ID: 954714465

View in Genome Browser
Species Human (GRCh38)
Location 3:52520256-52520278
Sequence GCTGCAGGAGAAAGAGATGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1047
Summary {0: 1, 1: 0, 2: 5, 3: 123, 4: 918}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954714465_954714474 0 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714474 3:52520279-52520301 CGAACGCGGGCCGTGAGTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 18
954714465_954714483 29 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714483 3:52520308-52520330 GCTTGGATGAAGGGAGTAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 289
954714465_954714475 1 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714475 3:52520280-52520302 GAACGCGGGCCGTGAGTCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 44
954714465_954714476 6 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714476 3:52520285-52520307 CGGGCCGTGAGTCTGGGGAGAGG 0: 1
1: 0
2: 0
3: 21
4: 227
954714465_954714480 19 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714480 3:52520298-52520320 TGGGGAGAGGGCTTGGATGAAGG 0: 1
1: 0
2: 5
3: 62
4: 544
954714465_954714479 12 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714479 3:52520291-52520313 GTGAGTCTGGGGAGAGGGCTTGG 0: 1
1: 0
2: 5
3: 62
4: 616
954714465_954714482 26 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714482 3:52520305-52520327 AGGGCTTGGATGAAGGGAGTAGG 0: 1
1: 1
2: 2
3: 31
4: 367
954714465_954714477 7 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714477 3:52520286-52520308 GGGCCGTGAGTCTGGGGAGAGGG 0: 1
1: 0
2: 4
3: 35
4: 357
954714465_954714473 -1 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714473 3:52520278-52520300 CCGAACGCGGGCCGTGAGTCTGG 0: 1
1: 0
2: 0
3: 0
4: 21
954714465_954714481 20 Left 954714465 3:52520256-52520278 CCCCCATCTCTTTCTCCTGCAGC 0: 1
1: 0
2: 5
3: 123
4: 918
Right 954714481 3:52520299-52520321 GGGGAGAGGGCTTGGATGAAGGG 0: 1
1: 0
2: 1
3: 38
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954714465 Original CRISPR GCTGCAGGAGAAAGAGATGG GGG (reversed) Exonic
900115381 1:1025813-1025835 GCTCCAGGAGAAACAGAGGTGGG - Intronic
900125198 1:1065833-1065855 GCTGAAGCAGAGAGAGAAGGCGG + Intergenic
900144477 1:1151848-1151870 GTAGCAGGAGACAGAGACGGAGG - Intergenic
900806692 1:4772258-4772280 GCTGGAAGAGAAAGAGTTTGGGG - Exonic
900986940 1:6078583-6078605 GATGCAGGGGATAGAGCTGGGGG + Intronic
901077656 1:6565467-6565489 GCTACAGGAGCAAAAGAAGGAGG + Intronic
901110643 1:6791299-6791321 GCTACAGGACAAAGGGATGGTGG - Intronic
901276659 1:7996822-7996844 GGAGCAGGAGCAAGAGATGGGGG + Intergenic
902641176 1:17767307-17767329 GCTGCTGGAGACAGAGCCGGGGG + Intronic
902754222 1:18538509-18538531 GGTGAAGGAGAAAGAGAAGGAGG - Intergenic
903046259 1:20566378-20566400 GAGGCAGCAGACAGAGATGGTGG - Intergenic
903493809 1:23750911-23750933 GCAGAAGGAGGAGGAGATGGAGG + Exonic
904357048 1:29947032-29947054 GAAGAAGGAGAAAGAGAAGGAGG - Intergenic
904414997 1:30355304-30355326 GAGGCAGGAGAAAGAGAGAGAGG - Intergenic
904440253 1:30525328-30525350 GCTGAAGAAGAAAGAGGAGGAGG + Intergenic
905258785 1:36703081-36703103 GGTGCAAGAGAAAGAGGAGGAGG + Intergenic
906664474 1:47609561-47609583 GTGGCAGGGGAAAGAGAGGGAGG + Intergenic
906835434 1:49078722-49078744 GGTCCAGGAGAAAGATAAGGAGG - Intronic
907277356 1:53324224-53324246 CCTGCAGGAGAGAGAGCTGTTGG - Intronic
907315571 1:53568715-53568737 GGAGCAGGAGACAGAGAAGGGGG - Intronic
907639752 1:56175779-56175801 GCTGCAAGAAAAGAAGATGGAGG + Intergenic
908295599 1:62709587-62709609 GCAGCAGGAGGAAGAGACAGAGG - Intergenic
908349131 1:63266984-63267006 GGAGTAGGAGAAAGAGAAGGAGG + Intergenic
908469374 1:64428003-64428025 GCTGAAGGAGAAACACATGAAGG + Intergenic
909005305 1:70268690-70268712 GTTGTAGGAGAAAGTGGTGGGGG + Intronic
909379538 1:74982482-74982504 GCTGCAGGAGAGAGACAGTGAGG - Intergenic
909728845 1:78870227-78870249 AGAGCAGGAGCAAGAGATGGAGG + Intergenic
910130786 1:83902888-83902910 GATGCTGGAGAAAGAGGGGGAGG - Intronic
910144588 1:84064908-84064930 GGGGGAGGAGAAAGGGATGGAGG - Intergenic
910360050 1:86406917-86406939 GGTGCAAGAGAAGGAGGTGGTGG - Intergenic
910420070 1:87050813-87050835 TCTGTAGGAGAAAGTGATAGTGG - Intronic
910759978 1:90724076-90724098 GCTCCATGAGAAGGGGATGGGGG + Intergenic
911354855 1:96803537-96803559 GCTGAATTAAAAAGAGATGGAGG + Intronic
912137872 1:106683313-106683335 GGAGCAGGAGAAAGAGTTTGGGG - Intergenic
912801697 1:112723455-112723477 GCAGCAGGGGAAGGAGCTGGAGG - Intronic
913059169 1:115188936-115188958 GCTGCAGGACAGATAGAGGGAGG - Intergenic
913318752 1:117574375-117574397 GCTGCAGGAGAAGGAGGATGGGG - Intergenic
913997660 1:143664648-143664670 GGTGCAGCAGAAAGACATGGTGG + Intergenic
914239389 1:145842530-145842552 GCTGCAGGGGATAGAGAGGGGGG - Intergenic
914508080 1:148306598-148306620 GGCGCAGCAGAAAGACATGGTGG + Intergenic
914964091 1:152237708-152237730 GGGGCAGGAGAAAGAGATGGGGG - Intergenic
915045350 1:153008858-153008880 GCTGCAGGAGAAAGAGTAGAGGG - Intergenic
915058304 1:153157903-153157925 GTGGCAGGAGACAGAGAGGGGGG + Intergenic
915569623 1:156737448-156737470 ACTGCAGGAGGAGGTGATGGAGG - Exonic
915829486 1:159113316-159113338 GCTGAAGGAGAGAGAAATGTAGG - Intronic
916060169 1:161092864-161092886 GGTGCAGGAGGATGAGTTGGGGG + Intergenic
916384708 1:164254616-164254638 GGAGCAGGAGAGAGAGTTGGGGG - Intergenic
916500294 1:165381103-165381125 GCTGCAAGAGGAAGACAGGGAGG - Intergenic
916560942 1:165933756-165933778 GCTGCAGTAGAAAGAAAGCGAGG + Intergenic
916659177 1:166905380-166905402 ACTGAAGGAGAAAGAGTTTGAGG + Intergenic
916683751 1:167126580-167126602 GCTGCTGGAGATTGAGAAGGAGG + Exonic
916819714 1:168386599-168386621 GCAGCAGGAGAGAGAGAGGGTGG + Intergenic
916977985 1:170102140-170102162 GTTCCAGGAGAGAGAGGTGGAGG - Intergenic
916993302 1:170267936-170267958 GCTGCAGGAGAATGGGAGAGGGG + Intergenic
917262740 1:173187671-173187693 GCCACAGGAGAAAGAAAAGGAGG + Intronic
917442173 1:175077757-175077779 GAAGCTGGAGGAAGAGATGGTGG + Exonic
917923283 1:179768500-179768522 GCTGCAGGGGCAAGTGATGGTGG + Intronic
918162085 1:181910815-181910837 GTGGCAGGAGAGAGAGAAGGAGG - Intergenic
918276702 1:182959754-182959776 GCAGCTGGAGACAGAGATCGAGG - Intergenic
918559126 1:185843318-185843340 TCGGCAGGAGAAAGAAAAGGGGG + Intronic
919177005 1:194031685-194031707 GGAGGAGAAGAAAGAGATGGGGG - Intergenic
919333309 1:196199374-196199396 GATGAATGAGGAAGAGATGGTGG + Intergenic
919846796 1:201647857-201647879 GGTGCAGGTAAAAGAGACGGAGG - Intronic
920443106 1:205994506-205994528 CATGCAGGAAGAAGAGATGGGGG + Intronic
920544974 1:206808869-206808891 GCTGCAGGGGCTAGAGATGCTGG + Intronic
920719790 1:208376435-208376457 GCTGCATGAGAAGTAGATGGTGG - Intergenic
921307251 1:213809217-213809239 GCTTGAGGAGACAGAGATGAGGG + Intergenic
921858308 1:220013382-220013404 GATGAAGGGGAAAGAGATGTGGG - Intronic
922163611 1:223096882-223096904 GGTGCAAGAGAAGGAGAAGGAGG + Intergenic
922398047 1:225223028-225223050 GCTGAAGGAGAAGGAGGAGGTGG - Intronic
922808110 1:228401080-228401102 GCTGGAGGAGGAGGAGCTGGAGG - Exonic
922885636 1:229018455-229018477 GCTTCAGAGGACAGAGATGGGGG + Intergenic
922959584 1:229635147-229635169 GCTGCAGGATCAAGAGATAATGG - Exonic
923179882 1:231506438-231506460 GCCTGAGGAGAGAGAGATGGGGG + Intergenic
924225069 1:241915198-241915220 AAAGCAGGAGCAAGAGATGGGGG + Intergenic
924481150 1:244435521-244435543 GATGAAGGAGGAAGAGAAGGAGG - Intronic
1062778403 10:175955-175977 GGTGCAGGGAAGAGAGATGGAGG - Intronic
1063883445 10:10553814-10553836 GCTGGAGGAGAAAGAGCTTGGGG + Intergenic
1063997053 10:11629288-11629310 GAAAAAGGAGAAAGAGATGGAGG - Intergenic
1064242606 10:13644895-13644917 CCTGCAGGATAAAGAGATACCGG - Exonic
1064425233 10:15224203-15224225 GAGCCAGGAGAAAGAGAAGGAGG + Intronic
1064592630 10:16910107-16910129 GAAGAAGGAGAAAGAGAAGGAGG - Intronic
1064634023 10:17345498-17345520 GAGGCAGGAGAAGGAGATGGAGG + Intronic
1064682893 10:17829077-17829099 GCAGCAGGAGAAAGAGTTCTGGG - Intronic
1065084910 10:22164548-22164570 GTCTCAGGAGAAAGAGAAGGTGG + Intergenic
1065109782 10:22428339-22428361 GTTGAAGGAGAAAGAGATCAGGG - Intronic
1065120071 10:22520711-22520733 GATGCATGAGAGAGAGAGGGAGG - Intergenic
1065918026 10:30368402-30368424 GCTGCAGGAGTAGGAGAGGCTGG - Intronic
1066411606 10:35175737-35175759 GCAGCAGGAAAAAGAGAAGTAGG + Intronic
1066700552 10:38123118-38123140 GGTGCAGGGCAAAGAGAGGGGGG + Exonic
1067056880 10:43057689-43057711 GAGGCAGGAGCAAGGGATGGCGG - Intergenic
1067056892 10:43057729-43057751 GAGGCAGGAGCAAGGGATGGTGG - Intergenic
1067089424 10:43259007-43259029 GCTGCATGGGCCAGAGATGGGGG - Intronic
1067381001 10:45773332-45773354 GTTGCAGGAGGAACAGATGTGGG - Exonic
1067888700 10:50113971-50113993 GTTGCAGGAGGAACAGATGTGGG - Exonic
1068001846 10:51344242-51344264 GGAGCAGGAGAGAGAGCTGGGGG + Intronic
1068008780 10:51421629-51421651 TGTGCAGGAGACAGACATGGAGG - Intronic
1068086686 10:52382135-52382157 GCTGCAGTAAACAGAGATTGCGG - Intergenic
1068087583 10:52393619-52393641 TCTGCAAGAGGAAGAAATGGGGG - Intergenic
1068198284 10:53746507-53746529 GGAGCAGGAGGAAGAGAAGGGGG - Intergenic
1068962061 10:62877030-62877052 GCTGCAGGGGAAGGGGAAGGAGG - Intronic
1069196281 10:65555255-65555277 GATTCAGAAGAAAAAGATGGAGG + Intergenic
1069563137 10:69445371-69445393 GGAGAAGGAGAAAGAGATGTGGG - Intergenic
1069613766 10:69793057-69793079 ACTGCTGGGGAAAGAGCTGGAGG + Intergenic
1070148255 10:73789934-73789956 TCTGAGGGAGAAAGAGACGGAGG - Exonic
