ID: 954710880

View in Genome Browser
Species Human (GRCh38)
Location 3:52504556-52504578
Sequence GGCCAGCTCCACCATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954710880_954710887 1 Left 954710880 3:52504556-52504578 CCCTCCCCATGGTGGAGCTGGCC 0: 1
1: 0
2: 4
3: 23
4: 233
Right 954710887 3:52504580-52504602 CTGGCCCTCACCTCCTCCCCTGG 0: 1
1: 0
2: 7
3: 81
4: 733
954710880_954710898 30 Left 954710880 3:52504556-52504578 CCCTCCCCATGGTGGAGCTGGCC 0: 1
1: 0
2: 4
3: 23
4: 233
Right 954710898 3:52504609-52504631 CCCCAGTCTTCAGGGCCACCTGG 0: 1
1: 0
2: 2
3: 34
4: 276
954710880_954710895 21 Left 954710880 3:52504556-52504578 CCCTCCCCATGGTGGAGCTGGCC 0: 1
1: 0
2: 4
3: 23
4: 233
Right 954710895 3:52504600-52504622 TGGATGCATCCCCAGTCTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 138
954710880_954710896 22 Left 954710880 3:52504556-52504578 CCCTCCCCATGGTGGAGCTGGCC 0: 1
1: 0
2: 4
3: 23
4: 233
Right 954710896 3:52504601-52504623 GGATGCATCCCCAGTCTTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954710880 Original CRISPR GGCCAGCTCCACCATGGGGA GGG (reversed) Intronic
900103270 1:971794-971816 GGCCGGGTGAACCATGGGGAGGG - Intronic
900546649 1:3233191-3233213 GGCCACCCCCACCCTGGGCAGGG - Intronic
900646268 1:3710097-3710119 GGTCAGCTGCACCAGCGGGAGGG + Intronic
900787458 1:4657668-4657690 GGCTTGCTCCACCATGGGAGAGG + Intronic
901063641 1:6485143-6485165 GGGCAGCTGCACCCTGGTGACGG - Intronic
903292295 1:22322033-22322055 CGCCACCTACACTATGGGGAGGG - Intergenic
903690788 1:25171962-25171984 CGCCAGCACCACCATGAGTAAGG + Intergenic
904208517 1:28870767-28870789 GGCCATCTGCGTCATGGGGATGG + Intergenic
904514187 1:31040659-31040681 TGCCAGCTACACAAGGGGGAAGG + Intronic
905802867 1:40856601-40856623 GGCCAGATCCAGCCTGGGAAGGG + Intergenic
906509383 1:46402219-46402241 GGCCAGCCCCTCCCTGGGAAAGG + Intronic
907140686 1:52182147-52182169 GGCCAGCTGCCCCATCGGGGAGG + Intronic
909049707 1:70753161-70753183 GGGAAGCTGCACTATGGGGAGGG + Intergenic
910540565 1:88351299-88351321 GGGTAGCTACAGCATGGGGATGG - Intergenic
911543898 1:99192270-99192292 GGCCATCTCCATCATGGGACAGG - Intergenic
912172289 1:107115522-107115544 AGCCATCTCCACCTTGTGGAAGG + Intergenic
913186342 1:116373499-116373521 GAGCACCGCCACCATGGGGAAGG + Intronic
919770451 1:201155007-201155029 GCCCAGCACCAGCATGGGGTAGG - Intronic
919840496 1:201605762-201605784 GGCCAGCTGCATCTAGGGGAGGG + Intergenic
919927641 1:202200575-202200597 TGCCATTTCCAACATGGGGAAGG - Intronic
922122109 1:222681747-222681769 AGCCACTGCCACCATGGGGAGGG + Intronic
922574442 1:226652678-226652700 GGCCAGCTCTGCCCTGGGCAGGG - Intronic
922610187 1:226920738-226920760 GGCCAGGTCCCAGATGGGGAGGG + Intronic
924250557 1:242128794-242128816 GACTAGCTCCACCACGGGCAAGG + Intronic
