298 17:50462778-50462800 CAAGAGGGCTGGAGTGGAGAGGG - Intronic
1148921060 17:51034607-51034629 AAACTGGACTGGAGGGAAGGAGG + Intronic
1149077929 17:52618215-52618237 CAACTTGATTGGATTGAAGATGG - Intergenic
1149190929 17:54060866-54060888 CAACAGCACTGGAGTAGAGAAGG + Intergenic
1149555926 17:57573579-57573601 CAGCAGGTCTGGAGTGATGGGGG - Intronic
1151506091 17:74528236-74528258 CATCAGGAGTGGGGTGAGGATGG - Intronic
1152366719 17:79860642-79860664 CAACAGGACGGCCCTGAAGATGG - Intergenic
1152759681 17:82101349-82101371 CAACACCACTGGTGTGCAGATGG + Intergenic
1156372154 18:36481155-36481177 CAACAGGACTGAAGGAAGGAGGG + Intronic
1157788308 18:50506760-50506782 CACCAGGACTGAAGTCAAAATGG - Intergenic
1158070235 18:53462028-53462050 GAAGAGGGATGGAGTGAAGAGGG + Intronic
1159551189 18:69897094-69897116 TGAGAGAACTGGAGTGAAGAGGG - Intronic
1159882417 18:73871108-73871130 CAATAGGAAAGGAATGAAGAAGG + Intergenic
1160532678 18:79574823-79574845 CAACAGGACTGAGGTGGAAATGG - Intergenic
1162362050 19:10226538-10226560 CCAAAGGACTGGAGGAAAGAGGG - Intronic
1162725164 19:12685896-12685918 CACCAGGGCTGGAGTGCAGTGGG + Intergenic
1163489587 19:17609420-17609442 GGACAGGAGTGGAGTGTAGATGG - Intronic
1164035094 19:21446775-21446797 CAACAGTGCTGGAGTGGATATGG - Intronic
1164821360 19:31253824-31253846 CAAAGGGACAGGAATGAAGAGGG + Intergenic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG + Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168001801 19:53452440-53452462 CACCTGGACTGGAGTGTAGTGGG - Intronic
1168280602 19:55303562-55303584 AAACAGGCCTAGAGTGGAGAGGG - Intronic
925501759 2:4512747-4512769 CAGCTGGAATGGAGTGAAGGAGG - Intergenic
925832389 2:7909341-7909363 CAACAGAACTCCAGTGAGGAAGG + Intergenic
927606273 2:24490195-24490217 CAGCAGGACAGGATTGAGGAAGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928477971 2:31650794-31650816 AGACAGGATTGGAGAGAAGAGGG + Intergenic
929502841 2:42504920-42504942 CAGCATGACTGGAGTGAGGCTGG - Intronic
929776481 2:44933853-44933875 GTACAGGACGGAAGTGAAGATGG + Intergenic
931035083 2:58231473-58231495 CAACAGAAGTGTAGTTAAGAGGG - Intronic
932448065 2:71792712-71792734 TAAGAGGACAGGAGTGGAGAAGG - Intergenic
932574700 2:72956223-72956245 CAAGAGGACTGGGGTCCAGAAGG + Intronic
932582189 2:72999232-72999254 GAACAGGGCAGGAGTGAAGTGGG - Intronic
933158702 2:79001390-79001412 CAATAGGAATGAAGAGAAGAGGG - Intergenic
933219847 2:79676264-79676286 GGATAGGACTGGATTGAAGAAGG + Intronic
933301393 2:80545114-80545136 CACAAGGGCTGGAGTGGAGAAGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934476492 2:94597027-94597049 CAGGAGGACTTGTGTGAAGAAGG + Intronic
935947814 2:108301902-108301924 CTAGGGGACTGGAGTGAAGTTGG + Intronic
936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG + Intergenic
937296758 2:120814131-120814153 CAACAGGTCTGGAGTGCAAAAGG - Intronic
937766672 2:125669238-125669260 CAAGAAGACTGGAGTGAAGCAGG - Intergenic
939002591 2:136753611-136753633 CCAGATGACTGGAGTGAAGGGGG - Intergenic
939759660 2:146158626-146158648 TGACAGGACTGGATTGGAGAGGG + Intergenic
941160150 2:162026388-162026410 TAAAAGGACTGAAGTGAAAAGGG - Intronic