1070486654 10:76938310-76938332 GCTGCAGGAGAAAGCAGTGTTGG - Intronic
1070603180 10:77879795-77879817 CCTGCAGGAAAAACAGATGGGGG + Intronic
1070661532 10:78310019-78310041 GGAGAAGGAGAAAGAGAAGGAGG - Intergenic
1070672104 10:78385158-78385180 GCTGTGGGAGAAAGAGCTGAGGG + Intergenic
1070673985 10:78399321-78399343 GCTGTCAGAGAAAGAGATGGAGG + Intergenic
1071341501 10:84653131-84653153 GCTGCCAGAGAAAGGGATGGAGG - Intergenic
1071359490 10:84831892-84831914 GCTGCAGGAGGTAGAGATTAGGG - Intergenic
1071877075 10:89853338-89853360 GCAGCAGGAGAAAGAGCTCAAGG - Intergenic
1072229616 10:93403263-93403285 GCTGGAGGAGAAGGAGGAGGAGG - Intronic
1072515602 10:96179809-96179831 GGAGAAGGAGAAAGAGAAGGAGG - Intronic
1072563326 10:96596993-96597015 GCCTCAGGAGCAAGAGAGGGAGG + Intronic
1072783259 10:98264429-98264451 TTTGGAGGGGAAAGAGATGGAGG + Intronic
1073073439 10:100808990-100809012 GATGGGGTAGAAAGAGATGGTGG - Intronic
1073122455 10:101131133-101131155 GATGCAGGAGCCAGAGATAGAGG - Exonic
1073689164 10:105788158-105788180 GAAGGAGGAGAAAGAGAAGGAGG - Intergenic
1073976878 10:109112198-109112220 ACAGCAGGAGAAAGAGAGTGAGG - Intergenic
1074206321 10:111286114-111286136 GCTAAAGGAGAAAGGGTTGGTGG - Intergenic
1074226322 10:111487967-111487989 GCAGCAGGAGACAGAGAGAGGGG - Intergenic
1074691130 10:116005058-116005080 ACAGGAGGAGAAGGAGATGGAGG - Intergenic
1075148036 10:119899977-119899999 GGGGCAGGAGAAAGGGATGGGGG - Intronic
1075529870 10:123219996-123220018 GCAGGAGGAGAATGGGATGGAGG - Intergenic
1075711091 10:124530829-124530851 GCTGCAGGAGACTCTGATGGTGG - Intronic
1075912005 10:126132886-126132908 CCTGGAGGAGACAGAGATGAGGG - Intronic
1076317612 10:129553657-129553679 ACTGCGGGAGACAGAGATGGTGG + Intronic
1076500221 10:130930874-130930896 GCCACAGGAGAAGGAGAAGGAGG - Intergenic
1076792012 10:132781839-132781861 GCTGCAGCAGGAAGAGAGGACGG - Exonic
1076852292 10:133099113-133099135 CCTCCAGGAGAAAGTGCTGGGGG + Intronic
1076852329 10:133099221-133099243 CCTCCAGGAGAAAGTGCTGGGGG + Intronic
1076891908 10:133288850-133288872 GATGGAGGAGAAGGAGCTGGTGG - Exonic
1077006476 11:360178-360200 GAGACAGGAGAGAGAGATGGGGG + Intergenic
1077103571 11:832623-832645 GGGTGAGGAGAAAGAGATGGGGG + Intergenic
1077115460 11:882608-882630 CAGGCAGGAGAAAGAGGTGGCGG + Intronic
1077120988 11:908431-908453 GCTGCAGCAGAAAGATAGTGGGG - Intronic
1077304892 11:1864610-1864632 GGTGGAGGTGGAAGAGATGGAGG + Intronic
1077357340 11:2124536-2124558 GCTGCAGCAGGAAGAGGTGGAGG - Intergenic
1077394658 11:2315127-2315149 GCACCAGGAGAAAGAGAGGAGGG - Intronic
1077543485 11:3158676-3158698 GGTGCAGGAGAGAGGGAGGGAGG + Intronic
1077572821 11:3354377-3354399 GCTACAGGAGAAAAGGAAGGAGG + Intronic
1077842933 11:5994551-5994573 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1078532762 11:12149691-12149713 GCTGCAGGAGAAGGAACAGGTGG + Intronic
1078593353 11:12665142-12665164 GGAGAAGGAGAAAGAGAAGGAGG + Intergenic
1079238866 11:18708300-18708322 GATGGAGGAGACAGAGGTGGAGG + Intronic
1079601433 11:22316384-22316406 GATGGGGGAGAAAGAGATGCGGG - Intergenic
1080827566 11:35860923-35860945 GCAGCTGGAGACAGAGATTGAGG - Intergenic
1080845303 11:36021569-36021591 GATTCAGGAGAGAGTGATGGTGG + Intronic
1080849420 11:36055347-36055369 GCTGAGAGAGAAAGAGAGGGAGG - Intronic
1081507759 11:43735863-43735885 GTGGCAGGAGAGAGAGATCGAGG + Intronic
1081802152 11:45867590-45867612 CCTACAGCAGAAAGAGAAGGTGG - Exonic
1081931650 11:46875681-46875703 GCTGCAGAGGAAGGAGAGGGTGG + Exonic
1082045698 11:47724557-47724579 GATCCAGGAGGTAGAGATGGAGG - Exonic
1082762517 11:57141580-57141602 AGTCCAGGAGAAAGAGGTGGCGG + Intergenic
1084163937 11:67366468-67366490 GTTGCAGAAGGAAGAAATGGAGG + Intronic
1084379014 11:68798759-68798781 GCTGCAGGAGAAACAGCTCACGG + Intronic
1085236961 11:75022775-75022797 GCTCCAGGAGACAGAGGGGGAGG - Intergenic
1085396742 11:76210306-76210328 GCTGCGGGGGAAAGGTATGGAGG + Intronic
1085816240 11:79740186-79740208 GGTGCAGGAGAAAGAAATAGAGG - Intergenic
1086662832 11:89442945-89442967 GCAGCAGGAGAAAGGGAAGCAGG + Intronic
1087156262 11:94907862-94907884 AGGGCAGGAGAAAGAGATGTGGG - Intergenic
1087165714 11:95000219-95000241 GGAGCAGGAGAAAGAGAGAGGGG + Intergenic
1087357548 11:97113857-97113879 GGTGGAGGGGAAAGAGAGGGAGG - Intergenic
1087594745 11:100238492-100238514 GCAGCAGGAGGAGGAGAAGGGGG + Intronic
1088087367 11:105997134-105997156 GGAGCAGGAGAAGGAGAAGGAGG + Intronic
1088325466 11:108596291-108596313 GATGCAGGAGAAAGGGAAAGAGG + Intergenic
1089093826 11:115901193-115901215 GGTGCAGAAGAAAGCAATGGGGG - Intergenic
1089578044 11:119460499-119460521 GGTGCAGGGGAAAGTGGTGGGGG - Intergenic
1090232019 11:125114160-125114182 ACAGCTGGAGACAGAGATGGAGG + Intergenic
1090736745 11:129617484-129617506 TCTCCAGGAGAAAGAGAGAGTGG - Intergenic
1090854642 11:130600932-130600954 GCTGCAGGAGAAGTAGATTGAGG + Intergenic
1091359142 11:134961086-134961108 GCAGGAGGAGAAGGAGAAGGAGG - Intergenic
1091585015 12:1811119-1811141 GCGGCAGCAGCAAGTGATGGGGG + Intronic
1091791304 12:3273701-3273723 GCGGCAGGAGCAGGAGAGGGAGG - Intronic
1091829405 12:3538956-3538978 GCTGCAGGGGAGTGAGCTGGGGG - Intronic
1092010047 12:5102065-5102087 GGTGGAGGAGAAAGGGAGGGAGG - Intergenic
1092061949 12:5558164-5558186 GATGCAGGAGGAAGATAAGGGGG - Intronic
1092197092 12:6555990-6556012 GCTGCAGGAGGAAGAGGTTGGGG + Exonic
1092278531 12:7081345-7081367 GCTGCAGAAGGAAGAGATGTGGG - Intronic
1092283628 12:7115863-7115885 GCAGCAGGAGAAAGAGAAGAAGG + Intergenic
1092289511 12:7150817-7150839 GGTGGAGGAGAAGGAGATGGGGG + Intronic
1092409351 12:8242335-8242357 GATGGAAGAGAAAGAGAAGGGGG - Intergenic
1092858208 12:12694864-12694886 GCTGCAGGAAAAATCCATGGAGG - Intronic
1093095553 12:14967880-14967902 GGAGAAGGAGAAAGAGAAGGAGG - Intergenic
1093538082 12:20247205-20247227 GCTGCTGGGGAAAGAGAAAGGGG - Intergenic
1093751714 12:22807665-22807687 GCAGCAGGAGAAAGAAGTGCAGG - Intergenic
1094085571 12:26587724-26587746 GATGGAGGAGAAAGGGATGAAGG - Intronic
1094497457 12:30997513-30997535 GCGGCAGGAGAGAGAGAGTGAGG + Intergenic
1095230378 12:39732192-39732214 TCAGAAGAAGAAAGAGATGGAGG - Intronic
1095323905 12:40863967-40863989 GCAGAAGGAGAAGGAGAAGGAGG - Intronic
1096489741 12:52007043-52007065 GCTGCAGCAGAAGGAGGAGGCGG + Exonic
1096541222 12:52308382-52308404 CCTGCAGGGGAAAGAGACGGAGG - Exonic
1096604988 12:52758239-52758261 GCTGCAGTAGAGAGACCTGGTGG - Intergenic
1096634715 12:52950840-52950862 GCAGCTGGAGACAGAGATCGAGG + Exonic
1096865687 12:54561405-54561427 GCTGCAGGAAGAAGAGAGTGGGG - Intronic
1097291961 12:57924693-57924715 GCAGCAGGAGAGAGAGAGCGAGG + Intergenic
1097377563 12:58858197-58858219 GATGGAGGAGAGAGAGACGGAGG - Intergenic
1097902835 12:64890316-64890338 GCTGCAGGAAAGAGAGAGAGAGG + Intergenic
1098251901 12:68579036-68579058 GAAGCAGGAGAAACAGAAGGAGG - Intergenic
1098830721 12:75359996-75360018 GCAGCAAGAGAAAGAAAAGGAGG + Intronic
1099397630 12:82160405-82160427 ACTTCAGGAGAAAGGGATGGGGG - Intergenic
1100567205 12:95808176-95808198 GCAGCAGGAGAGAGAGAGAGCGG + Intronic
1100935292 12:99657875-99657897 GAGGGAGGAGAAAGAGATAGAGG - Intronic
1101397386 12:104360300-104360322 GATGCAGGGGAAAGAGAAAGTGG - Intergenic
1101446949 12:104743367-104743389 ACTGCAAGAGAAAGACAAGGCGG - Intronic
1101468982 12:104977428-104977450 GCAGCTGGAGACAGAGATTGAGG - Intergenic
1101582758 12:106058271-106058293 GATGAAGGAGAGAGACATGGTGG - Intergenic
1102339929 12:112113524-112113546 GCAGAAGGAGAAGGAGAAGGAGG + Intergenic
1102524968 12:113505986-113506008 GCTGCAGCAGAGAGAGTGGGAGG - Intergenic
1102915607 12:116749960-116749982 GCTGGAGGGGAACGAGCTGGTGG - Exonic
1102987504 12:117290426-117290448 GCTGCAGGAGAGAATGAAGGTGG + Exonic
1104273772 12:127306162-127306184 GCTGCAGGTGCCAGCGATGGTGG - Intergenic
1105564489 13:21530782-21530804 GCAGCACCAGGAAGAGATGGCGG + Intronic
1105642519 13:22280242-22280264 GATACGGGAGAAAGAAATGGGGG + Intergenic
1105779725 13:23695783-23695805 TCTGCAGGAGAAGGTGCTGGCGG - Intergenic
1106051223 13:26191613-26191635 GCAGCGGGAGAAAGAGAGTGAGG - Intronic
1106301302 13:28468695-28468717 GCAGCAGGAACAAGAGAAGGGGG - Intronic
1107167429 13:37298986-37299008 GAAGCAAGAGAAAGAGATGGGGG + Intergenic
1107232151 13:38122999-38123021 GCTGCTGGAGAAAGAGAGCATGG + Intergenic
1107384630 13:39894576-39894598 GCTGCAGGTGAGAAAGGTGGGGG + Intergenic
1107601864 13:42022124-42022146 GCTGAAAGTGAGAGAGATGGTGG + Intergenic
1108259938 13:48646331-48646353 GCTGCAGGAGAGAGAAGTGAGGG - Intergenic
1108322684 13:49303234-49303256 GCAGCAGGTGACAGAGCTGGTGG - Intergenic
1108526293 13:51288520-51288542 GATGGAGGAGGAGGAGATGGAGG - Intergenic
1108526329 13:51288646-51288668 GCAGGAGGAGGAGGAGATGGAGG - Intergenic
1108735346 13:53278131-53278153 GGAGGAAGAGAAAGAGATGGGGG + Intergenic
1108908612 13:55512968-55512990 GCAGCAGGAGAAAGAGAAAAGGG + Intergenic
1109507734 13:63328618-63328640 GGAGCAGGAGAAAGAGAGAGAGG - Intergenic
1110590107 13:77246556-77246578 GCAGGAGGAGAAGGAGAAGGAGG + Intronic
1110772497 13:79366054-79366076 CCTGCAGTAAAAAGAGAGGGTGG + Exonic
1110999333 13:82158397-82158419 GAGGCAGGAGGAAGAGATGAGGG - Intergenic
1111104560 13:83628853-83628875 GCTGCAGGAGAAGGAGAGTGAGG - Intergenic
1111607724 13:90562585-90562607 GCTGGAGGAGAAAGAGGGTGTGG - Intergenic
1111697836 13:91647707-91647729 GCTGCAGGAGAGAGGAAGGGAGG - Intronic
1111790663 13:92851086-92851108 GCAGCAAGAGAAAGAGAAGGGGG + Intronic
1111876876 13:93908734-93908756 GCTGGAGTAGAAAGAAATGGAGG - Intronic
1112037339 13:95508813-95508835 GCTGAAGCACAAAGAGCTGGTGG + Intronic
