ID: 954714611

View in Genome Browser
Species Human (GRCh38)
Location 3:52520855-52520877
Sequence CGTAATCCCAAAGAGTGCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 105}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954714611_954714615 6 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714615 3:52520884-52520906 CTGGGTCCACCCCAGCCTTTGGG 0: 1
1: 0
2: 2
3: 21
4: 405
954714611_954714614 5 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714614 3:52520883-52520905 TCTGGGTCCACCCCAGCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 248
954714611_954714625 25 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714625 3:52520903-52520925 TGGGGTAGGCCCCAAGGCCTGGG 0: 1
1: 0
2: 2
3: 30
4: 233
954714611_954714626 29 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714626 3:52520907-52520929 GTAGGCCCCAAGGCCTGGGCAGG 0: 1
1: 0
2: 1
3: 43
4: 318
954714611_954714616 7 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714616 3:52520885-52520907 TGGGTCCACCCCAGCCTTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 180
954714611_954714622 19 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714622 3:52520897-52520919 AGCCTTTGGGGTAGGCCCCAAGG 0: 1
1: 0
2: 1
3: 14
4: 154
954714611_954714624 24 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714624 3:52520902-52520924 TTGGGGTAGGCCCCAAGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 165
954714611_954714617 11 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714617 3:52520889-52520911 TCCACCCCAGCCTTTGGGGTAGG 0: 1
1: 0
2: 3
3: 28
4: 270
954714611_954714627 30 Left 954714611 3:52520855-52520877 CCGCTGCACTCTTTGGGATTACG 0: 1
1: 0
2: 2
3: 9
4: 105
Right 954714627 3:52520908-52520930 TAGGCCCCAAGGCCTGGGCAGGG 0: 1
1: 0
2: 1
3: 30
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954714611 Original CRISPR CGTAATCCCAAAGAGTGCAG CGG (reversed) Exonic
900807094 1:4774620-4774642 AGTGATCCCAAAGAGTGCAGGGG - Intronic
901289903 1:8115931-8115953 TGTGATTCCAAAGCGTGCAGCGG - Intergenic
901877261 1:12173985-12174007 CGTGAGCCCCAAGTGTGCAGGGG + Intronic
903298515 1:22361454-22361476 CGTCATCCCAAATGGTGGAGAGG - Intergenic
909054578 1:70806607-70806629 CATAGTCCCAACGAGTGTAGAGG + Intergenic
909054586 1:70806662-70806684 CGTAGTCCCAACGAGTGCAGAGG + Intergenic
911069531 1:93821498-93821520 CGTAGCCCCAAAGACTACAGGGG + Intronic
912892211 1:113546456-113546478 TGTAATCCCAAATACTCCAGAGG - Intronic
919213732 1:194523076-194523098 CGTAAACCCAAAGCGTTCAGAGG + Intergenic
921369406 1:214406097-214406119 CGTCATCCCAAAAAGTCCTGTGG - Intronic
922131253 1:222781420-222781442 CGGAAACCAAAAGAGAGCAGGGG + Intergenic
922462846 1:225826421-225826443 CAGAGTCTCAAAGAGTGCAGTGG - Intronic
1062794635 10:335317-335339 CGTAATCCCAGACACTTCAGGGG + Intronic
1065047273 10:21755589-21755611 CCTCATCCCAAAAAGAGCAGCGG - Intergenic
1067741850 10:48901611-48901633 TGTAATGCCAGAGAGTGCTGAGG + Intronic
1068287696 10:54961718-54961740 GGTCATCCCAAAGAGTACAGAGG - Intronic
1068287713 10:54961827-54961849 GGTCATCCCAAAGAGTGTAGAGG - Intronic
1068317606 10:55367027-55367049 CATAATCCCAGAGAATGGAGGGG - Intronic
1068812373 10:61270442-61270464 TGTAATCCCAACTACTGCAGAGG + Intergenic