924638624 1:245812345-245812367 GGGCAGCTCCTGCATGAGGAGGG - Intronic
1062812419 10:476927-476949 GGCCAGCTCCACCGAGAGCAAGG - Intronic
1065319474 10:24495731-24495753 GCCCAGCTGCAATATGGGGATGG + Intronic
1070801404 10:79246477-79246499 GGCTGGCTCCTCCATGGGGAAGG + Intronic
1070982976 10:80665112-80665134 GGGCAGCTCCACCAAGGGAGGGG + Intergenic
1071496245 10:86169497-86169519 GCCCAGTTCCATCATGGGGGTGG + Intronic
1071887718 10:89969094-89969116 GGGCAGCTCCAGAATGTGGATGG + Intergenic
1071964157 10:90835231-90835253 GAACATCTCCAGCATGGGGATGG - Intronic
1072608828 10:97003545-97003567 GGCCATCTCCACCCTGTGGGAGG - Intronic
1072746147 10:97940606-97940628 GGACAGCACCACTGTGGGGAGGG + Intronic
1073864324 10:107784712-107784734 GGCCAGCTTCCCCATGGGATTGG - Intergenic
1074098508 10:110334404-110334426 GACCAGCTCCTCCTTGGTGAAGG - Intergenic
1075093501 10:119456440-119456462 GGCCAGCTGCTCCCTGGGGATGG - Intronic
1075727187 10:124616671-124616693 GGCCACTTCCAGCATGTGGAGGG + Intronic
1076343602 10:129766038-129766060 GGCCAGTCCCACCAGGGGAAGGG - Intronic
1076613020 10:131738074-131738096 GGCCGGCTGCCCCATGGAGAGGG + Intergenic
1076765544 10:132631073-132631095 GGGCTGGGCCACCATGGGGAGGG - Intronic
1077546092 11:3170691-3170713 CTCCAGCACCACCATGGGGCAGG - Intergenic
1078358869 11:10652972-10652994 AGGCTGCTGCACCATGGGGAAGG - Intronic
1079970699 11:27031981-27032003 GGTAAGCTGCAGCATGGGGAGGG - Intergenic
1080511857 11:32982732-32982754 GGCCTGGGCCACCATGGGGGAGG - Intronic
1082229869 11:49750644-49750666 GGCCAACTCCACTGTGGGGAGGG + Intergenic
1083343847 11:61975943-61975965 GACCAGCGCGGCCATGGGGATGG + Intergenic
1085426420 11:76408700-76408722 GGCCATCTCCATCTGGGGGATGG + Intronic
1085808308 11:79657270-79657292 AGGCAGCTCCAGCATGGGGCTGG - Intergenic
1086620204 11:88878473-88878495 GGCCAGCTCCACTGTGGGGAGGG - Intronic
1088738388 11:112747086-112747108 GTTCAGATCCCCCATGGGGAAGG - Intergenic
1089528627 11:119112694-119112716 GGGCAGCTTCACTATGAGGAGGG + Exonic
1089556755 11:119319439-119319461 GCCCAGGTCCACCATGGGGCTGG - Intronic
1090031116 11:123207238-123207260 TGCCAGATCTAACATGGGGAGGG + Intergenic
1090260519 11:125315569-125315591 TGCCAGCTGCACCCTGGGGTGGG - Intronic
1091089226 11:132754063-132754085 TGCCAGCTCCACTAAGGGAAGGG + Intronic
1095982819 12:47982597-47982619 GGCCAGATGCACCCTGGGGAGGG + Exonic
1096085514 12:48862846-48862868 TGCCCCCTCCACCCTGGGGAAGG + Intronic
1096260588 12:50087723-50087745 GGCCAGCAGCACCAAGAGGAAGG - Intronic
1096514143 12:52147105-52147127 GCCCAGCTTCCCCATGGGGCTGG - Intergenic
1101091398 12:101290269-101290291 GGCCAGGTACATAATGGGGAGGG + Exonic
1102206844 12:111096641-111096663 GGCCAGCTCAGCCACGGGGTGGG + Intronic
1103702395 12:122854762-122854784 GGCCCGCTCTCCCATCGGGATGG - Intronic