1112138125 13:96606568-96606590 GCTGGAGGAGGGAGAGAGGGAGG + Intronic
1112675804 13:101700231-101700253 ACTTCAGGAGAAAGAGGTTGAGG - Intronic
1112678613 13:101735080-101735102 GCTGGAGGAGAGAGAGAGTGGGG + Intronic
1113325320 13:109275995-109276017 GCTGCAGGTGTAAGGGATGCAGG - Intergenic
1113711944 13:112471192-112471214 GGCGCAGGACCAAGAGATGGGGG + Intergenic
1113935169 13:113990072-113990094 GGAGCAAGAGAGAGAGATGGGGG - Intronic
1114244465 14:20899846-20899868 GCAGCAGGAGAGAGTGAAGGGGG + Intergenic
1115270783 14:31549949-31549971 GCAGGAGGAGGAAGAGAAGGAGG - Intronic
1115443843 14:33466717-33466739 GGAGCAGGAGGAAGAGAGGGAGG + Intronic
1115662681 14:35512475-35512497 GCAGCTGGAGACAGAGATGGAGG - Intergenic
1116198642 14:41761265-41761287 GAGGCAGGAGAAAGAGAGGAAGG + Intronic
1116393054 14:44416491-44416513 GCTGAGGGAGAAGGAGGTGGTGG - Intergenic
1116422732 14:44751913-44751935 GGAGCAGGAGCAAGAGAGGGCGG - Intergenic
1116769000 14:49105481-49105503 GCAGGAGGAGAAATAGAAGGAGG - Intergenic
1117163156 14:53008607-53008629 GTGGCAGGAGAGAGAGAAGGGGG - Intergenic
1117959899 14:61152424-61152446 GGTGGAGGAGAAAGAGGAGGAGG + Intergenic
1118262531 14:64260726-64260748 GCTCCCGGAGAGAGAGATGTGGG - Exonic
1119458920 14:74781778-74781800 CCTGCAGAAGAGAGAGAAGGAGG - Exonic
1119458943 14:74781862-74781884 GCTGTTGAAGAGAGAGATGGTGG - Exonic
1119681688 14:76597053-76597075 GGTGCAGGAGGAAGAGAGAGGGG + Intergenic
1119691339 14:76675068-76675090 GCTGAAGGAGAAACAGCTAGGGG + Intergenic
1119776645 14:77253283-77253305 GCTGCAGCAGGGAGAGGTGGTGG - Exonic
1120101980 14:80455254-80455276 GCTGCTGGAGAAAGAGTTCATGG - Intergenic
1120203074 14:81559616-81559638 GCTGGAGGAGGAAGAGAGTGAGG + Intergenic
1120371209 14:83638965-83638987 GCAGCAGGAGAGAGAGAGAGAGG - Intergenic
1120596387 14:86442451-86442473 CCAGCAAGAGAAAAAGATGGAGG + Intergenic
1120696229 14:87648739-87648761 GTAGCAGGAGAGAGAGAAGGGGG - Intergenic
1120696499 14:87650718-87650740 GTGGCAGGAGAGAGAGAGGGGGG - Intergenic
1120707906 14:87763322-87763344 AGAGCAGGAGAAAGAGGTGGGGG + Intergenic
1121416330 14:93781658-93781680 GCTGCAGGAGGAAGAAGTGAAGG + Intronic
1121477992 14:94230694-94230716 GATGCAGGAGAATGACTTGGAGG - Exonic
1121825385 14:97006278-97006300 GCTGCAGGAGGGGGAGATCGAGG - Intergenic
1121847234 14:97183573-97183595 ACAGCAGGATAAAGAGATGGTGG - Intergenic
1121870104 14:97399596-97399618 GCAGCAGGAGAGAGAGAGAGAGG + Intergenic
1122149421 14:99716966-99716988 TCTGCAGGTGAAAGGCATGGAGG + Intronic
1122306261 14:100768617-100768639 GCTTCAGTAGAAAGAAAGGGAGG + Intergenic
1122369839 14:101223420-101223442 GCTGCATCAGAAAGAGCCGGGGG + Intergenic
1123179472 14:106455167-106455189 GCAGCAGGAGGAAGAGATAAGGG + Intergenic
1123193892 14:106598085-106598107 GCAGCAGGAGAGAGAGAGAGGGG - Intergenic
1123737186 15:23196652-23196674 GCTGGAGTAGAATGAGAAGGGGG + Intergenic
1123832243 15:24152289-24152311 GATGGAGGATAAAGAAATGGGGG - Intergenic
1124133338 15:27009892-27009914 GCAGAAGGAGGAAGAGGTGGTGG - Intronic
1124288402 15:28425314-28425336 GCTGGAGTAGAATGAGAAGGGGG + Intergenic
1124294822 15:28492000-28492022 GCTGGAGTAGAATGAGAAGGGGG - Intergenic
1124461960 15:29900240-29900262 GCTACAGGGGAAAGAGAAGGAGG + Intronic
1124496972 15:30192730-30192752 GCTTCAGGAGATAGGGATGAAGG + Intergenic
1124587974 15:31026943-31026965 GCTGCAGGAAAAAGAGAGAAGGG - Exonic
1124746604 15:32345917-32345939 GCTTCAGGAGATAGGGATGAAGG - Intergenic
1124769472 15:32519078-32519100 GCAGCAGGAGAACGAGAGAGGGG + Intergenic
1125280415 15:38036716-38036738 CCTGCAGGAGTAAGAAAAGGTGG - Intergenic
1125306207 15:38318581-38318603 ACTACAGGGGAAAGAGAAGGAGG - Intronic
1125512627 15:40300997-40301019 GCAGCAGGAGAGAGGGAGGGTGG + Intronic
1125519983 15:40343190-40343212 GCTGTATGAGGAAGATATGGGGG - Intergenic
1125579700 15:40776487-40776509 CCTGCAGGAGGAGGAGGTGGGGG - Intronic
1126341856 15:47649732-47649754 GTTGCAGGACCAACAGATGGCGG + Intronic
1126671773 15:51122004-51122026 TCAGAAGAAGAAAGAGATGGAGG - Intergenic
1126786255 15:52179843-52179865 GCTGCACGAGAACGAGACGCTGG - Exonic
1127125629 15:55809035-55809057 GCTGGAGGAGAAAAAAGTGGGGG + Intergenic
1127196483 15:56591464-56591486 GCAGCAGGAGGAAGAGAGTGAGG + Intergenic
1127577461 15:60305742-60305764 AGAGCAGGAGAAAGAGAAGGGGG + Intergenic
1127988130 15:64090963-64090985 GAGGCTGGAGAAAGAGATGAAGG + Intronic
1128092914 15:64931190-64931212 GCTGGAGGAGAAGGAAATAGAGG + Intronic
1128171479 15:65517451-65517473 GGCGCAGGAGAAGGAGAAGGGGG + Intronic
1128214181 15:65922905-65922927 GCTGCAGGAGACAGAGCAGTTGG + Exonic
1128523011 15:68387869-68387891 GAGGAAGGAGAAAGAGAAGGCGG - Intronic
1128729590 15:70011910-70011932 GATGCAGGAGAAAAACCTGGGGG - Intergenic
1128797748 15:70477794-70477816 GGAGGAGGAGGAAGAGATGGAGG + Intergenic
1128797752 15:70477809-70477831 GATGGAGGAGGAGGAGATGGAGG + Intergenic
1128797756 15:70477824-70477846 GATGGAGGAGGAGGAGATGGAGG + Intergenic
1129159876 15:73741252-73741274 GCTCCGGGAGATGGAGATGGGGG - Intronic
1129672485 15:77614949-77614971 GCTGCAGGAGATCCAGCTGGTGG - Exonic
1129790040 15:78334952-78334974 GGTGCAGGAGAAATAGAAGATGG - Intergenic
1130693889 15:86110868-86110890 GCTGGAGGAGAAAGGGAGGGAGG - Intergenic
1130862212 15:87901066-87901088 GGTTCAGATGAAAGAGATGGAGG + Intronic
1131447481 15:92512313-92512335 GGTGAAGGAGAAAGGGTTGGGGG - Intergenic
1131526372 15:93155928-93155950 GGAGCAAGAGAGAGAGATGGGGG - Intergenic
1131577545 15:93606710-93606732 GCTTCAGGACAATGAGTTGGTGG + Intergenic
1131690402 15:94820945-94820967 GGAGAAGGAGAAAGAGAAGGAGG + Intergenic
1131792948 15:95984498-95984520 CCTGCAGGAGAAGTAGAAGGTGG + Intergenic
1131967507 15:97859804-97859826 GCTGCAGGAGCAAGAGGGGCAGG - Intergenic
1132179184 15:99738918-99738940 GCAGCAGGAGAGAGAGAGTGAGG - Intergenic
1132299314 15:100766557-100766579 CCAGCATGAGACAGAGATGGTGG + Intergenic
1132613812 16:830650-830672 GCTGCAGGAGCCTGAGATCGGGG + Intergenic
1132670289 16:1099728-1099750 GCTGCAGGAGAAAGGGCAGGAGG + Intergenic
1132731998 16:1367250-1367272 GCTGCAGAAGAAGGAGGAGGTGG - Intronic
1132896238 16:2230616-2230638 GCTGCAGCAGGAAGAGGGGGTGG + Intronic
1133025959 16:2989065-2989087 GCTTCAGGAGAGAAAGATGGGGG + Intergenic
1133101508 16:3482818-3482840 GCTGCAGCAGAAAGGCCTGGGGG - Intronic
1133191968 16:4140486-4140508 GAAGCAGGAGAAAGAGAGAGGGG - Intergenic
1133234432 16:4381339-4381361 GCTGCAGGACAACGAGCTGCGGG + Exonic
1133271200 16:4611604-4611626 TCGGCAGAAGACAGAGATGGGGG + Intronic
1133389898 16:5401803-5401825 GCAGCACGAGAAGGAGAAGGAGG - Intergenic
1133874743 16:9723194-9723216 GCAGCAGGAGGAAGAGGAGGAGG + Intergenic
1133874787 16:9723419-9723441 GGAGGAGGAGAAAGAGAAGGAGG + Intergenic
1134075799 16:11290487-11290509 GCTGGAGCAGAGAGAGGTGGGGG + Intronic
1134636609 16:15796780-15796802 GCTGCAGGATTTAAAGATGGAGG + Intronic
1134780322 16:16889448-16889470 GATGGAAGAGAAAGAGGTGGCGG - Intergenic
1134794853 16:17025692-17025714 GCTGCAGGAGAGAGAGAGCAGGG - Intergenic
1135051890 16:19200072-19200094 TCTCTAGGAGAAAGAGAGGGTGG + Intronic
1135148497 16:19984634-19984656 TCTGAAGGATGAAGAGATGGAGG + Intergenic
1135161737 16:20102553-20102575 GGTGGAAGAGAAAGAGAAGGAGG - Intergenic
1136386953 16:29933880-29933902 GCTGCAGGAGAAAAATTTGAAGG + Intergenic
1136540768 16:30926603-30926625 GTGGCAGGAGGAAGAGAGGGAGG - Intronic
1136661491 16:31766930-31766952 GCTGAGGGAGAAGGAGGTGGTGG + Intronic
1137612764 16:49829937-49829959 GCTTCAGGAGAAAGGGTTAGTGG - Intronic
1137681443 16:50349454-50349476 GCAGCAGGAGAGAGTGAAGGGGG - Intronic
1137836464 16:51597180-51597202 GCAGCAGGAGCAAGAGAAAGGGG - Intergenic
1137943351 16:52710240-52710262 GAGGGAGGAGAAGGAGATGGAGG + Intergenic
1138198774 16:55073752-55073774 GGAGGAGGAGAAAGAGAAGGAGG + Intergenic
1138240686 16:55424844-55424866 GGAGAAGGAGAAAGAGAAGGAGG - Intronic
1138479338 16:57291593-57291615 GAGGCAGGAGAAGGAGGTGGAGG - Intergenic
1138520836 16:57570050-57570072 GCTGCTGGAGATAGAGAAGGTGG - Intronic
1139440985 16:66966703-66966725 TCTGCAGGAGAAAGCAATGCAGG - Exonic
1140378601 16:74465726-74465748 GCTGCAGGAGACAGAGATGATGG - Exonic
1140593051 16:76376048-76376070 GGAGCAGGAGAAAGAGGAGGAGG + Intronic
1140767948 16:78177474-78177496 GTTGCAGGAGAAAGTATTGGTGG + Intronic
1141124911 16:81394410-81394432 GCAGCAGGAGAGAGAGAACGGGG + Intergenic
1141235433 16:82211519-82211541 AGAGCAGGAGAAAGAGGTGGGGG + Intergenic
1142142486 16:88478800-88478822 GCGGCAGGGGAAGGAGTTGGGGG + Intronic
1142976400 17:3647251-3647273 GCTGCCAGAGACAGAGATGGAGG - Intronic
1142986879 17:3700816-3700838 GCAGCAGGAGAGAGAGGAGGAGG - Intergenic
1143161459 17:4874492-4874514 GCAGCAGAAGGAAGACATGGGGG + Intronic
1143532060 17:7511208-7511230 ACTGCAGGAGGAAGAGGTGGTGG + Exonic
1143571204 17:7759858-7759880 GTGGCAGAAGACAGAGATGGTGG - Exonic
1144210903 17:13014673-13014695 ATAGCAGGAAAAAGAGATGGAGG + Intronic
1144227444 17:13163392-13163414 GGAGCAGGAGCAAGAGATGGGGG + Intergenic
1144506299 17:15834165-15834187 GCTGGAGGAGAAGGAGAAGGAGG + Intergenic
1144622163 17:16824501-16824523 CCTGCAGAAGAAGGAGACGGTGG - Intergenic
1144884261 17:18448212-18448234 CCTGCAGAAGAAGGAGACGGTGG + Intergenic
1145013568 17:19383056-19383078 GCTGCAGGGGAAGGAAAGGGAGG - Exonic
1145147970 17:20496165-20496187 CCTGCAGAAGAAGGAGACGGTGG - Intergenic
1145170475 17:20652098-20652120 GCTGGAGGAGGAGGAGAAGGAGG + Intergenic
1145984368 17:29035230-29035252 GAAGAAGGAGAAAGAGAAGGAGG - Intronic
1146165518 17:30585216-30585238 GATGAAGGAGAAAGTGTTGGAGG + Intergenic
