ID: 954709939

View in Genome Browser
Species Human (GRCh38)
Location 3:52500558-52500580
Sequence GCTCAGAGCAGAGTGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954709931_954709939 25 Left 954709931 3:52500510-52500532 CCCTTGCGCTTGGTTAGAGAGGG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 954709939 3:52500558-52500580 GCTCAGAGCAGAGTGGTGGCTGG 0: 1
1: 0
2: 2
3: 41
4: 349
954709933_954709939 24 Left 954709933 3:52500511-52500533 CCTTGCGCTTGGTTAGAGAGGGT 0: 1
1: 0
2: 0
3: 4
4: 64
Right 954709939 3:52500558-52500580 GCTCAGAGCAGAGTGGTGGCTGG 0: 1
1: 0
2: 2
3: 41
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954709939 Original CRISPR GCTCAGAGCAGAGTGGTGGC TGG Intronic
900138524 1:1128968-1128990 GCCCAGGGCACAGTTGTGGCAGG + Intergenic
900968254 1:5974613-5974635 GCTCAGAGCTGAGACGTGTCTGG + Intronic
901442618 1:9287773-9287795 GCTCTGTGCAGAAGGGTGGCAGG + Intergenic
901741404 1:11344283-11344305 GCTCCGAGGAGATGGGTGGCAGG + Intergenic
902172904 1:14627376-14627398 GATGAGATCAGAGGGGTGGCTGG + Intronic
902176782 1:14656374-14656396 GCTCAGAGGAGGATGCTGGCTGG + Intronic
902436043 1:16398579-16398601 TCTGAGAGCCCAGTGGTGGCTGG + Intronic
903217659 1:21852149-21852171 GATCTGAGCTGCGTGGTGGCAGG - Exonic
903226361 1:21896134-21896156 GCTGGGAGCAGAGGGGTGGGGGG - Intronic
903410730 1:23141091-23141113 GGTCAGAGTAGAGGGGTGGTAGG - Intronic
904274159 1:29369512-29369534 GCTCAGAGCAGTGAGGTCACTGG + Intergenic
904364449 1:30001603-30001625 GCTCAGAGCAGTGAGGTCACTGG + Intergenic
904423806 1:30410579-30410601 GCTCAGAGCAGTGAGGTCACTGG - Intergenic
904892231 1:33788135-33788157 CCTCAGAACAAAGAGGTGGCTGG + Intronic
905917594 1:41696392-41696414 TCTAAGAGCACAGTGCTGGCGGG + Intronic
907274767 1:53311086-53311108 GCTCAGAGCAGGCTGGGGTCTGG - Intronic
907762821 1:57378125-57378147 GCTCAGAGCAGGATGGAGGCAGG + Intronic
908443232 1:64176589-64176611 ACACAAAGCAGTGTGGTGGCTGG - Intronic
908827975 1:68151832-68151854 GCTTTGAGCAGAGGGGTGACAGG + Intronic
909463333 1:75943933-75943955 GCTCAGATGCCAGTGGTGGCAGG - Intergenic
909556903 1:76964084-76964106 GCTAAGATCAAAGTGTTGGCAGG - Intronic
910593256 1:88950907-88950929 GCTAAGATCAGAGAGGTAGCTGG - Intronic
910682054 1:89876561-89876583 GGTTAGAGCAGAGAGGTGGCAGG + Intronic
912300564 1:108511860-108511882 TGTCATAGCAGAGTGGAGGCTGG - Intergenic
913319107 1:117576254-117576276 GGATAGAGCAGAGTGGAGGCAGG + Intergenic
914871295 1:151476959-151476981 GCTTAGATTAGAGTCGTGGCAGG - Intergenic
918078935 1:181190985-181191007 GCTCAGAGCTGAAGGGTGGACGG + Intergenic
918573039 1:186021414-186021436 GCTCAAAGGAGAGTTCTGGCTGG + Intronic
919044937 1:192439436-192439458 CCTGAGTTCAGAGTGGTGGCTGG - Intergenic
920266232 1:204725456-204725478 GCTAAGAGGAAACTGGTGGCTGG - Intergenic
923112291 1:230901904-230901926 CCTCAGTGGAGAGTGGTGGTGGG - Intergenic
924638650 1:245812487-245812509 GCTGAGAGGACAGTGGTGGTTGG - Intronic
1063076989 10:2727183-2727205 GGTCAGAGAAGAGTAGAGGCTGG - Intergenic
1063292155 10:4760816-4760838 GCTCAGTGCAGAAGGGTGGGAGG - Intergenic
1065947141 10:30615348-30615370 GCAGAGAGTAGAGCGGTGGCTGG + Intronic
1067028289 10:42862825-42862847 GCGCAGGCCAGACTGGTGGCTGG - Intergenic
1068818343 10:61343998-61344020 GCTAAAAGCAAAGTGATGGCAGG - Intergenic
1069568239 10:69478092-69478114 TCCCAGAGCAGGGTGCTGGCGGG - Intronic
1069855086 10:71435790-71435812 GCACAGAGCAGAGTGAGGTCAGG + Intronic
1070305148 10:75235200-75235222 GCTCAGCCCAGAGTGGGGGTCGG + Intronic
1070332772 10:75430270-75430292 GCGGAGGGCAGAGTGCTGGCTGG + Intergenic