946755904 2:222947194-222947216 AGAGAGGACTGGAGTGAGGATGG - Intergenic
1169109720 20:3024376-3024398 GAAATGGACTGGAGTGAAGTGGG + Intronic
1169766971 20:9157074-9157096 TAAATGGAGTGGAGTGAAGAAGG + Intronic
1171126057 20:22603072-22603094 CAGAAGGTCTGGAGTGAGGAGGG + Intergenic
1171139479 20:22728751-22728773 CAAGGGGACTGGAGCTAAGATGG - Intergenic
1172441429 20:34969128-34969150 CCACTGGACTGGAGGAAAGAGGG + Intergenic
1172697224 20:36831238-36831260 GGACAGGATTGGGGTGAAGATGG - Intronic
1173025248 20:39301496-39301518 CAACAGGACAGAAGAGCAGAGGG + Intergenic
1174557898 20:51408883-51408905 CAGCAGGACTGGGGTGGAGGTGG + Intronic
1177132075 21:17271302-17271324 CAACAGGGGTGGAGCCAAGATGG + Intergenic
1177631771 21:23738112-23738134 CTACAGGAATGGATTGAAAATGG + Intergenic
1177719893 21:24892150-24892172 CAACAGGTCAAGAGTGAAGTTGG + Intergenic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1180729864 22:17973202-17973224 CCACAGGGCATGAGTGAAGAGGG - Intronic
1183826636 22:40393485-40393507 CAACTGGAGTGGGTTGAAGAAGG - Intronic
1185117544 22:48946199-48946221 GAACAGGACAGGAGACAAGACGG + Intergenic
1185252250 22:49809692-49809714 CACCATGACTGGAGTGAAGAGGG + Intronic
949093578 3:59436-59458 CTCAAGGACTGGATTGAAGAGGG - Intergenic
950004016 3:9679849-9679871 CAGCAGGGCTGGAGTGTAGCAGG + Intronic
950006517 3:9695022-9695044 CTACAGGACTGGAGAGAACATGG - Intronic
951892782 3:27582593-27582615 CACCAGGTCTGGAGTAAGGAGGG + Intergenic
952279329 3:31908148-31908170 CAACACGGGTGGAGTGAACAAGG + Intronic
954165425 3:48753488-48753510 CAACAGGGCAGAAGTGTAGAAGG - Intronic
954595834 3:51823541-51823563 CAAACTGACTGGAGTGAAAATGG - Intronic
954631714 3:52051296-52051318 CAACAGCACTGCTGTGGAGAGGG + Intronic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
955077761 3:55630029-55630051 TAACAGGACGGAAGAGAAGACGG + Intronic
955523794 3:59800813-59800835 CAACAGGACAGGAGTGCAGGAGG + Intronic
955946404 3:64198703-64198725 CTACAGAACTGGAATGAGGAAGG + Intronic
957478346 3:80756618-80756640 CAACAGCAGTGCAGTGTAGAAGG + Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
959499508 3:107089238-107089260 CCCCAAGTCTGGAGTGAAGAGGG + Intergenic
960088725 3:113617179-113617201 GGACATGACTGGAGTGAACACGG - Intronic
961835948 3:129659744-129659766 CAAAATGGCAGGAGTGAAGATGG - Intronic
961975098 3:131015737-131015759 TAACAGGACTAGAGTGAATGAGG + Intronic
962438908 3:135393953-135393975 TAACAAGAGAGGAGTGAAGAAGG + Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
964768708 3:160202690-160202712 CAGCAGGGCTGGGGTCAAGATGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
967086835 3:186102790-186102812 GAAAATGACTGGAGTGAAGCTGG + Intronic
970767179 4:19563757-19563779 CACCAGGGCTGGAGACAAGAAGG - Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971295597 4:25387194-25387216 CACCAGGGTTGTAGTGAAGAAGG + Intronic
971425977 4:26515902-26515924 CCACAGGAGAAGAGTGAAGATGG + Intergenic
971426104 4:26517262-26517284 CCACAGGAGAAGAGTGAAGATGG - Intergenic
976690790 4:87865048-87865070 CAACATGACTGGAGTAGTGATGG - Intergenic
976822099 4:89218079-89218101 GAACAGCACTGGAGTGAAACAGG - Intergenic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