1103906017 12:124327574-124327596 TGCCAGCACCAACATGGGGCTGG - Exonic
1105415969 13:20211532-20211554 GGCCACCCCCACCATGGTGTTGG + Intergenic
1105529815 13:21209102-21209124 GGCCAGCAAAGCCATGGGGATGG + Intergenic
1106421091 13:29587036-29587058 GGCCAGCTCCTTCAAGGAGAGGG + Intronic
1106552044 13:30780528-30780550 GCCCAGCAAAACCATGGGGATGG + Intergenic
1113880681 13:113623813-113623835 GGCCAGCATCAGCCTGGGGAGGG - Intronic
1119208273 14:72810750-72810772 GCCCAGCTCCAGGATCGGGAAGG - Intronic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1122379116 14:101288824-101288846 GGCCGAGTCCACCAGGGGGAGGG - Intergenic
1122671046 14:103372687-103372709 GGCCAGCAGCCCCACGGGGAAGG + Intergenic
1122773452 14:104107113-104107135 GGCCAGGTAGGCCATGGGGAGGG - Intronic
1122920998 14:104880082-104880104 GTCCAGCTCAAGCCTGGGGAGGG - Intronic
1123015350 14:105371154-105371176 GGGCAGCTCCGCCACTGGGATGG + Intronic
1125201001 15:37100641-37100663 AGCCTGCTCCTCCACGGGGATGG + Intronic
1125429672 15:39581845-39581867 CAACAGCTCCACCATGGGGCTGG + Exonic
1128799623 15:70489337-70489359 TGCCAGCTCCACCTTCGGGATGG - Intergenic
1129183205 15:73889886-73889908 GGCCAGCTAGAGCATGGGGCAGG - Intergenic
1129454736 15:75670608-75670630 GCCCTGCTCCTCCATGGGGGAGG + Intergenic
1129693699 15:77728535-77728557 CTCCAGCTCCAGCTTGGGGATGG + Intronic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1131508558 15:93036447-93036469 TTCCTGCTCCACCCTGGGGAGGG + Intronic
1132463010 16:64665-64687 GCCCAGCTGCTCCATGGGGTGGG - Intronic
1132564772 16:616908-616930 GGCCAGCCTCTCCATGGGCACGG - Intronic
1132720983 16:1315475-1315497 GACCAGCCCCACCAAGGGGGCGG - Intronic
1136268301 16:29133439-29133461 GGCCAGCTCCAGCCTGGGCACGG - Intergenic
1136490129 16:30602392-30602414 AGCCAGCTCTACCAGGGGGCTGG + Intergenic
1137580676 16:49631827-49631849 TGCAAGCTCCACCCTAGGGATGG + Intronic
1138530429 16:57631563-57631585 GGCCACCCCCAGCATGGGGACGG - Intronic
1138654350 16:58482139-58482161 AGCCAGCTCTACCCTGGGGGAGG - Intronic
1139428833 16:66900329-66900351 CACCATCTCCACCCTGGGGAGGG - Intergenic
1139705289 16:68737161-68737183 CGTCAGCTCCGCCCTGGGGAGGG + Intergenic
1139801208 16:69524454-69524476 GGCCAGCTACTCCACAGGGAAGG - Intergenic
1140038615 16:71390270-71390292 GGACAGCTACACCATTGGCAAGG - Exonic
1142071609 16:88093773-88093795 GGCCAGCTCCAGCCTGGGCAGGG - Intronic
1142234095 16:88913264-88913286 GTCCAGCTCCACCAAGTGGCCGG - Intronic
1142276951 16:89123794-89123816 GGCCAGCTGCCACCTGGGGAGGG - Intronic
1142674259 17:1503824-1503846 GGCCAGCTCCCTTATAGGGAGGG - Intronic
1143213047 17:5203601-5203623 GCCCAGCACAGCCATGGGGACGG + Intergenic
1143329190 17:6121329-6121351 GGCTGGCTGCACCATGGGCAGGG + Exonic
1143593276 17:7898812-7898834 ATCCAGCAGCACCATGGGGAAGG - Intronic
