ID: 954713881

View in Genome Browser
Species Human (GRCh38)
Location 3:52517612-52517634
Sequence GGGTCCTGACCTTAGAGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954713881_954713891 13 Left 954713881 3:52517612-52517634 CCCCTGCTCTAAGGTCAGGACCC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 954713891 3:52517648-52517670 CTTCACTGACGAGAAGGAGAGGG 0: 1
1: 0
2: 2
3: 15
4: 177
954713881_954713887 7 Left 954713881 3:52517612-52517634 CCCCTGCTCTAAGGTCAGGACCC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 954713887 3:52517642-52517664 GTCCTCCTTCACTGACGAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 87
954713881_954713892 14 Left 954713881 3:52517612-52517634 CCCCTGCTCTAAGGTCAGGACCC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 954713892 3:52517649-52517671 TTCACTGACGAGAAGGAGAGGGG 0: 1
1: 0
2: 2
3: 11
4: 190
954713881_954713894 25 Left 954713881 3:52517612-52517634 CCCCTGCTCTAAGGTCAGGACCC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 954713894 3:52517660-52517682 GAAGGAGAGGGGACTGAGGCAGG 0: 1
1: 0
2: 8
3: 152
4: 985
954713881_954713893 21 Left 954713881 3:52517612-52517634 CCCCTGCTCTAAGGTCAGGACCC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 954713893 3:52517656-52517678 ACGAGAAGGAGAGGGGACTGAGG 0: 1
1: 0
2: 3
3: 40
4: 470
954713881_954713890 12 Left 954713881 3:52517612-52517634 CCCCTGCTCTAAGGTCAGGACCC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 954713890 3:52517647-52517669 CCTTCACTGACGAGAAGGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954713881 Original CRISPR GGGTCCTGACCTTAGAGCAG GGG (reversed) Exonic
900177220 1:1296246-1296268 GGGACCGCACCTTGGAGCAGTGG + Exonic
901663785 1:10815117-10815139 GGGCCCTGGCCTTGGAGCTGTGG + Intergenic
902197244 1:14806768-14806790 GGCTCCAAACCTTGGAGCAGAGG - Intronic
902417036 1:16245979-16246001 TGGTCATGAGCTTGGAGCAGAGG - Intergenic
904418383 1:30376243-30376265 GGGGCCTGATTTGAGAGCAGAGG - Intergenic
904890235 1:33774171-33774193 GGGTCCTCCCCTTTGTGCAGGGG + Intronic
905107708 1:35574086-35574108 GGCGCCTGACCGTAGGGCAGCGG - Exonic
905405149 1:37727398-37727420 GTGTTCTGCCCTGAGAGCAGAGG - Intronic
906073671 1:43036046-43036068 GGGGCCTGGCCTGAGATCAGAGG + Intergenic
910401850 1:86845324-86845346 GGGTCCTGTCCTTAGAGTCTTGG + Intergenic
916513930 1:165497832-165497854 GGGTGGTGACCCTTGAGCAGAGG + Intergenic
916624885 1:166544567-166544589 AGCTTCTGCCCTTAGAGCAGAGG + Intergenic
916808162 1:168280408-168280430 GAGCCCTGACCCTTGAGCAGTGG + Intergenic
918436521 1:184519368-184519390 GGGTCCTGCTCTTAGAGAAGAGG - Intronic
919806016 1:201381447-201381469 GGGTCCAGGCCTCAGAGAAGGGG + Exonic
920855383 1:209657373-209657395 GGCTCTTGACCTCAGGGCAGGGG - Intergenic
923000631 1:230003954-230003976 GGGTCCCCACCTGAAAGCAGTGG - Intergenic
924772719 1:247090477-247090499 GGGCCCTGATCTTTGAGAAGGGG + Intergenic
1062905104 10:1174494-1174516 TGGTCCTGAGCTCTGAGCAGTGG + Intergenic