1146479259 17:33191550-33191572 GGAGGAGGAGAAAGAGAGGGAGG + Intronic
1146566113 17:33914489-33914511 GAATCAGGAGACAGAGATGGTGG + Intronic
1146655088 17:34630306-34630328 GCTGTAGGAGGAAAAGGTGGGGG - Intronic
1146656299 17:34637155-34637177 CCTGGAGGAGAAGGAGAAGGAGG - Exonic
1146795983 17:35781306-35781328 CCTGCAGGAGGTACAGATGGGGG + Intronic
1147192931 17:38747902-38747924 GCTGCTGCACAAAGAGGTGGTGG + Exonic
1148174612 17:45552843-45552865 GCTCCAGGAGTAAGGGATGCTGG - Intergenic
1148274654 17:46292610-46292632 GCTCCAGGAGTAAGGGATGCTGG + Intronic
1148296758 17:46510184-46510206 GCTCCAGGAGTAAGGGATGCTGG + Intergenic
1148361309 17:47014671-47014693 GCTCCAGGAGTAAGGGATGCTGG + Intronic
1149449475 17:56738515-56738537 GGTGCAGGAGAAAGACATGGAGG + Intergenic
1149571247 17:57673985-57674007 CCTGCAGGAGAAGGAAAGGGGGG - Intronic
1149695950 17:58616195-58616217 GCCGCTGAAGAAAGAGAAGGTGG + Exonic
1150166702 17:62950923-62950945 GCTGGAGGTGGAAGTGATGGGGG - Intergenic
1150198670 17:63329756-63329778 GCCCAAGGAGACAGAGATGGGGG - Intronic
1150350445 17:64440206-64440228 GCGGCAGGAGAGAGAGAGGCAGG + Intergenic
1150405830 17:64899754-64899776 GCTCCAGGAGTAAGGGATGCTGG - Intronic
1150462636 17:65365285-65365307 TCAGCAAGAGAAAGAGATGGAGG - Intergenic
1150612077 17:66741484-66741506 GCTGGAGGACGAAGTGATGGAGG + Intronic
1150673147 17:67220032-67220054 GGAGCAGGAGAGAGAGAAGGTGG - Intronic
1151221195 17:72614302-72614324 GCTTCAGGAGAAAAAGATGAAGG - Intergenic
1151868073 17:76818061-76818083 GGAGCAGGAGGAAGAGAGGGGGG + Intergenic
1151987925 17:77556079-77556101 GCTCCAGGGGAAAGGGGTGGAGG - Intergenic
1152069142 17:78126530-78126552 GCTGCAGCAGAGAGAGCGGGAGG - Exonic
1152616321 17:81339559-81339581 CATGCAGGAGAAGGAGATGCAGG + Intergenic
1152817666 17:82418159-82418181 GGGGCAGGAGAAAGAGAAGGGGG - Intronic
1153907859 18:9678924-9678946 GCAGCTGGAGACAGAGATTGAGG - Intergenic
1153912014 18:9712668-9712690 GGAGGAGGAGAAAGAGAAGGAGG + Intronic
1153934195 18:9906114-9906136 ACTACAGGAGAAGGAGTTGGAGG + Intergenic
1154495837 18:14960133-14960155 GCAGGAGGAGAAGGAGAAGGAGG + Intergenic
1155123141 18:22843106-22843128 GCTAAAGGAGGCAGAGATGGTGG + Intronic
1155161632 18:23200929-23200951 GCTGCAGGAGATAACGCTGGCGG - Intronic
1156960383 18:43021657-43021679 GGAGCAGGAGGAAGAGATGAAGG - Intronic
1157268098 18:46246587-46246609 GAGGCATGAGAAAGTGATGGGGG - Intronic
1157867094 18:51196927-51196949 GCTGGAGGAGGAGGAGCTGGAGG - Exonic
1158174411 18:54638314-54638336 GATGATGGGGAAAGAGATGGGGG - Intergenic
1158203729 18:54967862-54967884 GCGACAGGAGAGAGAGAGGGAGG + Intergenic
1158449915 18:57555051-57555073 GGTGCAGGAGACAGAAAGGGAGG - Intronic
1158579702 18:58671209-58671231 GCTGGAGGAGGAAGCGGTGGAGG - Intergenic
1158869630 18:61672665-61672687 GATGAAGGAGACAGAGATGAAGG - Intergenic
1159089211 18:63828260-63828282 GAAGCAAGAGAGAGAGATGGGGG - Intergenic
1159703728 18:71661466-71661488 GCTGGTGGAGAGAGAAATGGAGG - Intergenic
1159931839 18:74320286-74320308 GCAGCAAGAGAGAGAGGTGGGGG + Intronic
1160037451 18:75315032-75315054 GCTGTAGGGGAGAGTGATGGAGG - Intergenic
1160429582 18:78802220-78802242 TTTACAGGAGAAAGGGATGGGGG + Intergenic
1160699543 19:499144-499166 GCTGCAGCAGAATGAGGAGGGGG - Intronic
1160787345 19:907181-907203 GCAGCTGGAGAAGGAGGTGGTGG + Intronic
1161157894 19:2743100-2743122 GTTGCAGGAGAAGGAGGTGTTGG + Intergenic
1161233862 19:3188534-3188556 ACTGCAGGGGAAAGGGAGGGAGG - Intronic
1161258900 19:3324737-3324759 GCTGCAGCAGAGAGAGTTAGTGG - Intergenic
1161302979 19:3551837-3551859 GCTGGAGCAGAGAGAGAAGGGGG - Intronic
1161324354 19:3656196-3656218 GCCACAGGAGGAAGAGAGGGCGG + Intronic
1161561425 19:4974914-4974936 GGTGCAGGAGGAAGAAAGGGAGG - Intronic
1162144484 19:8605427-8605449 GCTGCTGGAGCAAGTGATGCTGG + Intronic
1163008223 19:14409452-14409474 GGTGCAGGAGAAACAAGTGGAGG + Intronic
1163197695 19:15735217-15735239 GCAGAAGGAGAAGGAGAAGGAGG - Intergenic
1164292303 19:23879546-23879568 GAGGAAGGAGAAAGAGAAGGAGG + Intergenic
1164306399 19:24007529-24007551 GCTGGAGGAGAATGAAATGTAGG + Intergenic
1164409526 19:27989192-27989214 GCAGCTGGTGAAAGAGAAGGTGG - Intergenic
1164441925 19:28285221-28285243 GGTGCAGGGGAAGGAGCTGGAGG + Intergenic
1164441954 19:28285309-28285331 GGTGGAGGGGAAAGAGGTGGAGG + Intergenic
1164568984 19:29355149-29355171 GCTGTAGGAGAGAGAGGGGGTGG - Intergenic
1164581729 19:29439064-29439086 GAGGCAGGAGAGAGAGAGGGAGG + Intergenic
1164858641 19:31544976-31544998 GATGAAGGAGAAAGAGAAGGAGG - Intergenic
1164858649 19:31545028-31545050 GATGAAGGAGAAAGAGAAGAAGG - Intergenic
1165109981 19:33496723-33496745 GCTGCCGGAGAAATCGATGCTGG - Intronic
1165197763 19:34118246-34118268 GCAGAAGGAGAAAGAGAAGGAGG + Intergenic
1165257539 19:34588805-34588827 GATGGAGGAGAAGGAAATGGGGG + Intergenic
1165406213 19:35632914-35632936 GCTGTGGGAGAGAGAGATGGGGG - Exonic
1165433980 19:35786969-35786991 GCAGCAGGGGTATGAGATGGGGG - Exonic
1165845086 19:38812925-38812947 GCTGCAGGAGTGGGAGATGGTGG + Exonic
1166301974 19:41916028-41916050 GCTGCGGGCGGTAGAGATGGGGG - Intronic
1166460963 19:42987801-42987823 GAAGCAGGAGAAAGAGAAAGAGG - Intronic
1166645562 19:44529331-44529353 ACTCGAGGAAAAAGAGATGGAGG - Intronic
1166651097 19:44575807-44575829 GCTGCAGGAGTTAGGGATGAAGG + Intergenic
1166998842 19:46733052-46733074 GCTGCTGGTGAAACAGATCGAGG - Exonic
1167085990 19:47310043-47310065 GATGCAGGAGAGAGGGAAGGTGG - Intronic
1167415578 19:49369695-49369717 GCTGGAGGAGAAAGTGAAGGAGG + Intronic
1167589945 19:50398998-50399020 GCTGCAGGAGCAGGAGGAGGAGG + Exonic
1167842684 19:52134905-52134927 GTTGCAGCAGACAGAGGTGGGGG + Intronic
1168057949 19:53873945-53873967 GATGCAGGAGAAGAAGGTGGCGG - Exonic
1168481622 19:56724808-56724830 GCTGGAGGAGCAGGTGATGGGGG + Intergenic
1168507327 19:56947293-56947315 GGGGCAGGAGGAAGAGATGGGGG + Intergenic
925089462 2:1142019-1142041 TCTGCAGTACAAAGAGTTGGTGG + Intronic
925096369 2:1207575-1207597 GGTGGAGGAGAATGAGAAGGGGG + Intronic
925693510 2:6549583-6549605 GAAGCAGGAGGAAGAGAGGGAGG - Intergenic
925781467 2:7385959-7385981 GGTGAGGGAGACAGAGATGGAGG + Intergenic
925806238 2:7651860-7651882 GCAGAAGGTGAAAGAGATGCAGG + Intergenic
925857132 2:8140166-8140188 GAAGAAAGAGAAAGAGATGGAGG + Intergenic
926121730 2:10244964-10244986 GCTGCTGTTGGAAGAGATGGGGG + Intergenic
926638094 2:15205778-15205800 GCAGCAGGAGAGAGAGGGGGTGG - Intronic
926843497 2:17107893-17107915 GGGGCTGGAGAAAGAGATGTGGG + Intergenic
927035893 2:19175971-19175993 GCTGCATGAGAAAGAATTGTGGG - Intergenic
929541753 2:42828327-42828349 GCTGCAGGCGAAGTAGGTGGGGG - Intergenic
930505401 2:52277165-52277187 GCTTCAGGAGAGAGAGAGGTAGG + Intergenic
931528014 2:63179480-63179502 GGAGAAGGAGAAAGAGAAGGGGG - Intronic
932159731 2:69448728-69448750 ACTGAAGGAGAAAGAGGTTGAGG + Intergenic
932319709 2:70812726-70812748 GCTCCAGGAGAAAGGCCTGGGGG + Intronic
932818095 2:74877640-74877662 GCTTCAGGAGAAGGAAAAGGAGG - Intronic
933432280 2:82198190-82198212 GCTGAATGAGAAAGAGACAGAGG + Intergenic
935287955 2:101581892-101581914 GCAGCAACAGAAAGAGTTGGGGG + Intergenic
935401898 2:102668787-102668809 GGTGGAGGAGGGAGAGATGGAGG - Intronic
935481951 2:103601263-103601285 GTTTCAGGAGAAATGGATGGAGG + Intergenic
935792381 2:106604971-106604993 GCAGCAGGAGAGAGAAAAGGGGG + Intergenic
936022004 2:109002141-109002163 GCAGGAGCAGAAAGAGTTGGGGG - Intergenic
936775703 2:115970176-115970198 GGAGCAGGAGCAAGAGAGGGAGG + Intergenic
936922868 2:117707171-117707193 TCTGCAGCACAAAGAGAGGGAGG + Intergenic
937390655 2:121483031-121483053 CCAGCAGGAGCAAGAGAGGGAGG + Intronic
937463464 2:122109508-122109530 GTAGAAGGAGAGAGAGATGGGGG + Intergenic
937617905 2:123947999-123948021 GCAGCAGGAGAGAGAGAGTGAGG + Intergenic
937764026 2:125638990-125639012 GGTAAAGGAGAAAGAGATGAGGG - Intergenic
938026570 2:127954280-127954302 ACAGCATGAGAAAGAAATGGAGG + Intronic
938372566 2:130781315-130781337 GCAGCAGGAGAGAGAGAAAGAGG + Intergenic
938685826 2:133736810-133736832 GCAGGAGGAGAAAGAGGAGGAGG + Intergenic
939113799 2:138038342-138038364 TCTGCAGGGGAAAGATTTGGGGG - Intergenic
939146449 2:138420910-138420932 GCAGCAAGATAAAGAAATGGAGG - Intergenic
939743394 2:145938136-145938158 GCTGCAGTGGAAAGTGATGGAGG - Intergenic
940058205 2:149535728-149535750 GCTGCAGGACACTGAGAAGGAGG + Intergenic
940119116 2:150243109-150243131 GCTGCAGGTGAGAGAGAAGTAGG - Intergenic
940149156 2:150579769-150579791 GAAGCAGAAGAAAGAGGTGGGGG + Intergenic
941256934 2:163243731-163243753 ACAGCAGGAGGAAGAGAGGGAGG + Intergenic
941370576 2:164658797-164658819 TCAGCAGGAGAAATAGATTGGGG - Intronic
941888248 2:170551916-170551938 GCAGCAGGAGAGAGAGAAGGGGG - Intronic
942971366 2:181961868-181961890 GCCACTGGAGACAGAGATGGAGG - Intronic
943548660 2:189311928-189311950 GCAGCTGGAGACAGAGATCGAGG - Intergenic
944359191 2:198832030-198832052 GCTTCAGGAGAAAAAGCAGGTGG + Intergenic
944403238 2:199352683-199352705 GCTGCAGAAGAACTAGGTGGAGG + Intronic
944509870 2:200453946-200453968 CATGCAGTAGAAAGAGAAGGTGG - Intronic
944595901 2:201260381-201260403 GCTGCAGGAAAAAGGCCTGGTGG - Intronic
944716000 2:202376497-202376519 GCTGCGGGAGAACGAGGCGGCGG + Intergenic
945122281 2:206469259-206469281 ATTGCAGGAGAAGGAGGTGGTGG - Intronic
945921348 2:215757898-215757920 GGAGCAAGAGAAAGAGATGGGGG - Intergenic
946027197 2:216679079-216679101 TCTGCAGGAGAAGGAGCCGGAGG + Exonic
946189383 2:218000024-218000046 GCTGGAGGAGTTAGAGGTGGAGG - Intronic
946450522 2:219775154-219775176 GATGCAGGAGAAAGATGAGGGGG - Intergenic
946886288 2:224226275-224226297 GGTGAAGGAGAAGGGGATGGGGG - Intergenic