1143681169 17:8477037-8477059 GGCCTTCTCCATCTTGGGGAGGG + Exonic
1143783382 17:9240747-9240769 GGCCAGCCCCACGCTGGGCAGGG - Exonic
1144576354 17:16432122-16432144 GGCCAGCTCGCCCATGCCGATGG - Exonic
1144732675 17:17537518-17537540 GGCCTGGGCCAGCATGGGGAAGG - Intronic
1145174146 17:20685212-20685234 GGCCAGCCGCCCCATCGGGAAGG + Intergenic
1145253637 17:21310732-21310754 GGCCGGCCCCACCATGGGGGCGG - Intronic
1145322945 17:21777229-21777251 GGCCGGCCCCACCATGGGGGCGG + Intergenic
1146918981 17:36697181-36697203 GGCCAGCTCCACTCTGGCAAGGG + Intergenic
1147375336 17:40019592-40019614 GGCCAGAACCACCTTGGGGCTGG + Exonic
1148567041 17:48639481-48639503 GGCCATCTGCACCATGGAGTTGG - Intergenic
1148620286 17:49029549-49029571 GGCTTGCTCAACCATGGGGTGGG - Intronic
1150221491 17:63497944-63497966 GGCCAGGTCCCCCCAGGGGAAGG + Intronic
1150654444 17:67030823-67030845 GGACAGCTCCCCCATGGGGATGG - Exonic
1151993980 17:77597032-77597054 GGCCTGAACCACCATGGAGATGG + Intergenic
1152070753 17:78132549-78132571 GGCCAGCCCCCCCATGGCGCAGG - Intronic
1152623691 17:81378965-81378987 GGCCTGCTGCACCCTGGGGAGGG - Intergenic
1155474152 18:26221304-26221326 GGCCAGGTAGAACATGGGGAAGG + Intergenic
1159726008 18:71960661-71960683 GGCCACATTCACCATGGGGGAGG - Intergenic
1161383655 19:3979802-3979824 GCCCACCTGCACCATGGGGTCGG + Exonic
1162895236 19:13761492-13761514 GGCCAGCTCCACCAGGGCAAGGG + Intronic
1163534475 19:17869281-17869303 GGCCATCACCACCCTGGGGTGGG + Intergenic
1164256579 19:23533435-23533457 GGCCAGCCGCCCCATCGGGAGGG - Intronic
1165957082 19:39507669-39507691 GGCCAACTGCACCACGGAGATGG - Intronic
1165999691 19:39870863-39870885 GGTCAGCGCCAGGATGGGGAGGG + Intronic
1166042607 19:40212932-40212954 GCCCAGCTCCACCCTGCAGAAGG + Exonic
1166361870 19:42255832-42255854 GGACAGCTGCAGCCTGGGGACGG - Intergenic
1167079759 19:47270989-47271011 GGGCAGCTCCTCCCTAGGGAGGG + Intronic
1168312128 19:55465610-55465632 GGCCAGCAGCACTATGGGCAAGG + Intergenic
925738715 2:6986441-6986463 GGCCAGCTCAACAAGGGGGCAGG - Intronic
926209157 2:10856204-10856226 CCCCACCTCCACCATGGGGCAGG - Intergenic
926320306 2:11744730-11744752 GGCCAGCTCCTCCCTGGAGGTGG + Intronic
926541096 2:14182541-14182563 GCCCAGCTCCACCTTGGGCCTGG - Intergenic
926584967 2:14675731-14675753 GGCCAGCTCCACATCTGGGAGGG + Intergenic
930896194 2:56449359-56449381 CGCCAGCTCCACTTTGGGGCTGG + Intergenic
933811160 2:86033554-86033576 GGCCAGCACCAGGATGGGGCTGG + Intronic
934692174 2:96370257-96370279 GGCAAGCACCACCCTGGGGCTGG + Intronic
935171820 2:100616089-100616111 GTCCAGCTCCACCAGGGACATGG - Intergenic
935795398 2:106636287-106636309 GGCCAGCTACACAATTGGTAGGG - Intergenic
937379913 2:121367286-121367308 GGCCAACTCTACCATCAGGAAGG - Intronic