1067741697 10:48900340-48900362 TGATCCTGAACTGAGAGCAGAGG + Intronic
1071662647 10:87519947-87519969 GGTTCCAGACCTTTCAGCAGAGG + Intronic
1072531308 10:96322014-96322036 GGGGCGCCACCTTAGAGCAGTGG + Intronic
1073085654 10:100886908-100886930 GGGTTCTTACCTTAGAGCCTGGG - Intergenic
1073691533 10:105814615-105814637 AGGTTTTGACTTTAGAGCAGTGG - Intergenic
1077036676 11:498767-498789 GGGTCCTGAGCCTGGAGCTGGGG + Exonic
1078386723 11:10899122-10899144 GGGTACTCACCTGAGACCAGGGG + Intergenic
1080911136 11:36600258-36600280 AGGTCTTGCCCTTAAAGCAGGGG + Intronic
1083860795 11:65418941-65418963 GAGTGGTGACCTTAGGGCAGAGG + Intergenic
1084657216 11:70526770-70526792 GGGTCCTTGCCTGAGAGTAGGGG - Intronic
1084758514 11:71253279-71253301 GGGTCCTGAGCTTGGAGCTGTGG + Intergenic
1084967954 11:72754099-72754121 TGCTCCTTCCCTTAGAGCAGAGG + Intronic
1086172615 11:83852909-83852931 GACTCCTGCCCTTAGAGCAGAGG + Intronic
1088620093 11:111672786-111672808 AGGTCCAGACCTTTGAGCAAAGG + Intronic
1089785208 11:120902709-120902731 GGGCCCTGGCATGAGAGCAGGGG + Intronic
1091508602 12:1098741-1098763 GAGTCCTGAAATCAGAGCAGAGG + Intronic
1092157799 12:6295682-6295704 GAGTCCTGACCTTTAAGCCGAGG - Intergenic
1092283190 12:7112996-7113018 GGGGCCTTAACATAGAGCAGAGG - Intergenic
1096182333 12:49557722-49557744 GGGTGCTGGGCTCAGAGCAGAGG - Exonic
1096472995 12:51890582-51890604 AGGTGCTGACCTGACAGCAGTGG + Exonic
1096718097 12:53503014-53503036 GGGCCCTGACCTGAGAGAGGGGG - Exonic
1096760016 12:53833600-53833622 GAGGCCTGACCCTAGACCAGGGG + Intergenic
1096810565 12:54167047-54167069 GTCTCCTGACCTTGGAGCGGGGG - Intronic
1097742815 12:63264716-63264738 TGTTCCTGATTTTAGAGCAGGGG + Intergenic
1101025794 12:100604667-100604689 TGGTCCAGACCTTAGAGGAAAGG + Intronic
1101930474 12:109009704-109009726 GGCGCCTGGCCCTAGAGCAGTGG + Intronic
1104134315 12:125923076-125923098 AGCTCCTGACCTTGGAGCTGTGG - Intergenic
1104595198 12:130115877-130115899 GGCTGCTGACCCTGGAGCAGAGG + Intergenic
1105811656 13:24001297-24001319 GCATCCTGACCTTAGCGCAGAGG - Intronic
1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG + Intronic
1108106369 13:47014799-47014821 GGATCCTGACCTCAGGGAAGTGG - Intergenic
1112334939 13:98506984-98507006 GCGTGCTGACCTGTGAGCAGAGG + Intronic
1113221401 13:108107766-108107788 GGTTCCTGAGCTTAGAGCCCTGG - Intergenic
1113649719 13:112027009-112027031 GGGTCCACATCTGAGAGCAGGGG + Intergenic
1114673662 14:24428017-24428039 GGGTCCTGAGCTAAGGGCTGGGG - Intronic
1114924812 14:27383478-27383500 AGGATCTGTCCTTAGAGCAGGGG - Intergenic
1119099436 14:71866591-71866613 GGGTTCTGACCTTAGCAGAGGGG + Intergenic
1119605550 14:76013259-76013281 GGGTCCTTCCCACAGAGCAGAGG - Intronic
1119626172 14:76178346-76178368 GGGTCAAAGCCTTAGAGCAGTGG + Intronic
1120016913 14:79484313-79484335 GGTTCCTGATCTTAGAGTACAGG + Intronic
1121357690 14:93229807-93229829 AGGTCCTGCCCTCAAAGCAGAGG + Intergenic
1124144866 15:27115338-27115360 GGTTCGTGATCTCAGAGCAGAGG - Intronic