1073662353 10:105490589-105490611 CATAATCCCCAGGATTGCAGAGG - Intergenic
1074815619 10:117139538-117139560 CTCATTCACAAAGAGTGCAGGGG + Intergenic
1076827562 10:132976976-132976998 GGTCATCCCCAAGACTGCAGGGG - Intergenic
1077106290 11:843935-843957 CGGAAACCCCAAGCGTGCAGTGG - Intronic
1080868042 11:36212942-36212964 CTTATTCCAAAAGACTGCAGAGG - Intronic
1081819760 11:45981036-45981058 TGTAAGCCCCATGAGTGCAGGGG + Intronic
1082796468 11:57381476-57381498 TGGAATCCCAGAGAGTGAAGTGG + Intergenic
1085303572 11:75472800-75472822 CGCTATCCTAAAGAGTCCAGTGG + Intronic
1090760083 11:129828819-129828841 CATAATCCTAGAGAGGGCAGTGG - Intronic
1099494236 12:83325675-83325697 CGTTATGACAAAGAGTACAGTGG - Intergenic
1103147886 12:118611131-118611153 TGTAATCCCCAAGAGGGAAGAGG + Intergenic
1103429993 12:120875505-120875527 CGTAATCCCAACTACTCCAGAGG + Intronic
1104253415 12:127118037-127118059 TGTAATCCCAAACAAGGCAGTGG - Intergenic
1108497630 13:51040912-51040934 CTTAATCCCACAGACTGGAGGGG - Intergenic
1110304861 13:73974050-73974072 CTTAATTCCAAAGAATACAGAGG + Intronic
1110863805 13:80372770-80372792 CATAAAACCAAAGAGTTCAGTGG - Intergenic
1112919505 13:104594084-104594106 GGAAATCTCAAAGATTGCAGAGG - Intergenic
1116775155 14:49171028-49171050 CGTAATCCCAGCTACTGCAGAGG + Intergenic
1118998053 14:70855397-70855419 CTTAATCCTAAAGGTTGCAGAGG - Intergenic
1125700187 15:41675631-41675653 CGTAATCCCAACAATTTCAGAGG - Intronic
1128449966 15:67799829-67799851 GATAATACCAAAGAGTGGAGGGG - Intronic
1128685035 15:69677766-69677788 CATAATCCAAAAAACTGCAGTGG - Intergenic
1129550457 15:76443151-76443173 CATCCTCCCAAACAGTGCAGGGG + Intronic
1130874925 15:88005535-88005557 AGTTATCACACAGAGTGCAGTGG - Intronic
1134515753 16:14885628-14885650 GGTAATGTCAGAGAGTGCAGAGG + Intronic
1134703423 16:16284272-16284294 GGTAATGTCAGAGAGTGCAGAGG + Intronic
1134964120 16:18427842-18427864 GGTAATGTCAGAGAGTGCAGAGG - Intronic
1134968407 16:18510378-18510400 GGTAATGTCAGAGAGTGCAGAGG - Intronic
1135256123 16:20942780-20942802 GGTCATCACAAAGAGTGCACTGG + Intronic
1135791623 16:25401820-25401842 AGTAATCTAAAAGAGTGAAGTGG - Intergenic
1141354022 16:83326463-83326485 TGTACTCCCATAGAGTTCAGAGG - Intronic
1150348352 17:64422089-64422111 GGTATTTTCAAAGAGTGCAGTGG - Intergenic
1152398999 17:80052797-80052819 CATCATCCCAGAGTGTGCAGAGG + Intronic
1152885414 17:82846407-82846429 GGAAGTCCCAAAGAGAGCAGCGG - Intronic
1153048066 18:874516-874538 CTTAATCCTAAGGATTGCAGAGG + Intergenic
1154409212 18:14127423-14127445 TGTAACCCCCAAGAATGCAGAGG - Intronic
1156437041 18:37143074-37143096 TGTAATCCCAGCTAGTGCAGAGG - Intronic
1158937163 18:62375351-62375373 TGTAATCCCAGACAGTGCAGTGG - Intronic
930340061 2:50101284-50101306 GGTAATATCAAAGAGTGCAATGG - Intronic
930892858 2:56411433-56411455 TGTAAATCCAAAGAGAGCAGAGG + Intergenic
932866107 2:75344990-75345012 TGTAATCCCAAATAGTGATGTGG - Intergenic
933423375 2:82080258-82080280 CTTAAAACCAAAGACTGCAGAGG + Intergenic
933821625 2:86117715-86117737 TGCAATCCCAGAGATTGCAGAGG - Intronic
936398174 2:112145391-112145413 TGTAATCCCAAATACTCCAGAGG - Intronic
941816131 2:169797870-169797892 CATAATCCCCAAGTGTGGAGGGG - Intronic