1070817781 10:79336083-79336105 GCTCAGGGGAGAGAGGTGGGAGG - Intergenic
1070968202 10:80542927-80542949 GCTCAGAGCACTCTGCTGGCTGG - Intronic
1071296651 10:84225410-84225432 GCTCAGAGGAGAGTTTTGGCAGG - Exonic
1072742919 10:97921021-97921043 GCACATGGCAGAGTGGGGGCGGG + Intronic
1072811804 10:98467956-98467978 GCCCAGCGCCGAGTCGTGGCGGG - Intronic
1072847995 10:98853794-98853816 GCTCAGAGCAAAGTCATGACTGG - Intronic
1073467788 10:103704399-103704421 GCTGAGACCACACTGGTGGCTGG + Intronic
1073802333 10:107055790-107055812 GCTCTTAGCAGACTGGTGCCTGG - Intronic
1076737991 10:132467269-132467291 GCTGAGAGCACTGAGGTGGCTGG - Intergenic
1077012865 11:386641-386663 GCTCTCAGCAGAGAGGAGGCTGG - Intergenic
1077015066 11:395717-395739 GCTCTGGGCAGAGTTGTGGGAGG + Intronic
1077018212 11:406286-406308 GCACAGGGCGGAGTGGGGGCAGG - Intronic
1078022303 11:7665994-7666016 GCTCTGTGCACAGTGGTTGCTGG + Intronic
1078382625 11:10858141-10858163 GCTCAGCGCGGATTGGTGGCGGG - Intronic
1078524840 11:12092395-12092417 ACTCAGAGTAGCCTGGTGGCTGG + Intergenic
1080903268 11:36515622-36515644 GCTCAGAGCAGTGGAGGGGCAGG + Intronic
1081579660 11:44343535-44343557 GCTTAGAGATGAGAGGTGGCAGG + Intergenic
1082005836 11:47418549-47418571 GCTCAGAGCAGAGTGGTGCTCGG + Intergenic
1082087019 11:48058622-48058644 GCTTGGACCAGAGCGGTGGCTGG - Intronic
1083276174 11:61598247-61598269 GCTCAGAGCAGAGAAGTGACGGG + Intergenic
1083429404 11:62606120-62606142 GGACAGTGCTGAGTGGTGGCGGG - Exonic
1083489416 11:63004350-63004372 GGTAAGAGCAGAGAGGTGACAGG - Intronic
1083714499 11:64567856-64567878 GCTCAGAGCAGTGGGGTGGGCGG - Intronic
1084408274 11:68991478-68991500 ACCCAGAGCAGAGTGGGGGATGG - Intergenic
1087374610 11:97325925-97325947 GCTTGGAGCAGGGTGCTGGCTGG + Intergenic
1089769566 11:120793581-120793603 GCTGAGAGCAGGGTGATGGTTGG + Intronic
1089832911 11:121344587-121344609 TCTGAGAGCAAAGTGGTGCCTGG + Intergenic
1090047137 11:123345809-123345831 GCTCTGGTCAGAGTGGTGGGGGG - Intergenic
1091740546 12:2958420-2958442 GCTTAAAGCAGTGTGCTGGCAGG - Intergenic
1093251315 12:16807604-16807626 GCTTAAATCAGAGTGATGGCAGG + Intergenic
1093798725 12:23345876-23345898 AATCAGCGCAGTGTGGTGGCGGG - Intergenic
1093971908 12:25383527-25383549 GCTAACAGCAGATGGGTGGCAGG + Intergenic
1095735911 12:45555864-45555886 ACACAGAGCAGAGTGGCGGGAGG + Intergenic
1095877610 12:47099025-47099047 GGTCAGAGATGAGTGGTGGCTGG - Intronic
1096148749 12:49295918-49295940 ACTCAGAGCAAAGGGGTAGCGGG - Intronic
1096653144 12:53072031-53072053 GCTGAGAGCAGAGTGGGGACAGG + Intronic
1097068678 12:56339093-56339115 GCTCAGGGCAGAGCTGTGCCTGG + Exonic
1097208237 12:57342582-57342604 CCTCAGAGCAGTGTGGAGGCAGG - Intronic
1097582019 12:61469828-61469850 GCTTAAAGCAAAGTGGTGGATGG - Intergenic
1099437576 12:82661951-82661973 GCTGAGAGCAGAGTGGAGTGGGG + Intergenic
1100760775 12:97804556-97804578 GCCCAGAGCAGAGGGGCTGCAGG + Intergenic
1101319622 12:103662071-103662093 ACTCAGACCAGGGTGGTAGCAGG + Intronic
1101633704 12:106519938-106519960 GCTCAGAGCAGATTGGACACAGG - Intronic
1102212121 12:111134992-111135014 GCTTTGAGCAGAGCAGTGGCTGG + Intronic
1103340116 12:120216626-120216648 GCTCAGCCCACAGGGGTGGCGGG + Intronic
1103749451 12:123149710-123149732 GTTCAGAGCAGAGAGGAGTCTGG + Intronic
1103973044 12:124684010-124684032 GCTTTGAGCAGAGTGGTCGCAGG + Intergenic
1104016805 12:124967086-124967108 GCTCAGGGCAGAGTGCTGGTCGG + Intronic