1125523079 15:40358699-40358721 GAGTCCTGGCCTGAGAGGAGGGG - Intronic
1128637003 15:69309063-69309085 GGGTCCTGAGCTCAGAAGAGAGG + Intronic
1129642829 15:77398685-77398707 TGTTCCAGACCTTAGAGGAGAGG - Intronic
1129723358 15:77889679-77889701 GGGGCCTGACCCTGGGGCAGTGG + Intergenic
1130260690 15:82352017-82352039 GGGTCCTGACCTTCCAGCTGAGG - Intergenic
1130280546 15:82516990-82517012 TGGTCCTGACCTTCCAGCTGAGG + Intergenic
1130471917 15:84233173-84233195 TGGTCCTGACCTTCCAGCTGAGG + Intergenic
1130479411 15:84347744-84347766 TGGTCCTGACCTTCCAGCTGAGG + Intergenic
1130492359 15:84440385-84440407 TGGTCCTGACCTTCCAGCTGAGG - Intergenic
1130594215 15:85237810-85237832 GGGTCCTGACCTTCCAGCTGAGG + Intergenic
1131283413 15:91038884-91038906 GGGTCCTGACCTTCCAGCTGAGG - Intergenic
1132720572 16:1313728-1313750 GTCTCCTCACCTTCGAGCAGAGG + Intronic
1132725464 16:1336461-1336483 GGGACCAGACCCTAGAGCTGAGG - Intronic
1132739501 16:1404402-1404424 GTTTCCTGACCTTAGAGGATGGG - Intronic
1134887492 16:17806592-17806614 GGCTGCTGACCTTAGTTCAGTGG + Intergenic
1135609323 16:23852178-23852200 GCGTCCTGATCTTAGAGGAAAGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1137424659 16:48367388-48367410 GGGGCCTGTCCATAGATCAGTGG - Intronic
1139377567 16:66509731-66509753 GGGCCTTGTCCTTAGAGCACTGG - Exonic
1139497108 16:67327582-67327604 GGGTCTGGACCTCAGAGGAGAGG + Intronic
1141539925 16:84712258-84712280 TGGTCCTGTCCTGAGAGTAGCGG + Intronic
1142266899 16:89068106-89068128 GGGTCCTGACAGTACAGCAGGGG - Intergenic
1143338250 17:6189639-6189661 AGGTCCTGTCCTGAGAACAGTGG - Intergenic
1144268701 17:13596671-13596693 GCGCTCTGTCCTTAGAGCAGAGG - Intronic
1147744277 17:42685522-42685544 TGGTCCAGGCCTTAGAGAAGTGG - Intronic
1148960438 17:51388030-51388052 GAGTCCTGAACTTAGACCAGTGG - Intergenic
1150283876 17:63944868-63944890 GGGTCCTGCCCTCAGGGCTGTGG - Intronic
1151586078 17:75009178-75009200 GGATCCTGAGCTGAGAGCTGGGG + Intergenic
1151681550 17:75625272-75625294 TGGCCTTGACCTTAGAGAAGGGG - Intergenic
1154393887 18:13969506-13969528 GGGTGCAGAGTTTAGAGCAGAGG + Intergenic
1156312647 18:35939046-35939068 GGGCCCAGACCTTTGAGGAGAGG + Intergenic
1157222582 18:45838352-45838374 GGGTCCCGTCCCTAGAGCAGTGG + Intronic
1157681356 18:49609779-49609801 GGGGACTGTCCTTAGAGCAGAGG + Intergenic
1161778869 19:6278783-6278805 TGGTCCTGGTCTCAGAGCAGAGG + Intronic
1163018015 19:14468586-14468608 GGAACCTGACCCTAAAGCAGAGG - Intronic
1163271972 19:16259947-16259969 GGCTCCTGACCTCAGAGCCTCGG + Intergenic
1166710815 19:44936047-44936069 GCGTGCTGACCTTGGAGCTGCGG + Intergenic
1167203765 19:48086162-48086184 GGGGCATGGCCTGAGAGCAGTGG + Intronic
1167524166 19:49973284-49973306 GGGTTCTGACGTTAGAGATGGGG - Intergenic
1168279355 19:55296152-55296174 GGGGTCTGACCTTACAGGAGTGG - Intronic
926080605 2:9983142-9983164 GGATCCTTTCCTAAGAGCAGGGG + Intronic
927484566 2:23479601-23479623 TGGTCCGGACCTTAGGACAGAGG - Intronic
928399978 2:30970824-30970846 GGCTCCTGAGCTGTGAGCAGGGG - Intronic