947461225 2:230306369-230306391 GCTGCAGGAGACACAGAGAGGGG + Intronic
947820919 2:233068881-233068903 CCAGCAGGAGGAAGGGATGGGGG + Intronic
948507098 2:238435689-238435711 GCTGCAGGAGGAACACAAGGGGG - Exonic
948591403 2:239053145-239053167 CCCGCAAGAGAAGGAGATGGGGG + Intronic
948662328 2:239515175-239515197 GCAGCAGGAGAGAGAAATGAAGG - Intergenic
948672205 2:239575746-239575768 GCGGCAGGACACAGAGATGAAGG - Intergenic
948724965 2:239928955-239928977 GGTGCAGGAGGAAGAGTCGGGGG - Intronic
948892895 2:240915839-240915861 GGGGCAGGAGGAAGAGATAGGGG + Intergenic
949055565 2:241926476-241926498 GGTGCAGGAGAAGGTGAGGGTGG + Intergenic
1168902861 20:1379830-1379852 GCTACAGGACAAGGAGAAGGAGG + Intronic
1169667821 20:8058027-8058049 GCTGCAGATGAAAGAGTTTGGGG + Intergenic
1169873688 20:10273573-10273595 GCAGAAGGAGAAACAGAGGGAGG + Intronic
1170093582 20:12620071-12620093 GTGGCAGGAGGAAGAGATGAAGG + Intergenic
1170779619 20:19412586-19412608 GCAGGAAGAGAAAGAGAAGGAGG + Intronic
1171163242 20:22947642-22947664 GCTCCAGGAGGAAGAGAGAGGGG - Intergenic
1171379739 20:24725274-24725296 GCTACAGGAGGAAATGATGGCGG + Intergenic
1171383608 20:24752330-24752352 GCTGCAAGGGAAAGAGAAGGGGG + Intergenic
1172240751 20:33411136-33411158 GCTATAGGAGAAAGAGTGGGTGG - Intronic
1172431594 20:34897361-34897383 GCTGGAGGAGAAGAAGTTGGGGG - Intronic
1172529077 20:35618068-35618090 AATGCTGGAGAAAGAGAGGGAGG - Exonic
1172968762 20:38858311-38858333 GGTGCTGGAGAAACTGATGGGGG + Intronic
1173282777 20:41644042-41644064 GCTGCTGGAGCAAGGGATGGAGG + Intergenic
1173308370 20:41873189-41873211 GCTGCTGGAGAGAGGGAGGGAGG + Intergenic
1173573731 20:44096427-44096449 ACAGCAGGAGAAAGAGAGGGAGG + Intergenic
1173802755 20:45905034-45905056 GCTGCAGGAGGAAGAGCGGATGG - Exonic
1173811514 20:45958765-45958787 GAAGCAGGAGGAAGGGATGGGGG - Intronic
1173823605 20:46033534-46033556 TAGGCAGGAGAAAGAGATGGGGG - Intronic
1173824968 20:46042388-46042410 AGTCCAGGAGAGAGAGATGGTGG + Intronic
1173916970 20:46714914-46714936 GGTGCAGGAGGCAGAGGTGGAGG - Intronic
1173920910 20:46744055-46744077 GCTACAGGAGGGAGGGATGGGGG + Intergenic
1173951458 20:46996850-46996872 GGAGCAGGAGGAAGAGAGGGGGG + Intronic
1174159469 20:48540762-48540784 TGAGCAGGAGAAAGAGAAGGGGG - Intergenic
1174349587 20:49957333-49957355 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1174444092 20:50578912-50578934 GGAGCAGGAGCAAGAGATGGGGG + Intronic
1175128997 20:56775116-56775138 GGAGCAGGAGAAAGAGAAGGGGG - Intergenic
1175599906 20:60264945-60264967 GCTGCAGAAGACAGAGGCGGAGG + Intergenic
1175607201 20:60320884-60320906 GTTGGAGCAGAAAGAGATGGTGG + Intergenic
1176027214 20:62992081-62992103 GGTGCAGGAGGAAGAGAGAGTGG - Intergenic
1176162169 20:63653480-63653502 GCGGCGGGAGAGAGAGAGGGAGG + Intergenic
1176340677 21:5692492-5692514 TCTGCTGGAGACAGAGATGGAGG + Intergenic
1176472931 21:7124645-7124667 TCTGCTGGAGACAGAGATGGAGG + Intergenic
1176504150 21:7631964-7631986 TCTGCTGGAGACAGAGATGGAGG - Intergenic
1176515480 21:7780565-7780587 TCTCCAGGAGAAATAGTTGGAGG + Intergenic
1176545261 21:8194102-8194124 AAGGAAGGAGAAAGAGATGGAGG - Intergenic
1176564212 21:8377147-8377169 AAGGAAGGAGAAAGAGATGGAGG - Intergenic
1176877329 21:14145602-14145624 GGTGTAGGAGGAAGAGATGAAGG + Intronic
1176975118 21:15312249-15312271 GCAGCAGGAGAGAGAGAGCGTGG - Intergenic
1176975177 21:15312670-15312692 ACTGCAGGAGTAAGACATGTGGG + Intergenic
1177803097 21:25847637-25847659 GCAGCAGGAGAGAGAGAGAGAGG - Intergenic
1178127359 21:29529543-29529565 GCTGCAGGAGCATCTGATGGGGG + Intronic
1178396211 21:32246031-32246053 AGAGCAGGAGCAAGAGATGGAGG + Intergenic
1178453703 21:32727960-32727982 GCTGCGGGAGAAGGAGGAGGAGG - Exonic
1178649508 21:34410577-34410599 TCTCCAGGAGAAATAGTTGGAGG + Intergenic
1179132225 21:38648355-38648377 CTTGCTGGAGAAAGAAATGGAGG + Intronic
1179287504 21:39990800-39990822 GCTGCAGCAGAAAGTCATTGAGG - Intergenic
1179572811 21:42287867-42287889 ACTGCAGGAGACACAGACGGGGG - Exonic
1179831119 21:43996828-43996850 GCTGCTGCAGAAAGTGAGGGTGG - Intergenic
1179942011 21:44646469-44646491 GCTGGAGCAGACAGACATGGTGG - Exonic
1179974460 21:44856261-44856283 GCTGCAGGAGGAAGAGGAGCCGG - Exonic
1180782711 22:18529794-18529816 GGTGCAGGTGAAGGTGATGGAGG + Intronic
1181126271 22:20703821-20703843 GGTGCAGGTGAAGGTGATGGAGG + Intergenic
1181237621 22:21457171-21457193 GCTGCTGGAGGAAGACAAGGTGG + Intergenic
1181239601 22:21469132-21469154 GGTGCAGGTGAAGGTGATGGAGG + Intergenic
1181564684 22:23728219-23728241 CCTGCAGCAGAAACAGATGCTGG - Intergenic
1181832360 22:25571080-25571102 ACTGCAGGAGAAGGAAATGGTGG - Intronic
1181850061 22:25743523-25743545 GCAGGAGGAGAAAGAGAAGAAGG + Intronic
1181997583 22:26894850-26894872 GAGGGAGAAGAAAGAGATGGGGG + Intergenic
1182022266 22:27090997-27091019 GCTGAAGGCGTAAGAGATGGAGG + Intergenic
1182134830 22:27891678-27891700 GCGGCAGGAGAGAGAGGAGGAGG - Intronic
1182150671 22:28024985-28025007 GGAGCAGGGGAAAGAGATGCAGG + Intronic
1182235370 22:28871084-28871106 GCAGCAGGAGGAAGAGAGAGAGG - Intergenic
1182652859 22:31866162-31866184 GCTACAGGAGAAAGTAAGGGAGG - Intronic
1182738371 22:32547396-32547418 ACTGAAGGAGACAGAGAAGGAGG - Intronic
1182771798 22:32801747-32801769 GCTGGAGGAGCAAGAGGAGGAGG - Exonic
1182985895 22:34715842-34715864 GATGGAGGAGGAGGAGATGGAGG - Intergenic
1182996296 22:34815961-34815983 GGAGCAGGAGAAAGAGACGGGGG + Intergenic
1183041260 22:35179845-35179867 GGAGCAGGAGAAAGGGTTGGGGG + Intergenic
1183221266 22:36514982-36515004 AGAGCAGGAGAAAGAGAGGGGGG - Intronic
1183301413 22:37060852-37060874 GCAGCAGGAGGAGGAGGTGGAGG + Exonic
1183339357 22:37271056-37271078 GCTGCAGGGGAGACTGATGGGGG + Intergenic
1184449470 22:44574512-44574534 GAAGGAGGAGAAAGAGAAGGAGG + Intergenic
1184449809 22:44576152-44576174 GAAGGAGGAGAAAGAGAAGGAGG + Intergenic
1184636269 22:45834521-45834543 GCTGCAGGAGACAGTTGTGGGGG - Intronic
1184704865 22:46203916-46203938 GATGCAGGAGGCAGAGAAGGGGG - Intronic
1184956402 22:47889716-47889738 GGAGCAGGAGAAAGAGAGAGGGG - Intergenic
1185106429 22:48872350-48872372 GCTGGAGGAGGAAGCGATGGGGG - Intergenic
1185193188 22:49451777-49451799 GCTGAAGGGGAAGGCGATGGAGG - Intronic
1185305149 22:50111238-50111260 GCTGGAGGAGAAAGAGGGTGCGG + Intronic
1203239940 22_KI270733v1_random:6950-6972 TCTGCTGGAGACAGAGATGGAGG + Intergenic
1203250131 22_KI270733v1_random:110340-110362 AAGGAAGGAGAAAGAGATGGAGG - Intergenic
949324033 3:2843654-2843676 AAAGCAGGAGCAAGAGATGGGGG - Intronic
949607038 3:5664549-5664571 GGAGCAGGAGCAAGAGAAGGGGG + Intergenic
950530676 3:13550694-13550716 CCAGCAGGAGGAAGAGAGGGAGG + Intronic
950584875 3:13885131-13885153 GGTGCTGGAGACAGAGATGAAGG - Intergenic
950794975 3:15503340-15503362 TCTGCAGTATAGAGAGATGGGGG + Intronic
951485556 3:23204665-23204687 GCTGCAGGGGAAAGAGAATGGGG - Intronic
951486748 3:23221455-23221477 GCTGGTGGTGAAAGAGCTGGGGG - Intronic
951583898 3:24195707-24195729 GCTGGAGGATAGAGAGAAGGGGG - Intronic
952070174 3:29625073-29625095 GAGGCAGGAGACAGAGAGGGTGG - Intronic
952279375 3:31908466-31908488 GCTGCAGGTGCAAGAGAAGGGGG - Intronic
952319142 3:32259528-32259550 GCAGCTGGAGACAGAGATCGAGG + Intronic
952791539 3:37204495-37204517 GCTGCAGCAGAGTGAGCTGGTGG + Intergenic
953066428 3:39476118-39476140 GGAGCAGGAGAGAGAGAGGGAGG + Intronic
953486116 3:43298332-43298354 GCTGCTGGAAAAAGAGAAGCAGG + Intronic
953685318 3:45073584-45073606 GGTGAAGGAGAAAGAGATAGGGG + Intergenic
953701156 3:45196784-45196806 GCAGGAGAGGAAAGAGATGGTGG + Intergenic
954684068 3:52361142-52361164 CCTGCAGGAGACAGAGGAGGTGG - Exonic
954714465 3:52520256-52520278 GCTGCAGGAGAAAGAGATGGGGG - Exonic
955264694 3:57430614-57430636 GCTGCAAGCCAAAGAGATTGAGG - Intronic
955488439 3:59458371-59458393 TCTGCTGGGGAAAGAGATGGGGG + Intergenic
955628308 3:60945054-60945076 GAAGCAGGGCAAAGAGATGGAGG + Intronic
955812814 3:62808915-62808937 GTTGGAGGAGGAAGAGTTGGAGG - Intronic
956287542 3:67626576-67626598 GCTGAAGGAGAAAAAGTTGAAGG + Intronic
956591406 3:70918970-70918992 GCTCTAGGAGAAAAAGTTGGTGG - Intergenic
956732887 3:72213233-72213255 GTAGCAGGAGGAAGAGAGGGAGG + Intergenic
956765350 3:72480126-72480148 GCAGCAGGAGAAAGAGAGAGAGG - Intergenic
957069139 3:75552054-75552076 ACCGCGGGAGAAGGAGATGGTGG - Intergenic
957522369 3:81336028-81336050 GATGAGGAAGAAAGAGATGGGGG - Intergenic
957901482 3:86499568-86499590 GCTGCAGGAGAGAGAGAGCGAGG + Intergenic
957941480 3:87010782-87010804 TAAGCAGGAGAAAGAAATGGAGG - Intergenic
958070593 3:88605785-88605807 GGTTCAGGAGAAAGAGTGGGAGG + Intergenic
958115204 3:89207326-89207348 GCTGAAGGAGAAAAGGAGGGAGG + Intronic
958630097 3:96673209-96673231 GATGGAGGACAGAGAGATGGAGG - Intergenic
958630109 3:96673308-96673330 GATGGAGGAGAGAGAGATGGAGG - Intergenic
958630111 3:96673323-96673345 GATGGAGGACAGAGAGATGGAGG - Intergenic
958630126 3:96673458-96673480 GATGGAGGAGAGAGAGATGGAGG - Intergenic
958630132 3:96673506-96673528 AATGGAGGAGAGAGAGATGGAGG - Intergenic
958630138 3:96673556-96673578 GATGGAGGAGAGAGAGACGGAGG - Intergenic
958630144 3:96673630-96673652 GATGGAGGAGAGAGAGATGGAGG - Intergenic
958767148 3:98382814-98382836 GCTGGAGGAAAAAGAGAGGTTGG - Intergenic
959404093 3:105939772-105939794 ACAGAAGGTGAAAGAGATGGAGG + Intergenic
959444457 3:106421382-106421404 TGTGAAGGAGAAAGAGAAGGAGG + Intergenic
959584504 3:108013690-108013712 GCTGGAGGAACAATAGATGGTGG - Intergenic
959612824 3:108314220-108314242 GTCAAAGGAGAAAGAGATGGAGG + Intronic
960099984 3:113731445-113731467 GCTTAAGGAGAAAGAAATGAGGG - Intronic