1105005642 12:132719012-132719034 GCTGATTGCAGGGTGGTGGCAGG - Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1109394204 13:61733840-61733862 GCAGAGAGTAGAGTGGTGGTTGG - Intergenic
1109742430 13:66572389-66572411 GTAGAGAGTAGAGTGGTGGCTGG - Intronic
1111197843 13:84896987-84897009 GCTCAGATCAGAGAAGTGGCAGG - Intergenic
1112029815 13:95446984-95447006 GCACAGAGCCGAGTGATGGCGGG + Intronic
1112487751 13:99835122-99835144 GGTGAGAACAGAGTAGTGGCAGG - Intronic
1113444263 13:110353408-110353430 GCTGAGAGCAGGGTGGCAGCAGG + Intronic
1113911845 13:113845383-113845405 GCTGAGAGCAGAGGCGTGGCGGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115765213 14:36616335-36616357 GCACAGAGCAGAGTGGCAGGAGG + Intergenic
1117763933 14:59060604-59060626 GCTCAGAGCAGAGTGCAGAATGG + Intergenic
1117816680 14:59606196-59606218 TCTTAGAGCAGAGGGGAGGCAGG - Intronic
1118857869 14:69637983-69638005 TCTCCTAGCAGAGTGGTGGGGGG - Intronic
1119730635 14:76948775-76948797 GCTAACAGCAGAGTAGTGGGTGG - Intergenic
1119844348 14:77817305-77817327 GCACAGAGCAGGGAGGTGACAGG + Intronic
1121563033 14:94888148-94888170 GGACAGAGCAGTGTGGTGTCAGG - Intergenic
1121742327 14:96262981-96263003 GCTGGGACCAGTGTGGTGGCCGG - Intronic
1122278097 14:100605497-100605519 GCTCAGAGCAGAGGGGCTGGGGG + Intergenic
1122355755 14:101122010-101122032 GCTCAGGGCAGAGTGGGGCAGGG + Intergenic
1122532132 14:102435594-102435616 GCTCTGAGCAGTTTGGAGGCAGG + Intronic
1122671836 14:103378703-103378725 GCTCAGAGCAGAGTGGGTCATGG + Intergenic
1122946658 14:105014120-105014142 ACCCAGAGCTGAGGGGTGGCAGG + Intronic
1124641821 15:31400633-31400655 GCTTCTAGCAGAGGGGTGGCAGG + Intronic
1125582765 15:40798581-40798603 GCAAAGGGGAGAGTGGTGGCAGG + Intronic
1125826640 15:42682117-42682139 GCTCAGAGAAGAGACCTGGCTGG + Exonic
1127397737 15:58556003-58556025 GCTCAGAGCTGAGCAGTGGAGGG + Intronic
1128824448 15:70699008-70699030 GCTTAGAGCAGAAAGGAGGCAGG - Intronic
1128997159 15:72305739-72305761 GCTCAGAGGAGAATGCAGGCTGG - Intronic
1129186480 15:73910469-73910491 GCCCAGATGAGAGTGGTGACTGG + Intergenic
1129515071 15:76152316-76152338 GCTGAGGGCAGAGTGTGGGCAGG + Intronic
1131118744 15:89810021-89810043 GCGCAGAGGGGAGTGGGGGCTGG - Intronic
1132500100 16:281267-281289 GTCCAGAGCAGGGTGGTGGAGGG + Intronic
1132669750 16:1097755-1097777 GCACAGAGCAGGGTGGAGGGAGG + Intergenic
1132691208 16:1182685-1182707 ACTCAGAGCAGACTGGGGGTTGG + Intronic
1132923068 16:2410010-2410032 ATTCAGGGCAGAGTGGTGGGAGG + Intergenic
1132974178 16:2703298-2703320 CCTCAGAGCCAGGTGGTGGCTGG + Intronic
1133105942 16:3509520-3509542 GCTTTGAGCAGAGTGCTGGTGGG + Intronic
1134015158 16:10883099-10883121 GCACCCAGCAGAGTGCTGGCGGG + Intronic
1135595967 16:23743501-23743523 ACACAGAACAGCGTGGTGGCAGG - Intergenic
1136347183 16:29683693-29683715 TCACAGAGCAGGGTGGGGGCTGG + Intronic
1136416738 16:30108700-30108722 ACCCAAAGCAGAGTGGTGGTGGG + Intronic
1137775190 16:51048381-51048403 GATCAGAGCAGAGGGGAGGTGGG - Intergenic
1139355899 16:66366909-66366931 GCTCAGAGCAGGGTCGGGGAAGG + Intronic
1140042218 16:71415726-71415748 GCTCAGACTAGAGTTGGGGCTGG - Intergenic
1141702889 16:85650529-85650551 GCTCAGAGCGGAGGAGTCGCCGG - Intronic
1142222170 16:88860853-88860875 TCTCTGAGCAGAGGGGTGGAGGG + Intronic
1142290009 16:89189588-89189610 GGACAGAGCAAAGTGGTGGAGGG - Intronic
1142408635 16:89904934-89904956 GCTCAGGGCAGGGGGCTGGCTGG - Exonic
1142645737 17:1312869-1312891 GCAGAGAGCAGATTGGAGGCTGG - Intergenic
1143021512 17:3919236-3919258 GCTCTGTGCAGCGTGGAGGCTGG + Intergenic
1143327553 17:6109449-6109471 GCACAGAGCACAGTGGTGGAAGG + Intronic