937412591 2:121689496-121689518 TTCCAGCTCCACCAGGGGGCAGG - Intergenic
941393687 2:164947982-164948004 GGCCAGATCCACCTGGTGGAGGG - Intronic
942062410 2:172240003-172240025 AGCCAGCTCCACCATGAGTGAGG - Intergenic
942501147 2:176592180-176592202 GCCCAGCCCCACCATGGTGGGGG - Intergenic
948056072 2:235010135-235010157 GGCCGTGTGCACCATGGGGAGGG - Intronic
948455225 2:238101663-238101685 GGCCTTCTCCACACTGGGGACGG + Intronic
948487928 2:238292544-238292566 GGCCCGTTCCACCCTGGGGGAGG + Intergenic
948906886 2:240983894-240983916 GGCTATCTCCACCATGAGCAGGG - Intronic
1171487220 20:25493832-25493854 GCCCAGCACCTCCATGTGGAGGG + Intronic
1172701185 20:36854597-36854619 AGGCTGCTCCACCATGGGGTAGG + Intronic
1173028262 20:39329946-39329968 GGCCAGCCCCACAATGGGATGGG + Intergenic
1173260713 20:41432467-41432489 GTTTAGCTCCACCATGGGTAGGG - Intronic
1173418472 20:42879679-42879701 GGCCAGGACCACCCTGGAGACGG + Intronic
1175218713 20:57404951-57404973 TGGCACCTCCACCATGGGGGCGG - Intronic
1175355669 20:58365374-58365396 GTCAAGCACCACCATGGGCATGG - Exonic
1176023172 20:62972946-62972968 GGCGTGCTGGACCATGGGGAGGG - Intergenic
1176370592 21:6059649-6059671 GGCCGGCTCTGCCATGGGGAAGG + Intergenic
1179111282 21:38447711-38447733 AGCCAGTGCCACCATGGGAAGGG - Intronic
1179564157 21:42235902-42235924 GGCCCCCTGAACCATGGGGATGG - Intronic
1179752927 21:43478892-43478914 GGCCGGCTCTGCCATGGGGAAGG - Intergenic
1180920788 22:19520604-19520626 GACCAGAGCCACAATGGGGACGG - Exonic
1181173972 22:21025745-21025767 GGCCAGCCCCACCTGGGGGTGGG + Intronic
1182442970 22:30374837-30374859 GGCCAGCTCAAGCTTGGGAACGG - Exonic
1184259885 22:43308705-43308727 GCCCAGCTGCACCCTGGGGGAGG - Intronic
1184985477 22:48130502-48130524 GCCCAGCACCAGCCTGGGGAAGG - Intergenic
1185040992 22:48504349-48504371 GGGCAGCGCCCCCATGGGGAGGG - Intronic
1185231984 22:49688680-49688702 GGCCTTCTCCACCCTGGTGAGGG - Intergenic
1185316775 22:50182754-50182776 GGCCAGCTCCAGCACAGGGCAGG - Intergenic
950498717 3:13350344-13350366 AACAAGCTCCAGCATGGGGATGG + Intronic
952557990 3:34555824-34555846 TGCCAGTCCCACCATGGGTAGGG - Intergenic
952867499 3:37863588-37863610 GGCCAGCTCCGGCCTGGAGAGGG - Intronic
953582235 3:44167588-44167610 TCCCAGCTCCACCCTTGGGAAGG + Intergenic
954710880 3:52504556-52504578 GGCCAGCTCCACCATGGGGAGGG - Intronic
961825485 3:129596964-129596986 GCCCAGCCCCAGGATGGGGAGGG + Intronic
962848161 3:139288815-139288837 AGTCAGCTCCATCGTGGGGATGG - Intronic
968549911 4:1216835-1216857 GGCCGGCTCCTCCTCGGGGAAGG + Intronic
969050403 4:4369002-4369024 GTCCCACTCCACCATGGGGCTGG - Intronic
969110747 4:4842689-4842711 GGCCGGCTCCACGATGGCGGGGG - Intergenic
969451481 4:7276384-7276406 CCCCAGCTCCACCTTGGGGCAGG + Intronic
969526015 4:7704445-7704467 GGCCGGCTCCACCATGGCCACGG + Intronic