982487741 4:155988433-155988455 CAGCTGCACTGAAGTGAAGAAGG + Intergenic
982819221 4:159925850-159925872 CACCAAGTCTGGTGTGAAGAGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986263237 5:6167358-6167380 CAGCAGGACTGGGCAGAAGAGGG - Intergenic
986346439 5:6839674-6839696 CAACAGAACAGGAAAGAAGATGG - Intergenic
989699146 5:44240587-44240609 CAACATGATTGGATTGAAGGAGG - Intergenic
990989957 5:61674954-61674976 CTCCAGGACTGGAGAAAAGAGGG + Intronic
992681088 5:79153812-79153834 CAACATGGCTGGAGTAGAGAGGG + Intronic
992842895 5:80713740-80713762 CCATAGGACTGGAGTAAAAATGG - Intronic
993063096 5:83064653-83064675 CAACAGGACTTTACTGAAAAAGG + Intronic
993470506 5:88301948-88301970 TGACTGGACTGGAGTGAACAGGG - Intergenic
994750136 5:103727091-103727113 CAGAAGGTCTGGGGTGAAGATGG + Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
997104752 5:131005921-131005943 CCACAGGACTGGGGTGGTGATGG + Intergenic
998820741 5:146055686-146055708 GATCAGAACTGGAGTGAAAAAGG + Intronic
999682953 5:154076776-154076798 CAAGAGTACTGGGGAGAAGATGG - Intronic
999904942 5:156130604-156130626 CAACTGGCCTGGAATAAAGATGG - Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001940961 5:175739112-175739134 CAATAGGACAGTAGTGAACACGG + Intergenic
1002213246 5:177610626-177610648 CCACAGGACTGGAGAGAGGCAGG + Intergenic
1003236046 6:4295901-4295923 CAGCAGGACTGGGGTGAGGCTGG - Intergenic
1003242725 6:4358646-4358668 CAACAGGACAGGTGCCAAGAGGG - Intergenic
1003706352 6:8535589-8535611 CAACAGGAAATGAGGGAAGAAGG - Intergenic
1005569465 6:27130903-27130925 AAACAGGACTTGAGTCAACAAGG + Intronic
1005723935 6:28630475-28630497 CAACCAGAGTGGAGTGAATATGG + Intergenic
1006910502 6:37560338-37560360 CGACAGGACTGAAATGAAGGGGG + Intergenic
1008041166 6:46799896-46799918 GAACAAGATTAGAGTGAAGAAGG + Intronic
1008533763 6:52490596-52490618 CAACATGTCAGGACTGAAGAAGG + Intronic
1011028065 6:82891249-82891271 CAACACAACTGGAGTGGAGGAGG + Intergenic
1011492457 6:87906554-87906576 CAACAGAACTGGACTTAAGGTGG + Intergenic
1013724501 6:113076908-113076930 CAACAGGACTGGAGATGAGCAGG + Intergenic
1016940419 6:149478804-149478826 CATCAGGTATGGGGTGAAGATGG - Intronic
1018508868 6:164503598-164503620 CAACAGAACTGGACTGAGGCTGG - Intergenic
1018814818 6:167322759-167322781 AAACAGTACTGAAGTAAAGATGG + Intergenic
1019443513 7:1059459-1059481 GAACAGGTCTGCAGTGAGGAGGG + Intronic
1020430829 7:8114562-8114584 TAACAGGAAAGGATTGAAGAAGG - Intronic
1021632836 7:22663891-22663913 CACCATGTCTGGAATGAAGAAGG + Intergenic
1021689746 7:23220553-23220575 CAAAAGGTCTGGAGTGAAAAGGG - Intergenic
1022374139 7:29797688-29797710 CAACAGGCTTGGAGAGAAGTAGG + Intergenic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1024602997 7:51001603-51001625 CAACTTGACTGGATTGAAGAAGG - Intergenic
1027967398 7:85029580-85029602 AAACTGGACTAGAGTGCAGAAGG + Intronic
1028117298 7:87013551-87013573 CAGCAGGGATGGAGTGAGGAAGG + Intronic
1031343433 7:120634548-120634570 CAACAGGTTTGGGGTGAACAGGG - Intronic
1032494151 7:132348450-132348472 GAACAGGTTTGGAGTGAGGACGG - Intronic
1033540339 7:142350169-142350191 CAACATGGCTGGAGTAGAGAAGG - Intergenic