1143474306 17:7194046-7194068 GCTCAGAGCATGGGGGTGGCAGG - Intronic
1143726388 17:8849765-8849787 GCTCAGGTCAGTGTGGTGGGGGG - Exonic
1144773507 17:17772302-17772324 GGCCAGACCAAAGTGGTGGCAGG - Intronic
1146706802 17:35006642-35006664 ACTCAGAGTGGAGTGTTGGCTGG - Exonic
1147334147 17:39716621-39716643 GCTCAGAGCTGGGTGGAGGGGGG + Intronic
1148109976 17:45138952-45138974 GCTCTGGGCAGGGTGGGGGCAGG - Intronic
1148217545 17:45841323-45841345 GCAGAGAGCAGATTCGTGGCGGG - Intergenic
1148234309 17:45957561-45957583 GCTCACAGCAGAGATGTGGCTGG - Intronic
1148571394 17:48672246-48672268 GCTCCCAGAAGAGTGGGGGCTGG + Intergenic
1148861935 17:50609144-50609166 GCTGAGGGCAGAGGGGAGGCAGG - Intronic
1149777155 17:59366957-59366979 GCTCTGAGCATCGTGGGGGCAGG + Intronic
1150517356 17:65827472-65827494 GCTTAGACCAGAGTGGTAGCTGG - Intronic
1152430713 17:80246949-80246971 GGGCCGGGCAGAGTGGTGGCTGG - Intronic
1152541584 17:80979445-80979467 GGGCAGAGGAGAGTGATGGCAGG - Intergenic
1152832171 17:82504099-82504121 GCTCAGAACACAGAGGTTGCAGG + Intergenic
1153280487 18:3410067-3410089 GCTCAGAGCAGTCTGTTGGCAGG + Intergenic
1153666308 18:7370165-7370187 GCTCAGGGCAGAGTGTGGACTGG - Intergenic
1155193693 18:23453395-23453417 GAACAGAGCAGAGAGGTGGCAGG - Exonic
1155261227 18:24044415-24044437 GCACAGTGCAAAGAGGTGGCTGG + Intronic
1155669732 18:28355810-28355832 ACTCAGAGCACAGTGGAGACGGG - Intergenic
1156456137 18:37295517-37295539 GCTCAGAGCATGCTGGAGGCAGG + Intronic
1156676568 18:39533670-39533692 TCTCAGTTCAGTGTGGTGGCAGG - Intergenic
1159552457 18:69909377-69909399 GCTCAGGGGTGAGTGGTGCCAGG - Intronic
1160040627 18:75342140-75342162 GCTCAGAGCAGAGGGCAAGCTGG - Intergenic
1160350073 18:78170583-78170605 GCTCAGACCACAGTGGAGGGCGG - Intergenic
1160874135 19:1289535-1289557 CCTCAGAGCAGGGTGGACGCAGG + Intronic
1161812959 19:6481335-6481357 GATCAGGGCAGAGGGGAGGCTGG - Intronic
1162344872 19:10113237-10113259 GGTCAGGGCAGAGTGGGGGCTGG + Intronic
1162549659 19:11351482-11351504 GCTCAGGGGAGACAGGTGGCTGG + Intronic
1163042139 19:14610415-14610437 GCTCAGAGCTTGGTGGTGGGAGG + Exonic
1163257870 19:16168446-16168468 GCTCAGATCACAGGGGTGGAGGG - Intronic
1163559575 19:18010708-18010730 CCTCAGAGTACAGGGGTGGCGGG - Exonic
1164455514 19:28403705-28403727 GCTTGGAGCAGGGTCGTGGCAGG - Intergenic
1164596626 19:29534375-29534397 GCTCACAGCAGAGTGGAGAAGGG + Intronic
1165719409 19:38068473-38068495 GCACAGGGCAAAGGGGTGGCAGG + Intronic
1166039420 19:40192572-40192594 GCACTGAGCAGGGTGCTGGCAGG + Exonic
1166293541 19:41878160-41878182 GCTCAGAGCGGGGTGGAGACTGG - Intronic
1166297736 19:41897141-41897163 GCACAGAGCAGAGGGGTGGGGGG - Intronic
1166359755 19:42248217-42248239 GCTCTGGGCAAAGTGGTGGTAGG - Exonic
1166571961 19:43802661-43802683 GATTAGAGCAGAGTGCTGGGAGG - Intronic
1167189410 19:47974110-47974132 GCTCAGAGCAGAATGAGGGGTGG - Intronic
1167207876 19:48114667-48114689 GCTAACATCAAAGTGGTGGCAGG - Intergenic
1167408155 19:49327929-49327951 GATCAGATCAGAGCAGTGGCAGG + Intergenic
925821012 2:7800022-7800044 GCACTGAGCAGAGTGGTGGGTGG - Intergenic
926104555 2:10142151-10142173 GGTCAGAGCAGAGTGAGGGGTGG + Intronic
927086129 2:19675490-19675512 TGTCAGAGCAGAGTGGCTGCGGG + Intergenic
927477398 2:23424096-23424118 CCTCAGAGAGGAGTGGTGGATGG - Intronic
928238452 2:29565642-29565664 GCCCAGGGCAACGTGGTGGCTGG - Intronic
930069491 2:47354345-47354367 ACTCAGCGCTGAGTGGTGACTGG + Intronic
930309212 2:49716449-49716471 TCTCAGAGCAGAGGGTTGGATGG + Intergenic
931581003 2:63774513-63774535 GCTCAGAAAAGAGAGGTGGCTGG - Intronic