971673601 4:29595523-29595545 GGGAAGCTCCACCATGGTGGGGG - Intergenic
972830570 4:42809771-42809793 GGGAAGCTCCAGTATGGGGAAGG + Intergenic
975743651 4:77454563-77454585 GGCCAGCTCCACTATTGAGTTGG + Intergenic
980761425 4:137238891-137238913 GCCCAGCTTCTCCATGGGTAGGG + Intergenic
984835598 4:184017161-184017183 GACCAGCTCCACCATGGGCCGGG - Exonic
984944698 4:184961865-184961887 GGCCGGCTCCGCCCTGAGGATGG + Intergenic
986243748 5:5985590-5985612 GTCCAGCACCAAAATGGGGAAGG - Intergenic
986259740 5:6133973-6133995 ACCCAGAACCACCATGGGGAAGG + Intergenic
986689449 5:10302113-10302135 GGCCAAGTCCACAATGGGCAGGG + Intronic
986820909 5:11465886-11465908 GGCCATCTGCACCTTGGAGATGG - Intronic
988518256 5:31923359-31923381 GCTCAGCTTCACCATGGCGATGG - Intronic
993985509 5:94592438-94592460 GGCAAGCTCTATCATGGGAAAGG + Intronic
997435134 5:133868343-133868365 GGCCAGTACCATCCTGGGGAAGG + Intergenic
997655088 5:135548625-135548647 GGCCAGCTCCAGCAAGGTGCTGG + Intergenic
1001705306 5:173737209-173737231 TGCCAGCCCCACCCTGGAGAAGG + Intergenic
1002183736 5:177444334-177444356 GGCCAGCTCCCCCTTGGGCTAGG + Intergenic
1002191417 5:177479701-177479723 GGCCAAATCCAGCATGAGGACGG - Intergenic
1002476708 5:179470427-179470449 CGCCAGCTGCTCCTTGGGGAAGG + Intergenic
1003486161 6:6581399-6581421 GGCCAGGTCCTCCATAGTGAGGG - Intergenic
1007822785 6:44573206-44573228 GACCAGATCCACTATGGAGAAGG - Intergenic
1011751884 6:90461966-90461988 GCTCAGCCCCACCAAGGGGAAGG - Intergenic
1012996674 6:105981858-105981880 GGACAGCTCCACTACGGCGAGGG + Intergenic
1013168594 6:107616210-107616232 AGCCACCTCTCCCATGGGGAAGG + Intronic
1014299248 6:119660132-119660154 GGCAAGCTGCTCTATGGGGAAGG + Intergenic
1015864247 6:137711682-137711704 GGCCAGCTCCAGCAACAGGAAGG + Intergenic
1016982115 6:149863577-149863599 GGGCAGCTCCACCACGGCCACGG + Exonic
1017489623 6:154933647-154933669 GGCCATCTCCAGGATGGGGATGG + Intronic
1017645763 6:156538596-156538618 GGCCAGCTCCAGCATGGCACGGG - Intergenic
1017710833 6:157166347-157166369 GGTCTGCACCACCCTGGGGACGG + Intronic
1017790021 6:157789907-157789929 GGGCAGCTCCACCATCCGCAGGG + Intronic
1018546401 6:164941442-164941464 GCCCAGCAACACCATAGGGAAGG - Intergenic
1018614837 6:165676918-165676940 GGCCAGCTCCTCCAGCAGGACGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019453891 7:1114648-1114670 GGCCAGCTCTCCCATGGGTGAGG + Intronic
1019573774 7:1726466-1726488 GGCCAGCTTGGCCTTGGGGAGGG - Intronic
1019710001 7:2513844-2513866 GGCCAGCTGGGCCATGGGGCTGG - Intronic
1021649889 7:22822765-22822787 GCTCAGCTTCACCATGGCGACGG + Exonic
1023761558 7:43469146-43469168 TGCTAGCTTCACCCTGGGGAAGG - Intronic
1024002338 7:45199050-45199072 GGAGAGCTCCACCATGGGGATGG - Intergenic
1024446282 7:49483496-49483518 AGCCATCTCCACTGTGGGGAAGG + Intergenic