935702533 2:105824903-105824925 GGCTCCTGATCTTACTGCAGTGG - Intronic
937989624 2:127654967-127654989 GGGTCAGGACCTGACAGCAGGGG + Intronic
938235627 2:129704193-129704215 GGGGCCTGGCCTCTGAGCAGTGG - Intergenic
940695695 2:156975038-156975060 TGTTCCTGAGCTTAGAGGAGAGG + Intergenic
942393377 2:175520129-175520151 GGGTCCTCTTCTTTGAGCAGTGG + Intergenic
944392184 2:199228963-199228985 GGGTCCACACCTTAAAGAAGGGG - Intergenic
948149767 2:235735996-235736018 GAATCCTCAGCTTAGAGCAGAGG - Intronic
948899333 2:240948222-240948244 GGGTTCTGACCTGAGCCCAGAGG + Intronic
948987822 2:241536128-241536150 GGGGCCTGACCTGTGACCAGGGG + Intergenic
949058575 2:241943399-241943421 GGTTACTGACCTTAAAACAGGGG - Intergenic
1172782625 20:37446267-37446289 GGGGCCTGACCTTGGAGGACAGG - Intergenic
1174865605 20:54132627-54132649 GGGACCTGTCCTGAGAGCTGTGG + Intergenic
1175626514 20:60492646-60492668 GGATTCTGATTTTAGAGCAGAGG + Intergenic
1176241182 20:64076666-64076688 GGGTTCTGACCTGAAAGCTGAGG - Intronic
1177182411 21:17757869-17757891 GGGCCCTGCACTTGGAGCAGCGG - Intergenic
1179461370 21:41537672-41537694 GTGTCCTGGCCGTAGTGCAGTGG - Intergenic
1179493778 21:41758822-41758844 GGGAAGTGACCTTAGACCAGAGG - Intronic
1185276430 22:49951930-49951952 GGGTCCTGAGCTCCCAGCAGAGG - Intergenic
1185330352 22:50249475-50249497 GGGTCCTGACCTTTGACCTCTGG - Intronic
950405519 3:12801907-12801929 AGTCCCTGCCCTTAGAGCAGTGG - Intronic
951485713 3:23207364-23207386 GGGGCCTGAACTCAGAGCAAAGG + Intronic
953903536 3:46856990-46857012 GGGCCCTGGCCCCAGAGCAGGGG + Intergenic
954625820 3:52021393-52021415 GGGTCCTTGCCTTTGAGCTGGGG + Intergenic
954713881 3:52517612-52517634 GGGTCCTGACCTTAGAGCAGGGG - Exonic
954929413 3:54268331-54268353 GGGTCCACACCTCAGTGCAGTGG - Intronic
959186473 3:103053093-103053115 GTGGCCTGGCCTTAGAACAGTGG - Intergenic
962378732 3:134879694-134879716 TGGTCCTGGCATTAGAGCAAGGG + Intronic
968074272 3:195807995-195808017 GGGCCATGGCCCTAGAGCAGGGG - Intronic
968598879 4:1499792-1499814 GGGTGCTGACTGTGGAGCAGGGG - Intergenic
968753568 4:2402885-2402907 GGGTCCTGAGCTAGGAGGAGGGG - Intronic
972785609 4:42323997-42324019 GGCTCCACTCCTTAGAGCAGTGG + Intergenic
973531781 4:51843145-51843167 GGGTCCTCAGCTTCGAGCCGAGG + Exonic
975470011 4:74755229-74755251 GGGACCTTTCCTTAGAGAAGTGG - Intronic
977644525 4:99397646-99397668 TGTTCCTGACCTTAGAGGAAAGG - Intergenic
981110000 4:140924438-140924460 TTGTCCTGACCAGAGAGCAGTGG + Intronic
986612348 5:9582040-9582062 GTTACCTGACCTCAGAGCAGCGG - Intergenic
988539141 5:32093486-32093508 GGGCACTGACCTTCGAGCAGTGG + Intronic
990468447 5:56090981-56091003 AAGTCCTGAACTTAGCGCAGTGG + Intergenic
991203165 5:64017915-64017937 GGGGCCTGAGCTGAGAACAGTGG + Intergenic
994210724 5:97085256-97085278 GGGACCGGGCCTTGGAGCAGGGG + Intergenic
997723194 5:136097393-136097415 GGGGCCTCACCATAGAGAAGAGG - Intergenic
998128550 5:139639725-139639747 TGGTCCTGAGGTTAGACCAGTGG - Intergenic
998602682 5:143601394-143601416 GGGTACAGACTTTGGAGCAGAGG + Intergenic