931976136 2:67646354-67646376 GCCCAGAGCTGAGTGATGCCTGG - Intergenic
933725983 2:85427530-85427552 GAGCAGAGCAGGGAGGTGGCTGG + Intronic
933762822 2:85684933-85684955 GCTCAGTGCCGTGTGGTTGCAGG - Intergenic
934662166 2:96148783-96148805 GCACAGAGCAGGGTGGGGGCGGG + Intergenic
935725656 2:106021742-106021764 GTTCAGAGCAGAGTTTTAGCAGG + Intergenic
935978281 2:108601081-108601103 GCACAGAACAGCATGGTGGCGGG - Intronic
936135900 2:109893647-109893669 GCACAGAACAGCATGGTGGCGGG - Intergenic
936208797 2:110477838-110477860 GCACAGAACAGCATGGTGGCGGG + Intergenic
937550413 2:123081757-123081779 GCTCTCTGCAGGGTGGTGGCAGG + Intergenic
938745188 2:134271239-134271261 CCTCAGAGCAGTGTGATGGTGGG - Intronic
940209867 2:151245311-151245333 AGTCAGAGCAGAGTGGTTGAGGG - Intergenic
940800192 2:158124504-158124526 GCTCTGAATAGAGAGGTGGCTGG + Intronic
941742588 2:169051263-169051285 TCTGAGATCAGGGTGGTGGCTGG - Intergenic
945447604 2:209956473-209956495 TCTCAATGCAGAGTGGTGCCTGG - Intronic
945840089 2:214877190-214877212 GCTCAGAGCAGAGTGGGGAAGGG + Intergenic
946408010 2:219502441-219502463 GGTGAGAGCAGAGTGGGGGCTGG + Exonic
946859848 2:223990194-223990216 GCCCAGAGCAGGGTGGAAGCGGG + Intronic
948029535 2:234805721-234805743 CCTCTGAGCAGGGTGGTGTCTGG - Intergenic
948030033 2:234809914-234809936 CCTCTGAGCAGGGTGGTGTCTGG - Intergenic
948276663 2:236714198-236714220 TCTGAGATCAAAGTGGTGGCAGG - Intergenic
948790339 2:240373520-240373542 GACCTGAGCAGAGTGGTGGGCGG - Intergenic
948982151 2:241499828-241499850 GCTGAGAGCAGACGGGAGGCTGG - Intronic
1168771985 20:421310-421332 GCTGAGAGCAGCGTGGCTGCAGG - Intronic
1169068888 20:2709670-2709692 GCTCAGAGGAGAGTGGGGGAGGG + Intronic
1169201441 20:3712219-3712241 GGTCAGAGCAGGGTGATGGTCGG + Intergenic
1169531175 20:6486685-6486707 GCTCAGTGCAGAGTTGAGGGAGG + Intergenic
1170450970 20:16483268-16483290 GCTCACAGAAGAGTGATGGTGGG - Intronic
1170587373 20:17745059-17745081 GCTGAGAGCAGTGGGGTAGCTGG + Intergenic
1172174252 20:32962512-32962534 CCTCCCAGCAGAGTGGTGGTGGG - Intergenic
1172193917 20:33079194-33079216 GCTCAGAGGAGGGAAGTGGCTGG + Intergenic
1172771766 20:37386293-37386315 GCCCAGGGCAGTGTGGAGGCAGG + Intronic
1172966382 20:38838468-38838490 GCTCCCAGCAGAGTGGTTCCAGG - Intronic
1173310561 20:41892833-41892855 GATCAGACCAGGGTGGAGGCAGG + Intergenic
1173362189 20:42354874-42354896 GCCCAGAGCAGAGTGTGCGCAGG + Intronic
1174179189 20:48664403-48664425 GCTAGGAGCAGAGTGATGACGGG + Intronic
1174285562 20:49470407-49470429 GCCCAGAAGAGGGTGGTGGCAGG - Intronic
1174302640 20:49593532-49593554 GCTCACAGGGGCGTGGTGGCAGG - Intergenic
1174689311 20:52488107-52488129 GCAGAGAGCAGATTAGTGGCTGG + Intergenic
1174930076 20:54804148-54804170 GATCAGAGCATAGAGGTGGAAGG + Intergenic
1175517939 20:59580709-59580731 GCTCAGCTCAGAGTCGGGGCTGG + Intronic
1175722243 20:61294343-61294365 GCTTAGGGCAGGGTGATGGCAGG - Intronic
1176055149 20:63141349-63141371 GCTGAGAGGAGAGAGGTGCCAGG + Intergenic
1176116317 20:63432985-63433007 CCTCAGAGCAGAGGGCGGGCGGG + Intronic
1179340228 21:40500895-40500917 GCTCAGAGCAGGGTGAAGACAGG + Intronic
1181152543 22:20895465-20895487 GCCCAAACTAGAGTGGTGGCAGG + Intergenic
1181318193 22:21984830-21984852 GCTCGGATCAGGGTGGTGGCAGG - Intergenic
1181574199 22:23783524-23783546 GGTCAGAGGAAAGTGTTGGCAGG - Exonic
1181756704 22:25029245-25029267 GTTAAGAGCAGAGTGGCGGATGG + Exonic
1182261326 22:29074045-29074067 GCGCAGAGCAGAGCGGAGGCGGG + Intronic
1182351245 22:29701166-29701188 GCCCAGGGCAGAGAGGTGGAGGG + Intergenic