960972371 3:123149065-123149087 GCTGGAGGACAAAGACAGGGAGG + Intronic
961382668 3:126505844-126505866 GCTGCAGGGAGAAGAGGTGGGGG + Exonic
961428621 3:126864588-126864610 GGTGGAGGAGAAGGAGGTGGTGG - Intronic
961428628 3:126864612-126864634 GGTGGAGGAGAAGGAGGTGGTGG - Intronic
961428698 3:126864905-126864927 GGTGGAGGAGAAGGTGATGGTGG - Intronic
961521031 3:127467465-127467487 GCTGCAGGAGGAAGGGGAGGTGG - Intergenic
962236361 3:133710795-133710817 GCTGCAGGAGAATGTTGTGGGGG - Intergenic
962304507 3:134273554-134273576 GCAGCAGGAGGAAGAGGAGGGGG - Intergenic
962316334 3:134361775-134361797 GCAGCAGGAGCAAGAGAAGCTGG - Exonic
962431975 3:135328280-135328302 GCTGCAGGTGAGAGAGCTGAGGG + Intergenic
962698684 3:137975822-137975844 GCTGCAGCAGAGTGAGGTGGGGG - Intergenic
963044713 3:141094175-141094197 GCTGGAGGAGGAAGAGAAGGTGG - Intronic
963351626 3:144158972-144158994 ACAGCAGGAGAGAGAGAAGGAGG + Intergenic
963402438 3:144817046-144817068 ACAGAAAGAGAAAGAGATGGAGG + Intergenic
964002090 3:151787205-151787227 GGGGAAGGAGAAAGAGATGGGGG - Intergenic
964367229 3:155963360-155963382 GCTTCAGGAGAAAGAGACATGGG - Intergenic
964665776 3:159170368-159170390 GCTGGAGGAGAAGCAGTTGGGGG - Intronic
964928949 3:161991914-161991936 GGGGCAGGAGGAAGAGTTGGAGG + Intergenic
965003219 3:162985029-162985051 GATGCAGGAGGAAGATAAGGGGG - Intergenic
965349813 3:167598547-167598569 GCAGCAGGAGAAAGAGAGTGGGG - Intronic
965451703 3:168846160-168846182 GGTGGAGGAGAAAGAGGAGGAGG - Intergenic
965543241 3:169890896-169890918 GCTTCAGGAGCAAGAGTGGGAGG - Intergenic
965544707 3:169903645-169903667 GCAGCTGGAGACAGAGATTGAGG - Intergenic
966117922 3:176487082-176487104 ACTTCAGGAGGCAGAGATGGGGG + Intergenic
966140482 3:176751641-176751663 TCTGATGGAGAAAGAGAAGGAGG + Intergenic
966859824 3:184224455-184224477 GCTCCAGGAGAAGGAGACAGAGG + Intronic
967776558 3:193391954-193391976 GCTGCACGAGACTGAGATGTGGG + Intergenic
967930583 3:194687621-194687643 GCTGCAGGAGGAAGAGGAAGAGG + Exonic
968129613 3:196185115-196185137 GCTGCAGGCGAAGGAGGTGAGGG + Intergenic
968442889 4:633489-633511 GCTGCAGGGGAAGGGGGTGGAGG + Intronic
968924729 4:3541262-3541284 GCAACAGGAGACAGAGATGCAGG - Intergenic
969032073 4:4223577-4223599 GCAGAAGGAGAAGGAGAAGGAGG + Intronic
969338695 4:6527406-6527428 GCACCAGGAGAAAGAGAGAGGGG - Intronic
969612164 4:8233417-8233439 CCTCCAGAAGAAAGAGAAGGAGG + Exonic
970222157 4:13822179-13822201 GCTGAAGGAGAAAGACCTGCAGG + Intergenic
970223207 4:13831466-13831488 GCTGCAGGAGAATGAGTAAGGGG - Intergenic
970225015 4:13848901-13848923 GGAGCAGGAGAAAGAGAGGCAGG - Intergenic
970411244 4:15809855-15809877 ACTGCAGTAGACAGGGATGGGGG - Intronic
970828775 4:20310122-20310144 GATGTATGAGAAGGAGATGGTGG - Intronic
971587446 4:28422201-28422223 GGAGCAAGAGAAAGAGAAGGGGG + Intergenic
971598835 4:28567570-28567592 GCTGCAGGAGAGAGAAAGTGGGG + Intergenic
972428380 4:38956578-38956600 AAAGCAGGAGCAAGAGATGGGGG - Intergenic
972538722 4:40020830-40020852 GCAGCTGGAGACAGAGATCGAGG + Intergenic
972709277 4:41578241-41578263 GCAGCAGGAGAGAGAGAAGGGGG + Intronic
973105986 4:46338061-46338083 GGTGGAGGAGAAAGAGAAGGAGG - Intronic
974095491 4:57359451-57359473 GGTACAGGAGAAAGAGAGAGAGG + Intergenic
974457524 4:62146648-62146670 GGAGCAAGAGAAAGAGTTGGGGG - Intergenic
975190850 4:71460398-71460420 GCTGGATGAGCAAGACATGGAGG - Intronic
975265072 4:72353921-72353943 GATGTAGGAGAAAAAAATGGGGG - Intronic
975423885 4:74203605-74203627 GGAGCAGGAAGAAGAGATGGGGG + Intronic
976692356 4:87882552-87882574 TCTGCTGGAGAAAGAGGTTGGGG + Intergenic
976777186 4:88719600-88719622 GGAGGAGGAGAAAGAGAAGGGGG - Intergenic
977012046 4:91648481-91648503 GCTGCTGGAGAAACAGATTTTGG + Intergenic
978492588 4:109324435-109324457 GTGGCAGGAGAAAGAGAGGGGGG + Intergenic
979104672 4:116668445-116668467 GCAGCAGAAGAGAGAGAAGGAGG - Intergenic
979596901 4:122544256-122544278 ACAGCAGGAGAAAGAAATTGTGG + Intergenic
979640491 4:123008142-123008164 GCCTCAGCAGAAAGAGATGCTGG - Intronic
980092463 4:128456583-128456605 GCTACAAGTGGAAGAGATGGAGG - Intergenic
980222577 4:129938642-129938664 AGATCAGGAGAAAGAGATGGAGG - Intergenic
980963062 4:139495558-139495580 GCGGCAGGAGAAAGAGAGCAGGG + Intergenic
981069788 4:140523182-140523204 GCTGGAGGAGAAAGAGCAAGGGG - Intergenic
982179899 4:152740681-152740703 TCTGCAGGAAAAATAGAAGGAGG - Intronic
982205587 4:152995216-152995238 GCTGCAGGGGGAAGGGAGGGAGG + Intergenic
982668497 4:158293734-158293756 GCTGAGGGAGAAGGAGATGGTGG - Intergenic
983287160 4:165754403-165754425 GCTGCAGGTGATAGATATGGTGG - Intergenic
983578900 4:169288157-169288179 GTGGCAGGAGAAAGCGAAGGGGG + Intergenic
983808635 4:172027893-172027915 GCTGCAGGACAAAAGTATGGAGG + Intronic
983946701 4:173594106-173594128 TCTGCAGGAGAAAGAGTTGGGGG + Intergenic
984121120 4:175745809-175745831 GAGGCTGGAGAAGGAGATGGGGG + Intronic
984157200 4:176207314-176207336 GCTGCAGGTGGCAGGGATGGAGG + Intergenic
984620723 4:181949516-181949538 GGTGCAGGTGAAAGAAAGGGAGG - Intergenic
984723112 4:182995033-182995055 GGTGGAGGTGGAAGAGATGGAGG - Intergenic
985202088 4:187494339-187494361 GGAGCAGGAGGAAGAGAGGGAGG - Intergenic
985347846 4:189025609-189025631 CCTTCAGGAGAAAGTGATGCTGG + Intergenic
985404998 4:189629043-189629065 GCTTCAGGGGAGAGGGATGGGGG + Intergenic
985475497 5:76700-76722 GGAGGAGGAGGAAGAGATGGGGG + Intergenic
985816599 5:2132372-2132394 TCTGCTGGAGACAGAGATGTGGG - Intergenic
986014814 5:3748568-3748590 GTTGCAGGGGAGAGAGAGGGAGG - Intergenic
986290135 5:6393142-6393164 GTGGCAGGAGAGAGAGAGGGAGG - Intergenic
986360655 5:6975117-6975139 GGAGTAGGAGAAAGAGAGGGAGG + Intergenic
986392618 5:7300295-7300317 GAAGCAGGAGAAGCAGATGGGGG - Intergenic
986538865 5:8822367-8822389 GCAGCAGGAGAGAGAGAGAGAGG - Intergenic
986552898 5:8978625-8978647 GGAGGAGGAGAAAGAGGTGGGGG - Intergenic
986575694 5:9210551-9210573 GCATCGGGAGAGAGAGATGGAGG + Intronic
986815735 5:11407990-11408012 GAGGCAGGAGAAGGAGATTGGGG + Intronic
987372809 5:17208637-17208659 GCTGGAGGAGGAAGAGGAGGAGG + Intronic
987447259 5:18035074-18035096 GCTGCAGCAGGAAGAAAAGGAGG - Intergenic
988455981 5:31387724-31387746 GGAGCAGGAGGAAGAGAGGGCGG + Intergenic
989087875 5:37695153-37695175 GGAGCAGGAGTAAGAGAAGGGGG + Intronic
989127133 5:38066070-38066092 GATGCAGGAGAAAGAAATAAAGG - Intergenic
989197731 5:38732047-38732069 CCTACAGGAGAAAGAGCTGGTGG - Intergenic
989218576 5:38930031-38930053 GCTGGAGGAGAAAGGGCTGGAGG - Intronic
989692358 5:44159295-44159317 GATGCAGGAGGAAGATAAGGGGG + Intergenic
989810613 5:45668384-45668406 GTGGCAGGAGAGAGAGATTGAGG - Intronic
990184851 5:53201732-53201754 GCCTCAGGAGAGGGAGATGGGGG - Intergenic
990570481 5:57073375-57073397 GAAGCAGGAGAAGGAGAAGGAGG + Intergenic
991669675 5:69035542-69035564 TCTGAAGGACAAAGAGATTGGGG + Intergenic
992800215 5:80289014-80289036 GCAGCTGGAGACAGAGATTGAGG + Intergenic
993174514 5:84466264-84466286 GTTGCAGGAGAATGAGAATGTGG + Intergenic
994084504 5:95743636-95743658 GGGGAAGGAGAAAGAGAGGGAGG - Intronic
994114418 5:96046124-96046146 GCTGGAGTAGAATGAGATAGGGG + Intergenic
994722561 5:103397868-103397890 GGGACAGGAGAAAGAGACGGCGG + Intergenic
994936199 5:106256171-106256193 GCAGAAGGTGAAAGAGATGCAGG - Intergenic
995001611 5:107137993-107138015 GCAGAATGAGAAAGAAATGGAGG + Intergenic
995324213 5:110872796-110872818 GCTCCAGGAGAAGGAGAAGGTGG + Intergenic
995504069 5:112840602-112840624 GCTGCTGGAGAAGGAGTTAGAGG + Exonic
995566935 5:113440586-113440608 ACGGAAGGAGAAAGAGAGGGAGG + Intronic
995623791 5:114055667-114055689 GCTGCAGAGGAAAGACAGGGAGG - Intergenic
995654636 5:114411653-114411675 GCTCCAGGAGAGAGAGAGAGGGG + Intronic
996452057 5:123636697-123636719 GCAGCTGGAGACAGAGATCGAGG + Intergenic
996784598 5:127224696-127224718 GTTGGAGGAGGAAGGGATGGTGG + Intergenic
997294484 5:132761132-132761154 GCTGAAGGAGAAGGAAAGGGAGG - Exonic
997430859 5:133839996-133840018 GCTGCAGGGGTGAGAGGTGGGGG + Intergenic
997767910 5:136523871-136523893 GCAGCAGGAGAGAGAGAGAGGGG + Intergenic
998097050 5:139401928-139401950 GCAGCTGGAGAAAGAGAAGCTGG - Exonic
998255260 5:140581513-140581535 GCTGGAGGAGAAAGAAATGCAGG + Intronic
998272404 5:140718637-140718659 GCTGAAGGCGAAGGAGGTGGGGG + Intergenic
998294199 5:140951526-140951548 GGTGCAGGAGCAAGGGACGGGGG + Intronic
998900032 5:146843393-146843415 ACTGCAGGGTAAAGAGAGGGTGG - Intronic
998928842 5:147157870-147157892 GCTGCTGGAAATAGAGAAGGAGG - Intergenic
999100933 5:149025318-149025340 ACTGGAAGAGAAAGAGAAGGGGG + Intronic
999494479 5:152083617-152083639 GAGGCAGGAGAAGGAGATAGAGG - Intergenic
1000552318 5:162682360-162682382 GAAGCAGGAGGAAGAGAGGGAGG + Intergenic
1000641590 5:163709356-163709378 GCTGGAGGAGAAACTGAAGGAGG - Intergenic
1001440638 5:171740075-171740097 GCTAAAGGAAAAAGAGTTGGAGG - Intergenic
1001708309 5:173758108-173758130 GCTGCAGGTGGAAGATCTGGGGG + Intergenic
1001733048 5:173974110-173974132 GCTGCAGGTGAAGGAGATGCTGG + Intronic
1002136820 5:177112830-177112852 GCTGCATAGGAGAGAGATGGTGG + Intergenic
1002402177 5:178996855-178996877 GCTGGAGGAGAAGGGGAGGGGGG + Intergenic
1002521054 5:179793500-179793522 CCTGAAGGAGAAAGAGCTTGTGG + Intronic
1003136259 6:3436717-3436739 GCTGCAGGAGACAGGGAGGATGG - Intronic
1003406731 6:5832457-5832479 GGAGCAGGAGAAGGAGAAGGAGG + Intergenic
1003449651 6:6219028-6219050 GTTGAAGAAGAAATAGATGGTGG + Intronic
1004144564 6:13053109-13053131 GCTGGAGGAGGAAGAGAAAGAGG - Intronic
1004288587 6:14345996-14346018 GCTGGAGTGGAAAGAGTTGGAGG + Intergenic