1033903172 7:146168216-146168238 CAACATGATTGGATTGAAGAAGG - Intronic
1034782462 7:153893124-153893146 CAATAAAACTGTAGTGAAGAGGG + Intronic
1035046433 7:155970538-155970560 CAAGAGCCCTGGAGGGAAGACGG - Intergenic
1036106163 8:5842621-5842643 CAACTGGCCTGAAGTGAAGGTGG + Intergenic
1036500315 8:9308133-9308155 CAACAGAACTGTAATGAAGTAGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038349449 8:26762892-26762914 CATCAGGACTGGAGAGAGGAAGG + Intronic
1040980640 8:53242839-53242861 CAAAGGGACTGGTGTGAAGCCGG - Intronic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1043431292 8:80197611-80197633 CACCAGCACTGGAGTAGAGAGGG + Intronic
1046025755 8:108721584-108721606 CAAAGTGACTGGAGTGAGGATGG - Intronic
1046349173 8:112983778-112983800 TAACAGGTCTGGTGTAAAGAAGG + Intronic
1046462045 8:114552132-114552154 CAACTGGAGTGGAGTGAAGAAGG - Intergenic
1047590953 8:126326775-126326797 CAAAAGGAATGGACTCAAGAGGG - Intergenic
1048514810 8:135096618-135096640 CAACAGAAATGGAGTAGAGATGG + Intergenic
1049979659 9:892492-892514 CAACAGAACTGGAGGGCTGAGGG - Intronic
1050592395 9:7173919-7173941 GAACAGGAGTGGAGAGGAGAAGG + Intergenic
1050639003 9:7645500-7645522 CAACTTGACTGGATTGAAGGAGG + Intergenic
1053140554 9:35680098-35680120 CAGCTGGACTGGAGAGAAAAAGG - Exonic
1053681568 9:40489051-40489073 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1053931562 9:43117381-43117403 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054282145 9:63135883-63135905 CAGGAGGACTTGTGTGAAGAAGG + Intergenic
1054294659 9:63324568-63324590 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054392679 9:64629055-64629077 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054427329 9:65134264-65134286 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054503047 9:65887276-65887298 CAGGAGGACTTGTGTGAAGAAGG + Intronic
1055749334 9:79487398-79487420 TAACAGAGCTGGTGTGAAGAAGG - Intergenic
1057194468 9:93109052-93109074 CAACAGAACAGGAGTCAACACGG + Intronic
1058379297 9:104361248-104361270 CAATAGGAATGCAGTGATGAGGG - Intergenic
1058466772 9:105236822-105236844 TAACAGGACTTGAGGGAAGCTGG + Intergenic
1058590254 9:106557901-106557923 CAACAGCACTGTGGTGAACAAGG - Intergenic
1059078125 9:111216876-111216898 CACCAGGACTGCAGAGCAGAGGG - Intergenic
1060123909 9:121023773-121023795 CTACAGGACTGGACTGAGGAAGG + Intronic
1061052094 9:128203071-128203093 AAACAGGCCTGGAGAGCAGATGG - Intronic
1061242255 9:129381556-129381578 ACACAGGACTGGCGTGGAGAGGG - Intergenic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1186315702 X:8367652-8367674 CAACAGAACAGCAGTGAAGAAGG + Intergenic
1190292422 X:49001570-49001592 CATTAGGCCTGGGGTGAAGAAGG - Intronic
1192967044 X:76188702-76188724 CAAGAGGACTGCAGAGGAGAGGG + Intergenic
1193169759 X:78321981-78322003 CAACAGGAGTGGGGTGATGAAGG + Intronic
1194752707 X:97702520-97702542 AAAGAGGACTGGAGTTAAGAAGG - Intergenic
1195202805 X:102566080-102566102 GAACAGGCCTGGAGGGAAAAAGG - Intergenic
1195514138 X:105753199-105753221 CAATAGGACAGGAGTCTAGAAGG + Intronic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1198423717 X:136494971-136494993 CTCCAGGACTGCAGTGTAGATGG - Intergenic