1182570472 22:31233886-31233908 GCTTGGAGCAGGGTGGTGGTGGG - Intronic
1183305547 22:37081177-37081199 GCCCAGAGCAGAGTGAGAGCCGG + Intronic
1183582181 22:38732579-38732601 GCCCAGGGCACAGAGGTGGCAGG - Exonic
1184405334 22:44297605-44297627 CCCCTGAGCAGAGTGGTGGGAGG - Intronic
1184880348 22:47300565-47300587 GGTGAGAGCTGAGGGGTGGCTGG - Intergenic
949688114 3:6601080-6601102 GCTCAGAGCAGAGGGCTAGATGG + Intergenic
950008161 3:9704518-9704540 GCTCAGAGCCGACTCGAGGCGGG + Intronic
950197387 3:11018380-11018402 GCCCAGTGCAGACTGGTGGCAGG - Intronic
950583648 3:13878818-13878840 GCTCGGAGCGGTGTGGGGGCGGG - Intronic
950786048 3:15436873-15436895 GCAGAGAGCAGTATGGTGGCAGG - Intronic
950892305 3:16414862-16414884 GCTCAGTGCAGAGGGGTGCAGGG + Intronic
950900287 3:16491397-16491419 GCTCTGAGCAGAGAACTGGCAGG + Intronic
951222509 3:20083748-20083770 GCTCAGTGGAGTCTGGTGGCTGG + Intronic
952936172 3:38399976-38399998 GCTCAGAGCAGAATGGATGAGGG - Intronic
952972270 3:38659131-38659153 CATCAGAGCAGTGTGGGGGCTGG - Intergenic
953771428 3:45780862-45780884 GCTCAGAGTGGAGTGGGGGTGGG - Intronic
954409040 3:50361822-50361844 GCAGAGAGCAGAGTGTTGGGAGG + Intronic
954709939 3:52500558-52500580 GCTCAGAGCAGAGTGGTGGCTGG + Intronic
956167347 3:66406596-66406618 TTTCAGAGGACAGTGGTGGCGGG - Intronic
956845994 3:73183490-73183512 GCATAGAGCAGAGTGGAGGGAGG - Intergenic
957577599 3:82029666-82029688 GCTCAGGGCAGAGTCGTGCTCGG + Intergenic
959108349 3:102092097-102092119 GCTCAGAGCAGGGTGCAGGGTGG + Intergenic
961170134 3:124791741-124791763 TTCAAGAGCAGAGTGGTGGCTGG + Intronic
961314609 3:126026099-126026121 GAGCAGAGGCGAGTGGTGGCAGG + Intronic
961371580 3:126434900-126434922 GCTCAGAGGGGAGTGGAGGGGGG + Intronic
961413487 3:126740682-126740704 GCTCAGAGAACAAGGGTGGCAGG + Intronic
962239266 3:133737462-133737484 GATCAGAGCAGAGCTGTGGGAGG + Intergenic
962828598 3:139120621-139120643 GCTCAGCCCATAGTAGTGGCAGG + Intronic
962980898 3:140489162-140489184 GTTGAGAGGAGAGTGGTGGTTGG + Intronic
963872404 3:150431752-150431774 GCTCAGAGTTGGGTGGTGGGTGG + Intronic
964405820 3:156348364-156348386 GATCAGATCAGGGTGGTGGCAGG + Intronic
965259265 3:166459340-166459362 GCTGAGATCAGAGTGGTAACAGG - Intergenic
967305139 3:188052247-188052269 GCTCACAGCAGAGGGGCGGGTGG + Intergenic
967942878 3:194779846-194779868 GCTCAGAGCACAGAGGAGGGAGG - Intergenic
968443404 4:636035-636057 GCACAGAGGCGGGTGGTGGCAGG + Intronic
968541367 4:1169986-1170008 GCCCCGAGCTGTGTGGTGGCTGG + Intronic
968741097 4:2332186-2332208 ACTGAGAGCAGAGGGGAGGCAGG - Intronic
969536054 4:7756689-7756711 CCTGAGAGCAGAGTGGCGGCAGG + Intergenic
970540542 4:17074038-17074060 GCTCAGAGCAGAATGTTGATGGG - Intergenic
970585483 4:17510867-17510889 GCACTGAGCAGATGGGTGGCAGG + Intronic
973893136 4:55387788-55387810 ACTCAGGGCAGAGAGGTGGTTGG - Intergenic
974927938 4:68324464-68324486 GCTCAGAGAAGAGAGCAGGCTGG - Intronic
975108820 4:70600563-70600585 GCTCAGAGAGGGGTGATGGCTGG + Intronic
975144114 4:70948879-70948901 GCTCAGAGCATGGTGGAGGGAGG - Intronic
975715037 4:77197382-77197404 AGTGAGAGCAGAGCGGTGGCTGG + Intronic
977020256 4:91749848-91749870 GCTGATATCAGAGTGTTGGCAGG + Intergenic
977697682 4:99984758-99984780 GCAGAGAGCAGAATGGTGGTTGG - Intergenic
982449113 4:155531264-155531286 TCTCAAGGCAGAGTGTTGGCAGG + Intergenic
984314690 4:178112997-178113019 GCTCAGAGCAGTGGGGTTTCGGG - Intergenic
985638739 5:1053175-1053197 GCTCTGAGCCCAGTGGTGACCGG - Intronic
985823377 5:2176056-2176078 GCTCAGGGCAGTGTGGAGGGAGG - Intergenic