999314840 5:150576662-150576684 GGGCCCTGGCCTTGGAGCACAGG - Intergenic
1001905264 5:175466919-175466941 TGGCCCTGAGCTTAGAGGAGAGG + Intergenic
1001960604 5:175878528-175878550 GGGTCTTGACCTCAGAGCGATGG + Intronic
1001971560 5:175959197-175959219 GGGTTGTTACCTAAGAGCAGTGG - Intronic
1002245882 5:177884579-177884601 GGGTTGTTACCTAAGAGCAGTGG + Intergenic
1003172223 6:3728896-3728918 TGGTCCTGGTCTTAGAGCTGTGG - Intronic
1004871693 6:19911430-19911452 TGGTCATTACCATAGAGCAGTGG - Intergenic
1006441946 6:34058568-34058590 GGGTTCTGCCCTGAGAGGAGGGG + Intronic
1007716434 6:43858821-43858843 AGCTCCTGGCCTTCGAGCAGAGG + Intergenic
1010548379 6:77187838-77187860 TGTTCCTGACCTTAGAGAAAAGG - Intergenic
1010745953 6:79561878-79561900 GGGTACTGAACTTTGAGTAGAGG + Intergenic
1012303093 6:97614306-97614328 TGTTCTTGACCTTAGAGGAGAGG + Intergenic
1013082409 6:106824048-106824070 GGGAGCTGGCTTTAGAGCAGAGG - Intergenic
1019018262 6:168896361-168896383 GGGTCCTGGCTGTAGAGGAGAGG - Intergenic
1019515420 7:1437848-1437870 AGGTCCTGGCCTTCGAGGAGGGG + Intronic
1030599417 7:111576413-111576435 TGTTCCAGACCTTAGAGGAGAGG - Intergenic
1034757856 7:153640039-153640061 GGCTCCTGTCCTAAGAGCAATGG + Intergenic
1035795059 8:2348348-2348370 GGGGCAGGATCTTAGAGCAGTGG - Intergenic
1037662669 8:20940963-20940985 GCCTCCTGCCCTTAGAGCTGTGG - Intergenic
1039685064 8:39792628-39792650 AGATCCTGAGCTCAGAGCAGTGG + Intronic
1039908819 8:41808066-41808088 TGGGTCTGGCCTTAGAGCAGAGG - Intronic
1039988441 8:42467654-42467676 GCGTGCTGACCTTTGAGCTGAGG + Intronic
1042489453 8:69381200-69381222 GAGTCCCGACCTAACAGCAGAGG - Intergenic
1045819537 8:106320040-106320062 GGCTGCAGACCTTAGAGCAGTGG + Intronic
1047616980 8:126570784-126570806 GGGCTCTCACCTTAGAGCAAAGG - Intergenic
1047785300 8:128148599-128148621 GGGGACTGACCTTACAGAAGAGG - Intergenic
1047785911 8:128153689-128153711 AGGTCCTGTCCTCAGTGCAGCGG + Intergenic
1048794910 8:138141045-138141067 GAGTCCTGGCCTTAGAGGTGTGG - Intronic
1050624395 9:7487612-7487634 GAGTCCTGAGCTCAGAACAGGGG + Intergenic
1050624621 9:7489598-7489620 GGTTCCTGAGCTAAGGGCAGAGG - Intergenic
1053289292 9:36869421-36869443 TGGTGCTGCCCTTAGGGCAGGGG - Intronic
1055387505 9:75778599-75778621 AGTTCCTGACCTTAGAGGAAAGG - Intergenic
1056234974 9:84585769-84585791 GAGTCCTAACCTTGGAGCGGAGG + Intergenic
1060014369 9:120073728-120073750 GGGGCCTGACCTTAGATAAATGG - Intergenic
1060112018 9:120913328-120913350 GCATCCTGAGCTTGGAGCAGAGG - Exonic
1060513041 9:124248233-124248255 GGGTGCTGACTGCAGAGCAGTGG + Intergenic
1060587462 9:124795415-124795437 GGGTCCTGATCTTGGTGCACTGG - Intronic
1061934811 9:133851554-133851576 GGGTCCTAACCTCACAACAGAGG + Intronic
1191126353 X:56958503-56958525 GGTTCCAGATCTTAGAGCTGAGG - Intergenic
1193776938 X:85654689-85654711 TGTTCCTGATCTTAGAGCAAAGG + Intergenic
1194559435 X:95402866-95402888 TGGTCCTGATCTTAGAGGAAAGG - Intergenic
1196122705 X:112067654-112067676 GGGCTCTGATCTGAGAGCAGTGG - Intronic