1004291308 6:14369971-14369993 TCTGCACCAGAAAGAGAAGGAGG - Intergenic
1004567512 6:16812618-16812640 GATGAAGTAGAAAGACATGGTGG - Intergenic
1005055272 6:21722858-21722880 GATGCAGGAGGAAGATAAGGAGG - Intergenic
1005167727 6:22944297-22944319 GGAGCAGGAGAAAGAGAAGGAGG + Intergenic
1005507972 6:26486449-26486471 GCAGCAGGAGAGAGAGAGGGAGG + Intergenic
1005761213 6:28969810-28969832 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1006184972 6:32176259-32176281 GCAGCTGGAGCCAGAGATGGGGG - Intronic
1006293892 6:33161325-33161347 GGTGCGGGAGAAACAGATGGGGG + Intergenic
1006299369 6:33185535-33185557 GCTGCAGCAGAGAGACAGGGAGG + Intronic
1006342646 6:33455008-33455030 GCTGCAGAGGAAAAAGATGGAGG - Exonic
1006675577 6:35760360-35760382 GCGGCAGGAGAGAGAGAGCGAGG + Intergenic
1007066523 6:38996479-38996501 GATGGAGGAGAAGTAGATGGAGG - Intronic
1007233924 6:40377089-40377111 AGAGCAGGAGAAAGAGAGGGAGG + Intergenic
1007496033 6:42260871-42260893 GCTGAGGGAGAAACAGAAGGGGG - Intronic
1007578225 6:42939507-42939529 GCAGCAGGAGAGAGGGAGGGAGG - Intergenic
1008582582 6:52920415-52920437 GATGGAGGAGATAGAGACGGAGG - Intergenic
1008583694 6:52929739-52929761 TCTGAAGCAGACAGAGATGGGGG + Intergenic
1009267874 6:61579030-61579052 CCTGCAGCAGAAAGAGAGGGAGG + Intergenic
1009352620 6:62701274-62701296 GAAGAAGGAGAAAGAGAAGGAGG + Intergenic
1010155084 6:72783177-72783199 GCAGCTGTAGAGAGAGATGGTGG + Intronic
1010752501 6:79631254-79631276 GCTGAAGGGGAAGGAGAGGGAGG - Intergenic
1011064723 6:83312576-83312598 ATTGAAGGAGAAAGAGAGGGAGG + Intronic
1011242602 6:85288310-85288332 GCAGCTGGAGATAGAGATTGAGG + Intergenic
1011311913 6:85988965-85988987 GCTGCAGAAGCCAGGGATGGTGG + Intergenic
1011361630 6:86531710-86531732 GGAGGAGGAGAAAGAGAAGGAGG - Intergenic
1012471711 6:99579881-99579903 GGAGCAGGAGCAAGAGGTGGAGG - Intergenic
1013033825 6:106361119-106361141 GCAGCAGGAGAAGGAGGAGGAGG - Intergenic
1013041720 6:106440793-106440815 GTTTCATCAGAAAGAGATGGTGG - Intergenic
1013178118 6:107694511-107694533 GGAGCAGGAGCAAGAGAGGGTGG + Intergenic
1013475809 6:110506315-110506337 CCTGCTGGAAACAGAGATGGAGG - Intergenic
1013478224 6:110529391-110529413 GCTGGAGGATAAAGAGGAGGAGG - Intergenic
1013667332 6:112362117-112362139 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1013937727 6:115618239-115618261 GGTGGAGGTGAAGGAGATGGTGG + Intergenic
1014009241 6:116457997-116458019 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1014288308 6:119528669-119528691 GCTGGAGGACAAAGAGCTTGAGG - Intergenic
1014338146 6:120165683-120165705 ATTGCAAGAGGAAGAGATGGAGG - Intergenic
1014707315 6:124763431-124763453 GGAGCAGGAGCAAGAGATGGAGG + Intronic
1015228614 6:130887325-130887347 GGTCCAGGTGAAAGCGATGGTGG - Intronic
1015561920 6:134525270-134525292 GCTGAAGGAGAAAGAGGAGGAGG + Intergenic
1015769327 6:136752834-136752856 GCTGGAGGGGAAAGAGAAAGGGG + Intronic
1016074338 6:139778211-139778233 TCTGCAGGATAAAGAGCTGCTGG - Intergenic
1016310133 6:142725205-142725227 GCTGCAGGAGGAAGTGACTGAGG - Intergenic
1016518335 6:144922289-144922311 GCTGCATGAGAAGCAGATGTTGG - Intergenic
1017184751 6:151589563-151589585 GCTGCTGGATATAGAGATGGGGG - Intronic
1017926326 6:158914400-158914422 GCAGCAGGACAGAGAGATAGGGG - Intergenic
1018058141 6:160070024-160070046 GCTGCAGGTGAATCGGATGGTGG - Exonic
1018066998 6:160131390-160131412 GCTGCAGGAGACAGGGAGAGGGG + Intronic
1018278992 6:162164303-162164325 GAGGCAGGAGATGGAGATGGGGG - Intronic
1018446616 6:163864361-163864383 GCTGAAGGAAAAAGAGCTGCAGG - Intergenic
1018613966 6:165668553-165668575 GTTACAGGAGAAAGAAATGTTGG + Intronic
1018621541 6:165733769-165733791 GGTGCAGGAAGAAGAGATTGTGG - Intronic
1018897053 6:168027079-168027101 GGGGCAGGAGGCAGAGATGGGGG + Intronic
1018933405 6:168257350-168257372 GCAGAGGGAGAGAGAGATGGGGG - Intergenic
1018946719 6:168352402-168352424 GGAGCAGGAGAAAGAGGTGGGGG + Intergenic
1019114193 6:169744274-169744296 ACTGGAGGAGAAAGAGAGAGGGG + Exonic
1019399515 7:844237-844259 GCTGCAGGTGAGAGAGATCCTGG - Intronic
1019481225 7:1267654-1267676 CCTGCAGGAGACCGAGCTGGGGG + Intergenic
1019527489 7:1487285-1487307 GCTCCAGGAGGTAGAGATGGTGG - Intronic
1019774940 7:2906769-2906791 GCTGAAGGAGAAGGAGCTGGAGG - Exonic
1019847611 7:3521942-3521964 TCTGCAGGACAGAGAGAAGGTGG + Intronic
1020105977 7:5422516-5422538 GCTGCTGCAGACAGAGATCGAGG - Intronic
1020358828 7:7305343-7305365 GCTGGAGGAGAGAGAGAGAGAGG - Intergenic
1020616094 7:10464527-10464549 GGAGCAGGAGGAAGAGAGGGTGG - Intergenic
1020682756 7:11257118-11257140 GCTGCAGGAGAAAAGGAAAGAGG - Intergenic
1021840524 7:24718320-24718342 GCTGGAGGAGAAAGAGTTTGGGG + Intronic
1022772362 7:33487635-33487657 GCTGCTGGAGGAAGAGATCTGGG + Intronic
1022793614 7:33714376-33714398 GCTGCAGCAGAAAGAGCCTGGGG - Intergenic
1022793654 7:33714578-33714600 GGAGGAGGAGAAAGAGAAGGAGG - Intergenic
1023214500 7:37847552-37847574 GGAGAAGGAGAAGGAGATGGAGG + Intronic
1023351510 7:39324365-39324387 GTTTCAAGAGAAAGTGATGGGGG + Intronic
1023384708 7:39644608-39644630 GTTGAAGGAAAAAGAGATGAAGG - Intronic
1023401655 7:39795925-39795947 ACTGCAGGTGAAACAGATGCTGG - Intergenic
1023751068 7:43373086-43373108 CCTGGAGCAGGAAGAGATGGAGG + Intronic
1024286699 7:47763913-47763935 GGTCCCGCAGAAAGAGATGGAGG + Intronic
1024512194 7:50212986-50213008 GATGCTGGAGAAAGAGTGGGAGG + Intergenic
1024775986 7:52786457-52786479 GCTGCAAGAGAGAGAGAATGTGG - Intergenic
1025887767 7:65614487-65614509 GGAGGAGGAGGAAGAGATGGAGG - Intergenic
1026191865 7:68136281-68136303 GGAGAAGGAGAAAGAGAAGGAGG + Intergenic
1026477159 7:70746704-70746726 GCTGAAGGAGAGGGAGAGGGGGG + Intronic
1026499143 7:70928127-70928149 GCTGCATAAGAAGGAGAGGGAGG + Intergenic
1026800596 7:73397721-73397743 GGTGCTGGAGGAAGAGAAGGGGG + Intergenic
1029184726 7:98730393-98730415 AATGCAGGAGAAAGAGACAGAGG + Intergenic
1029251424 7:99239484-99239506 GCTGCATGAAGAACAGATGGTGG + Intergenic
1029316182 7:99716687-99716709 ACTGGAGGAAAAAGAAATGGTGG + Intronic
1029403327 7:100358505-100358527 GGTGGAGGGGGAAGAGATGGCGG - Intronic
1029426150 7:100495113-100495135 GTTGAAGGAGTAAGAGAGGGGGG + Intergenic
1029497395 7:100903421-100903443 GCTGCAGGCAACAGTGATGGCGG + Intergenic
1029575612 7:101401515-101401537 GCAGGAGGACAAAGAGAAGGAGG + Intronic
1029792915 7:102864161-102864183 GAGGCTGGAGAAAGAGATGGAGG - Intronic
1030330556 7:108265455-108265477 GATGATGGAGAAAGACATGGAGG - Intronic
1031690610 7:124782936-124782958 GGAGCAGGAGAGAGAGAAGGGGG - Intronic
1031854605 7:126907202-126907224 GAAGGAGGAGGAAGAGATGGAGG + Intronic
1031854610 7:126907223-126907245 GGAGGAGGAGGAAGAGATGGAGG + Intronic
1031915776 7:127561674-127561696 GGGGCAGGAGAAACAGATGGAGG + Intergenic
1031919572 7:127590962-127590984 GCTGCAGGAGGACGAGCTGCGGG + Exonic
1032329271 7:130962544-130962566 GATGCAGGAGGAAGATAAGGGGG - Intergenic
1032373417 7:131383735-131383757 GATGCAGGGGAAAAAGAGGGAGG - Intronic
1032542505 7:132715040-132715062 GTGGCAGGAGAAAGGGCTGGGGG - Intronic
1032985243 7:137330304-137330326 GGAGAAGGAGAAAGAGAAGGAGG + Intronic
1033454328 7:141488943-141488965 GGAGGAGGAGAAAGAGAAGGAGG + Intergenic
1033761745 7:144443040-144443062 GGTGCAGGAGAGGGAGAGGGTGG + Intergenic
1033889598 7:145994988-145995010 GGAGAAGGAGAAAGAGAAGGAGG - Intergenic
1034085011 7:148314640-148314662 GGTGAAGGAGAAGGAGTTGGGGG + Intronic
1034452425 7:151144116-151144138 GCTGCAGCAGAGAGGGATGAGGG + Exonic
1034957296 7:155342827-155342849 GCAGCGGGAGAAAGCTATGGAGG + Intergenic
1035562022 8:612363-612385 GCTGCAGCATATAGAGATGGAGG - Intergenic
1035691959 8:1565738-1565760 CCTGCAGGAGAATGAGAAGTGGG + Exonic
1035850988 8:2919165-2919187 GCTGCAGGAGAAGGAGAAAGGGG - Intergenic
1035856370 8:2980479-2980501 GGAGGAGGAGAAAGAGAAGGAGG - Intronic
1036210459 8:6836282-6836304 GCAGCAGGGGAGAGAGATTGGGG + Intergenic
1036282861 8:7416618-7416640 GAAGCAGGAGAAAAGGATGGAGG + Intronic
1036338608 8:7894900-7894922 GAAGCAGGAGAAAAGGATGGAGG - Intronic
1036453845 8:8891993-8892015 GCTGCAGGGGAACCAGATCGCGG - Exonic
1036473542 8:9072573-9072595 GCTGGAGGGGACAGAGATAGAGG - Intronic
1037229593 8:16640468-16640490 GGTGGAGGAGAAAGAGAATGGGG - Intergenic
1037344062 8:17879580-17879602 GGAACAGGAGAAAGAGAGGGAGG - Intronic
1037375738 8:18225498-18225520 GCTTCTGGAGAAAAAAATGGGGG + Intergenic
1037411813 8:18605830-18605852 GCCACAGGAGAAAGAGAAGGGGG - Intronic
1037428680 8:18785830-18785852 GCCTGAGGAGACAGAGATGGGGG + Intronic
1037580042 8:20239652-20239674 GCAGAAGGAGAACGAGGTGGGGG + Intergenic
1039016315 8:33153286-33153308 GCAGCAGGAGTAACAGATGGTGG + Intergenic
1039176272 8:34810366-34810388 GTTGCAGCAGAAAGAGATGGAGG + Intergenic
1039947748 8:42144513-42144535 GCTGCAGGAGGAGGAGATTGTGG - Intergenic
1039986332 8:42451331-42451353 GGAGAAGGAGGAAGAGATGGAGG + Intronic
1039986484 8:42452185-42452207 GGAGGAGGAGGAAGAGATGGAGG + Intronic
1039986517 8:42452376-42452398 GGAGAAGGAGGAAGAGATGGAGG + Intronic
1039986566 8:42452676-42452698 GCAGAAGGAGGAAAAGATGGAGG + Intronic
1040055871 8:43056445-43056467 GCAGCACAAGGAAGAGATGGCGG + Exonic
1040098030 8:43467240-43467262 GGAGCAGGAGAAAGAGAGAGTGG + Intergenic
1041391256 8:57349345-57349367 GCTGAAGGAGAAATAGCTGTTGG + Intergenic
1041682072 8:60604140-60604162 ACAGCAGGAGAAAGAGAAAGAGG - Intronic
1041701544 8:60795083-60795105 TCTTCAGGAGGAGGAGATGGTGG - Exonic
1042497114 8:69467609-69467631 GCTGCAGGGAAAGCAGATGGAGG + Intronic
1042753380 8:72183319-72183341 CCTGCAAGGGAAAGAGATGACGG - Intergenic
1043284637 8:78514308-78514330 GGAGCAGGAGAAAGAGAAGGGGG - Intergenic