986016897 5:3765597-3765619 GCTCAGAGCAGAGTGGAGGGTGG + Intergenic
986108442 5:4685373-4685395 GCTCAGAGCAGGGTGGGTGAAGG + Intergenic
986646580 5:9921921-9921943 GCTCAGAGCACACTGAAGGCTGG + Intergenic
988788932 5:34589722-34589744 GCCCAGAGCAGAGTGCAGGAGGG - Intergenic
991457097 5:66815850-66815872 TCCCAGAGGAGAGTGGTGACAGG + Intronic
991497701 5:67243644-67243666 GCTCAGAGCAGTGAGCTGGAAGG + Intergenic
991659393 5:68934820-68934842 GGTGAGAGCAAAGTGGTGACTGG + Intergenic
992088886 5:73300784-73300806 GCTCAGAGCAAAGCGATTGCAGG - Intergenic
993975682 5:94476695-94476717 GAGCAGAGCAGAGTGGTAACAGG + Intronic
997836061 5:137194455-137194477 CCTCAAAGCAGAGTGGCGGGTGG + Intronic
998168248 5:139856597-139856619 GCTCAGGGTAAAGTGGAGGCTGG + Intronic
998463437 5:142325460-142325482 GTTGAGAGCAGGGTGGTGGAGGG + Intronic
1001043904 5:168356506-168356528 GATCAGAGCAGGGTGTGGGCCGG - Intronic
1001483325 5:172103198-172103220 GATCAGAGCAGGGAGGTGACTGG - Intronic
1002080985 5:176737325-176737347 GCCCAGAGCTGAGCGGAGGCTGG + Intergenic
1003092204 6:3113619-3113641 CCTCAGAGCGGATTGTTGGCTGG - Exonic
1004866358 6:19857083-19857105 GCTTAGGGCAGAGTTGGGGCAGG - Intergenic
1006133495 6:31882474-31882496 GGTCTGGGCAGAGTGGAGGCAGG + Intronic
1006427824 6:33977117-33977139 GCTGTGAGCAGGGTGGTGGCAGG - Intergenic
1006910724 6:37561790-37561812 GCCCAGGCCTGAGTGGTGGCTGG + Intergenic
1006910925 6:37563220-37563242 GCCCAGGCCTGAGTGGTGGCTGG - Intergenic
1007027426 6:38590961-38590983 CCTCAAACCAGATTGGTGGCAGG - Intronic
1007130089 6:39464211-39464233 GCTCAGAGCTGAGCAGTGGAGGG + Intronic
1007644088 6:43367480-43367502 GCTTAGACCAGAGTGATGGCAGG + Intronic
1011379286 6:86725274-86725296 CCTGAGTTCAGAGTGGTGGCAGG + Intergenic
1013087261 6:106867045-106867067 GCTGAGCGCAGAGCTGTGGCAGG + Intergenic
1013448728 6:110257961-110257983 TCTAAGAACAGTGTGGTGGCTGG + Intronic
1013622036 6:111899406-111899428 GCTCAGAGAAGACAGGAGGCAGG - Intergenic
1015326161 6:131926183-131926205 GGGCAGAGCAGAGAGGTAGCAGG - Intergenic
1015840370 6:137470329-137470351 GCTCAGAGCAAAGGGGTGCTTGG - Intergenic
1016249495 6:142022779-142022801 AAACAGAGCAGAGTAGTGGCAGG - Intergenic
1016990035 6:149922504-149922526 GAACAGAGCAGGCTGGTGGCTGG + Intronic
1017073708 6:150599750-150599772 CCTCAGGGCAGAGGGGAGGCGGG + Intergenic
1017571301 6:155748269-155748291 GCTCCAAACAGAGTGGGGGCTGG + Intergenic
1017766249 6:157609626-157609648 GCTCAGAGCAGAATGGAAGATGG - Intronic
1017899703 6:158708663-158708685 GCACAGAGCAGAGTTGGGGAAGG - Intronic
1018336448 6:162795220-162795242 GATCAGAGAAGAGGGGTGGGGGG + Intronic
1018350757 6:162956545-162956567 TCTCAGATGAGAGTGTTGGCAGG + Intronic
1020024406 7:4888666-4888688 GCCCAGAGGAGAGAGGAGGCAGG + Intergenic
1022360124 7:29649514-29649536 GCTCAGGGAAGCGTGGAGGCGGG + Intergenic
1023351183 7:39321498-39321520 GCTTAGAGCAGAGTCGTGAAGGG + Intronic
1024418069 7:49131587-49131609 GCACAGAGCAGAGTGGTCAGCGG + Intergenic
1026644470 7:72155797-72155819 GCTCAAAGCAAGGTGGTAGCTGG + Intronic
1028932018 7:96423837-96423859 GCTCAGTGAAGAGTGGCGCCAGG + Intergenic
1029101035 7:98130163-98130185 GCTCATAGTAGAGAGCTGGCGGG + Intronic
1030108329 7:106005877-106005899 GCACAGAGCAGGGTGGAGACTGG - Intronic
1030677406 7:112398550-112398572 GCCCAGAGCAGGGTGGAGGAGGG - Intergenic
1032522615 7:132557371-132557393 GCTCAGAGAAAAGAGGTGGCAGG + Intronic
1034849724 7:154482243-154482265 GATAAGATCAGAGTGGAGGCTGG + Intronic
1034986877 7:155521771-155521793 CAGCTGAGCAGAGTGGTGGCAGG + Intronic