1026923542 7:74173852-74173874 GGCCAGCTCCTGCCTGGAGAAGG + Intergenic
1029177374 7:98674638-98674660 TGCCAGCTCCACCAGGGAGAGGG - Intergenic
1029539549 7:101174514-101174536 GGCCAGCACCACCGTGCGGTCGG + Exonic
1030313842 7:108094094-108094116 GGACAGTTCCCCCATGGGGGGGG + Intronic
1032444718 7:131972369-131972391 GTCCAGGACCACCATGAGGAAGG - Intergenic
1034377997 7:150663801-150663823 GGTCAGCACCAGCCTGGGGAGGG + Intergenic
1034669964 7:152850340-152850362 GGCCAGCTTCTCCAGGTGGAAGG + Intronic
1035276803 7:157752806-157752828 GGCCAGCTCCATCTCAGGGATGG + Intronic
1035319142 7:158017350-158017372 GCCCAGCCCCTCCCTGGGGAGGG + Intronic
1037513067 8:19603215-19603237 CCCCAGTTCCTCCATGGGGATGG + Intronic
1037514009 8:19611579-19611601 TCCCAGCTCCACCACTGGGATGG - Intronic
1037861989 8:22411997-22412019 GGCCAGCCCCACCCAGGGCAGGG - Intronic
1042912897 8:73845069-73845091 GGCCAGCTGCACCATCTGGGAGG + Intronic
1048262024 8:132953254-132953276 GGGCTGCTCCAGCCTGGGGAAGG - Intronic
1049054592 8:140225845-140225867 GGCCAGCTCCTCCCGAGGGAAGG + Intronic
1049671384 8:143871628-143871650 GGCCAGCTTCTCCACGGAGAGGG + Exonic
1053260266 9:36656894-36656916 GGCATGAGCCACCATGGGGACGG + Intronic
1056965339 9:91160111-91160133 GGCCAGCAGCACCCTGGAGAGGG - Intergenic
1060995672 9:127873880-127873902 GCCCACCTCCTCCCTGGGGAAGG - Intronic
1061237492 9:129351386-129351408 GCCCAGCTCCAACCTGGGGAGGG + Intergenic
1061326722 9:129868799-129868821 GGCCAGCTCCACGAGTGGGCAGG - Intronic
1062334831 9:136060522-136060544 GGTCAGCTCCACACTGGGGCCGG + Intronic
1062554540 9:137107990-137108012 GGCCTGGTCCACAGTGGGGATGG - Intronic
1062619951 9:137416232-137416254 TGGCCGCTCCACCAGGGGGAGGG + Intronic
1062697169 9:137881326-137881348 GGCCAGCTCCACCACAGGACAGG + Intronic
1185464264 X:345844-345866 GGGGAGCTCCAGCATGGGGGTGG + Intronic
1187325023 X:18278588-18278610 GGCCAGCTTCCCCATGGGACTGG + Intronic
1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG + Intergenic
1187521851 X:20021101-20021123 CGCCGGGTCCACCCTGGGGAAGG - Intronic
1188451023 X:30308464-30308486 GGCCAGCTCAAGCATGAGCAGGG + Exonic
1190717375 X:53115393-53115415 GGCCAGCCCCATGCTGGGGATGG + Intergenic
1190756391 X:53405460-53405482 GTCCAGCTCCAGCCTGGGCAAGG + Intronic
1191668168 X:63724557-63724579 GGCCAGATCGACGATGAGGAGGG - Exonic
1195703825 X:107724285-107724307 GGCCAGCTTCTCCCTGGGGAGGG + Intronic
1196639075 X:118037773-118037795 GCACAGCTCCAATATGGGGATGG + Intronic
1199851399 X:151726877-151726899 GGCCAGCTTCTCCATTGGGCAGG + Intergenic
1200093087 X:153644776-153644798 GGCAACCTCCGCAATGGGGAAGG - Intronic
1200097890 X:153672670-153672692 GGCCAGCACCACCTCGGAGAAGG + Exonic
1200115419 X:153767774-153767796 ACCCAGCTCCACCATGGGGAAGG - Exonic