1043486599 8:80704402-80704424 ACAGCAGGAGACAGGGATGGAGG - Intronic
1043609681 8:82046524-82046546 GCTGCTGAAGGAAGAGATGGGGG + Intergenic
1043930567 8:86086110-86086132 GCTAGAGCAGAAAGAGAGGGAGG + Intronic
1044082445 8:87902765-87902787 GATGGAGGAGAAAGAGAGGTAGG - Intergenic
1044807323 8:96021517-96021539 GCTGCAGGGCCAAGAGGTGGTGG - Intergenic
1044937818 8:97309897-97309919 GGAGCAGGAGAAGGAGATGCTGG - Intergenic
1045709385 8:104965188-104965210 TCTGCAGAAGAAGGAGAAGGTGG + Intronic
1046019998 8:108653336-108653358 GCTGCAGAACAAAGCGCTGGAGG + Intronic
1046633813 8:116649787-116649809 GATGGAGGAGAAAGAGAAGGGGG + Intronic
1046756185 8:117974922-117974944 GAGCCAGGGGAAAGAGATGGTGG - Intronic
1046840464 8:118850531-118850553 GCTTCATGGGAATGAGATGGAGG + Intergenic
1046841705 8:118865928-118865950 ACTGAAGGAGAGAGAGATTGAGG - Intergenic
1047510896 8:125514503-125514525 ACAGCAGGAGAAAGACAAGGGGG + Intergenic
1047782421 8:128120838-128120860 GCAGGAGGAGAGAGAGATCGGGG - Intergenic
1047917367 8:129596305-129596327 GAGGCAGGAGAGAGAGATGGGGG - Intergenic
1048182079 8:132204575-132204597 GGTGGAGGATGAAGAGATGGTGG - Intronic
1048369881 8:133768032-133768054 TGTACAGGAGGAAGAGATGGAGG - Intergenic
1048392095 8:133976794-133976816 GGAGCAGGAGAGAGAGATGGGGG - Intergenic
1048592573 8:135834398-135834420 GCAGCATGAGGAACAGATGGAGG + Intergenic
1049613894 8:143568048-143568070 GCTGCAGTAGAAACGGTTGGGGG + Intronic
1049869033 8:144959021-144959043 GGTGAAGGAGAAGGAGTTGGGGG + Intergenic
1050029431 9:1369777-1369799 GCTGAAGGATAAGGAGATGTTGG - Intergenic
1051156906 9:14158240-14158262 GCTGCAGGAGGAAGATATGAAGG - Intronic
1051357709 9:16254888-16254910 GTTGGAGGAGGAAGAGGTGGAGG + Intronic
1051706028 9:19880743-19880765 GCTATAGGAGGAAGAGATTGGGG + Intergenic
1051954496 9:22674524-22674546 GGAGGAGGAGAAAAAGATGGTGG + Intergenic
1052172930 9:25424616-25424638 GGAGCAGGAGAGAGAGAAGGGGG - Intergenic
1053799802 9:41757237-41757259 GCAACAGGAGACAGAGATGCAGG - Intergenic
1054145408 9:61557696-61557718 GCAACAGGAGACAGAGATGCAGG + Intergenic
1054188210 9:61969292-61969314 GCAACAGGAGACAGAGATGCAGG - Intergenic
1054650304 9:67619284-67619306 GCAACAGGAGACAGAGATGCAGG + Intergenic
1054741625 9:68811631-68811653 GCTGCAGGCACAAGAGAAGGTGG - Intronic
1054797793 9:69318652-69318674 AGAGCAGGAGAAAGAGAAGGGGG + Intergenic
1054871400 9:70049970-70049992 GCTGGAGGAAAAAGAACTGGTGG - Intronic
1055266065 9:74497539-74497561 GCAGCAGGAGGAGGAGTTGGTGG - Exonic
1055299554 9:74868892-74868914 GATGCAGAAGAAAGAGTTTGGGG + Intronic
1056448081 9:86685955-86685977 GGTGCAGGAGAGGGAGAAGGGGG + Intergenic
1056544905 9:87605582-87605604 GATGGAGGGGGAAGAGATGGGGG - Intronic
1057113638 9:92499689-92499711 GGTACTGGAGGAAGAGATGGGGG - Intronic
1057360264 9:94366909-94366931 GCTGGAGGAGAAGGAGAAAGAGG + Intergenic
1057640567 9:96816237-96816259 GCAGCAGGAGAAAGGGAATGTGG + Intergenic
1057663075 9:97021168-97021190 GCTGGAGGAGAAGGAGAAAGAGG - Intergenic
1057745198 9:97745663-97745685 ACTGGAGGAGAAGGAGAAGGGGG + Intergenic
1058156140 9:101518029-101518051 GCTGGAGGAGAAAGGGAGGGAGG - Intronic
1058333244 9:103791388-103791410 GGAGCAGGAGGAAGAGATTGAGG - Intergenic
1058698468 9:107580666-107580688 ACTGAAGTAGAAAGAAATGGCGG + Intergenic
1059269129 9:113061208-113061230 GCAGCTGGAGAAAGAGGAGGGGG - Intergenic
1059270265 9:113066657-113066679 GCAGCTGGAGAAAGAGGAGGGGG - Intergenic
1059271401 9:113072107-113072129 GCAGCTGGAGAAAGAGGAGGGGG - Intergenic
1059272532 9:113077551-113077573 GCAGCTGGAGAAAGAGGAGGGGG - Intergenic
1059273667 9:113082993-113083015 GCAGCTGGAGAAAGAGGAGGGGG - Intergenic
1059274803 9:113088439-113088461 GCAGCTGGAGAAAGAGGAGGGGG - Intergenic
1059353409 9:113682017-113682039 GCAGCAGGAGAAAGGAATGAGGG - Intergenic
1059366460 9:113790149-113790171 GCTGCAGGAGAAAGTGAGGCTGG - Intergenic
1060178695 9:121516663-121516685 GGAGCAGGACCAAGAGATGGTGG - Intergenic
1060348610 9:122838134-122838156 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1060404889 9:123368273-123368295 CCACCAGGGGAAAGAGATGGTGG + Intronic
1060785421 9:126448675-126448697 GGAGCAAGAGAAAGAGAAGGGGG + Intronic
1061360447 9:130138518-130138540 GGAGGAGGAGAAAGAGGTGGAGG - Exonic
1061641845 9:131964397-131964419 GCTGGAGGTGATAGTGATGGTGG + Intronic
1061902140 9:133678382-133678404 GCTGCAGGGGAGAAAGAGGGCGG - Intronic
1062562750 9:137149062-137149084 GATGGAGGCGAAAGAGCTGGAGG + Exonic
1062567409 9:137169403-137169425 CCTGCAGGACAACGAGCTGGCGG - Exonic
1062672916 9:137722505-137722527 TCTGCAGGAGAAGGAGGGGGTGG + Intronic
1203422390 Un_GL000195v1:5501-5523 TCTGCTGGAGACAGAGATGGAGG - Intergenic
1203466532 Un_GL000220v1:93607-93629 AAGGAAGGAGAAAGAGATGGAGG - Intergenic
1185561253 X:1062065-1062087 GATGGAGGAGATGGAGATGGAGG - Intergenic
1185566707 X:1100217-1100239 GATGCAGGAGATAGAGGAGGAGG + Intergenic
1185566761 X:1100514-1100536 GATGCAGGAGATAGAGGAGGAGG + Intergenic
1185591719 X:1281528-1281550 GGTGCAGGAGGAGGAGAAGGAGG - Intronic
1186051272 X:5598253-5598275 AGAGCAGGAGCAAGAGATGGGGG + Intergenic
1186342364 X:8658117-8658139 GATGCAGCAGAAAGAGCTGTGGG + Intronic
1186403821 X:9283936-9283958 GCTGCAGAGGAAAGATGTGGTGG + Intergenic
1186413222 X:9361745-9361767 ACAGCAAGAGAAAGAGTTGGGGG - Intergenic
1186996256 X:15126535-15126557 GTTGCAGGAGAAAGAGAGAGAGG + Intergenic
1187386332 X:18852150-18852172 GCTGCAACTGAGAGAGATGGTGG - Intergenic
1187388880 X:18873007-18873029 GCGGCAGGGGAAACAGAAGGAGG - Intergenic
1187391536 X:18889510-18889532 GCTGCAGGGGAAAGGGGTGGCGG + Intergenic
1187634273 X:21210080-21210102 GTGGCAGGAGAAAGAGAATGAGG - Intergenic
1187693794 X:21898031-21898053 CCTGCAAGACAAAGAGATGCAGG - Intergenic
1187942771 X:24398102-24398124 GATCCTGGAGAAAGAGATTGGGG + Intergenic
1188023807 X:25187332-25187354 GCTGCAGGACAATGAGAGGAGGG - Intergenic
1188138197 X:26515484-26515506 GCAGCAAGAGAAAGAGATTGGGG - Intergenic
1189066244 X:37812358-37812380 GAAGAAGGAGAAAGAGCTGGGGG + Exonic
1189446519 X:41085752-41085774 GCTGCAGGAGGAGGAGCAGGAGG + Exonic
1189753075 X:44242757-44242779 GGTGCAGTAGGAGGAGATGGTGG - Intronic
1190084155 X:47380859-47380881 GGAGGAGGAGAAAGAGAAGGAGG + Intronic
1190084160 X:47380886-47380908 GGAGGAGGAGAAAGAGAAGGAGG + Intronic
1190084165 X:47380913-47380935 GGAGGAGGAGAAAGAGAAGGAGG + Intronic
1190084171 X:47380946-47380968 GGAGCAGGAGAAAGAAAAGGAGG + Intronic
1190084177 X:47380976-47380998 GGAGGAGGAGAAAGAGAAGGAGG + Intronic
1190084190 X:47381033-47381055 GGAGGAGGAGAAAGAGAAGGAGG + Intronic
1190084200 X:47381081-47381103 GGAGGAGGAGAAAGAGAAGGAGG + Intronic
1190084203 X:47381108-47381130 GCAGAAGGAGAAAGAGCAGGAGG + Intronic
1190084211 X:47381144-47381166 GGAGGAGGAGAAAGAGAAGGAGG + Intronic
1190084214 X:47381171-47381193 GCAGAAGGAGAAAGAGCAGGAGG + Intronic
1190336237 X:49264127-49264149 GATGGAGGAGACAGAGATAGGGG + Intronic
1190628721 X:52364273-52364295 GCAGCTGCAGAAAGACATGGTGG + Intergenic
1190809306 X:53868202-53868224 GCTGCCAGAGAAAGATATGATGG - Intergenic
1192205721 X:69094888-69094910 GCTGCAGGGGCAAGTGAAGGGGG - Intergenic
1193090960 X:77493756-77493778 GGAGCAGGAGCAAGAGAAGGTGG + Intergenic
1193354935 X:80508206-80508228 CCAGCATGAGAAAAAGATGGAGG + Intergenic
1193885354 X:86977750-86977772 GCTCCAGGGAAAAGAGATGGAGG - Intergenic
1193900095 X:87166538-87166560 GAAGCAGGAGCAGGAGATGGTGG + Intergenic
1194072791 X:89348484-89348506 GCAGCAAGAGAAAGAGAGAGAGG - Intergenic
1194200475 X:90948780-90948802 GAAGCAGGAGAAAGAGAGGGAGG - Intergenic
1194321988 X:92460254-92460276 GCAGCTGGAGACAGAGATTGAGG + Intronic
1194503204 X:94703608-94703630 GGTGAAGGAGAAAGGGTTGGGGG + Intergenic
1194641029 X:96404425-96404447 GATGCAGGAGGAAGATAAGGGGG - Intergenic
1194676287 X:96797620-96797642 GGAGCAGGAGCAAGAGACGGAGG + Intronic
1195234001 X:102878998-102879020 GCAGCAGGAGAACAAAATGGTGG - Intergenic
1195335075 X:103844867-103844889 GTTTCAGAAGAAAGAGATGTTGG + Intergenic
1195861823 X:109391271-109391293 GCTGGAGGAGTGAGAGAAGGTGG + Intronic
1196125646 X:112095928-112095950 ACAGCAGAAGATAGAGATGGTGG + Intergenic
1196481734 X:116158155-116158177 AGAGCAGGAGAAAGAGAGGGGGG - Intergenic
1196601301 X:117604456-117604478 GCTGGAGCAGAAAGAGAGAGAGG - Intergenic
1197305836 X:124841220-124841242 ACTGAAGGAGAAAGGCATGGGGG - Intronic
1197387071 X:125814715-125814737 GCTGAAGGAGATTGTGATGGTGG - Intergenic
1197617897 X:128715093-128715115 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1198225176 X:134638618-134638640 GCTTCAGGAGAAATAGAGGATGG - Intronic
1199306055 X:146268859-146268881 GCAGCAGGAGAGAGGGACGGGGG - Intergenic
1199600590 X:149539402-149539424 GCTGCCGGAGGAGGAGCTGGGGG - Intergenic
1199649965 X:149940443-149940465 GCTGCGGGAGGAGGAGCTGGGGG + Intergenic
1199931977 X:152532027-152532049 GCAGCAGGAGAGAGAGATTAGGG + Intergenic
1200085876 X:153604737-153604759 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1200546466 Y:4525201-4525223 GAAGCAGGAGAAAGAGAGGGAGG - Intergenic
1200727030 Y:6684224-6684246 GCAGCAAGAGAAAGAGAGAGAGG - Intergenic
1200728182 Y:6699999-6700021 GCAGCAAGAGAAAGAGAGAGAGG - Intergenic
1201439141 Y:13989485-13989507 ACTGCTGGGGAAAGAGAGGGAGG - Intergenic
1201445432 Y:14053223-14053245 ACTGCTGGGGAAAGAGAGGGAGG + Intergenic
1202074197 Y:21022021-21022043 GCTGTTGGGGAATGAGATGGGGG - Intergenic
1202381427 Y:24278671-24278693 ACTGCAGGTGAAACAGATGCTGG - Intergenic
1202489358 Y:25391455-25391477 ACTGCAGGTGAAACAGATGCTGG + Intergenic