1035276008 7:157748316-157748338 TCTCTGAGCAGAGGGGTGTCCGG + Intronic
1035320587 7:158026894-158026916 GCCCAGAGCCGAGTGGCTGCTGG - Intronic
1035495514 7:159322131-159322153 GCTCAGAGGAGTGAGGTAGCAGG + Intergenic
1035600562 8:894707-894729 GGGAAGAGCAGAGTGGTGGCTGG + Intergenic
1035600589 8:894792-894814 GGGGACAGCAGAGTGGTGGCTGG + Intergenic
1035600658 8:894983-895005 GGGAAGAGCAGAGTGGTGGCTGG + Intergenic
1035670351 8:1412233-1412255 GCTCAGAGCAGGAGGCTGGCGGG - Intergenic
1036625306 8:10466211-10466233 GCTCAAATCAAAGTGCTGGCAGG - Intergenic
1037681378 8:21100531-21100553 GCTGACAGCAGTGTGCTGGCTGG + Intergenic
1037764791 8:21765964-21765986 GCACAGAGCAGAGTGGAGCCAGG - Intronic
1040388699 8:46932097-46932119 GCTCATAGAAGGGGGGTGGCCGG + Intergenic
1043137990 8:76551854-76551876 ACAGAGAGCAGAATGGTGGCTGG + Intergenic
1045036725 8:98181779-98181801 GCTCAGACCAGTGTGTGGGCTGG + Intergenic
1045295763 8:100870569-100870591 ACTGAGAGCAGAGGTGTGGCGGG - Intergenic
1047447889 8:124936562-124936584 GCTCACAGCATAGTGGTCTCAGG + Intergenic
1048017185 8:130507862-130507884 GCTCAGACCAGCTAGGTGGCAGG - Intergenic
1048843893 8:138588602-138588624 GCTTAGAGCACTGAGGTGGCTGG + Exonic
1048976193 8:139674339-139674361 CCTGAGAGCAGAGTGCTGGCAGG - Intronic
1049394719 8:142394622-142394644 GCACAGAGCAGAGCTGTGGGAGG - Intronic
1054803897 9:69379833-69379855 GCTCAGAGCACACTGCTGGATGG - Intronic
1054881668 9:70150743-70150765 GCTTAGACTAGGGTGGTGGCTGG - Intronic
1055432768 9:76260699-76260721 GCTAAAAGCAGAGTGGCAGCAGG - Intronic
1056923709 9:90814524-90814546 GCTGAGAGCAGCTTGGTGTCTGG - Intronic
1057124233 9:92603605-92603627 GATCAGAGCTGAGTGTAGGCAGG - Intronic
1058136117 9:101309415-101309437 GCTCAGAGCAGCGTGTTTGGAGG - Exonic
1058171778 9:101690100-101690122 GCTCAGAAGAGAGAGGTGGGAGG + Intronic
1061392766 9:130327066-130327088 CCTCAGAGCAAGGTGGTGGTGGG + Intronic
1061578563 9:131522902-131522924 GGTCAGAGCAGCGTGGGGGAGGG - Intronic
1061759261 9:132838751-132838773 GCTCAGAACAGAGGGCTGACAGG - Intronic
1061802550 9:133120430-133120452 GCTCAGAGCGGGGTGGGGGGGGG - Intronic
1062084890 9:134643311-134643333 GCTCAGAGCTGTGTGCTGCCAGG + Intronic
1062674384 9:137731878-137731900 GCTCTGTGCAGAGCTGTGGCTGG + Intronic
1062723634 9:138058743-138058765 GCTCAGCGCAGAGGGGCAGCTGG + Intronic
1186473269 X:9837580-9837602 GCTCACAGGAGAGTGGGCGCTGG + Intronic
1187307932 X:18113962-18113984 GCTCAGAGAAGAGTCTTGGAAGG - Intergenic
1187810550 X:23171618-23171640 GCTCAGAGCACAGTGGCTGTGGG - Intergenic
1189305808 X:39985788-39985810 GCTCAGAGAAGGGAGGGGGCAGG + Intergenic
1189309695 X:40010603-40010625 GCTCAGCGCAGTGTGGGGGTGGG - Intergenic
1190128691 X:47726814-47726836 ACTCAGAGCAGGGTGGTGGGGGG - Intergenic
1192331089 X:70175751-70175773 GCCCAAAGCAGAGTGGGGGTGGG + Intergenic
1192707076 X:73537803-73537825 GACCACAGCAGAGTGGGGGCTGG - Intergenic
1194426690 X:93747685-93747707 GATCAGAGCAGAGTGGAGAAGGG - Intergenic
1195361006 X:104084093-104084115 GCTTGGGGCAGAGTGCTGGCTGG + Intergenic
1197809184 X:130426565-130426587 CCTCACAGCAGAGGGGTAGCAGG - Intergenic
1198392844 X:136193788-136193810 TCTCAGAGAAGAGAGGAGGCAGG - Intronic
1198673732 X:139109610-139109632 GCTCAGAAAAAAGTGATGGCTGG - Intronic
1198685046 X:139219922-139219944 TCTCAGAGCACAGTGATGACTGG - Intronic
1199456718 X:148037485-148037507 GCTCACACCAGAGTGTTAGCAGG + Intergenic
1199731541 X:150637837-150637859 TCTGAGAGCAGAGATGTGGCGGG + Intronic
1200222540 X:154398200-154398222 GCGCAGATCAGAGAGGTGACCGG - Intronic