942954381 2:181757423-181757445 GATAATTCCAAAGGGTGCAGAGG + Intergenic
943810928 2:192188479-192188501 GCTAATGCCAAAGAGAGCAGAGG + Intronic
948572742 2:238927693-238927715 TGTAACCCCAAGGAGAGCAGAGG + Intergenic
949063829 2:241977132-241977154 ACTCATCCCAAAGAGTGGAGCGG - Intergenic
1168850649 20:974486-974508 CTCAATGCCAGAGAGTGCAGAGG - Intronic
1174235584 20:49088165-49088187 CGTAATGCCAAAGAGTTCTGAGG - Intronic
1176864008 21:14032466-14032488 TGTAACCCCCAAGAATGCAGAGG + Intergenic
952072877 3:29660357-29660379 TGGTATCCCAAAGAGTGCAAGGG - Intronic
953322630 3:41985798-41985820 TGTAATCCCAGATAGTCCAGAGG + Intergenic
954341208 3:49955290-49955312 TGTAGTCCCAAATACTGCAGAGG - Intronic
954714611 3:52520855-52520877 CGTAATCCCAAAGAGTGCAGCGG - Exonic
956502716 3:69904142-69904164 GGAAATCCCAGAGAGTGCAAAGG - Intronic
958677681 3:97287944-97287966 AGTATTCCCAAAAATTGCAGAGG - Intronic
961944884 3:130675513-130675535 CTTAATACCAATGAATGCAGGGG - Exonic
965139045 3:164812296-164812318 TGTAATCCCAACCACTGCAGAGG + Intergenic
965603149 3:170474297-170474319 TGTGATCCCAAAGAATGAAGAGG - Intronic
968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG + Intergenic
968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG + Intergenic
971992727 4:33920934-33920956 CTTCATACCAAAGAGTGCAATGG + Intergenic
973903462 4:55501865-55501887 AATAATCCGAAAGAGTGGAGAGG - Intronic
974051782 4:56948266-56948288 CTTAATCCTAAAGGTTGCAGGGG + Intergenic
974832359 4:67205464-67205486 TGTAATCCCAGATAGTGGAGAGG - Intergenic
976629586 4:87222703-87222725 TGTAATCCCAACTATTGCAGAGG - Intronic
985916238 5:2921003-2921025 GGTCATCCCAAAGAGTGTAGTGG - Intergenic
985962791 5:3315624-3315646 GGTAATTCCAAGGAGTGCAATGG + Intergenic
986412957 5:7500372-7500394 CTTACTACCAAAGAGTACAGTGG + Intronic
990172188 5:53064799-53064821 TGTAATCCCAAAGACTCCAGAGG - Intronic
999074344 5:148780517-148780539 CAAAAGCCCAAAGACTGCAGTGG - Intergenic
999379721 5:151111826-151111848 TGGCCTCCCAAAGAGTGCAGTGG + Intronic
1002604416 5:180373765-180373787 CGAAATCCCAGAGAAGGCAGGGG + Intergenic
1005448612 6:25951844-25951866 CTTAATCCTAAGGATTGCAGTGG + Intergenic
1012491131 6:99783580-99783602 CTTAATCCCAGAAAGTGCTGTGG + Intergenic
1014200327 6:118602075-118602097 CTTAATCCTAATGATTGCAGAGG + Intronic
1021958125 7:25846866-25846888 CCTCAACCCAAGGAGTGCAGGGG + Intergenic
1023932924 7:44717476-44717498 CTTAATCCTAAAGGTTGCAGAGG + Intergenic
1026432988 7:70366808-70366830 CCTAACCCCAAAGACTGCATGGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1030037224 7:105418214-105418236 TGTAATCCCAACAAGTTCAGAGG + Intergenic
1039621905 8:39005118-39005140 CTTAATCCTAAAGATTGTAGAGG + Intronic
1047492761 8:125387993-125388015 CGTAATCCCAGCTACTGCAGAGG + Intergenic
1053631824 9:39949034-39949056 CGTAATCCCAACAATTTCAGAGG + Intergenic
1054212063 9:62301664-62301686 CGTAATCCCAACAATTTCAGAGG - Intergenic
1055401256 9:75926522-75926544 GGTAATCCCATAAAGTGCAAAGG - Intronic
1057580721 9:96285838-96285860 CTTAATCCTAAAGGTTGCAGAGG - Intronic
1059950365 9:119455910-119455932 TGTAATCCCACACATTGCAGGGG + Intergenic
1061890493 9:133616765-133616787 CTTCATCCCAAAGAGCTCAGTGG + Intergenic
1187765424 X:22636597-22636619 TGTAAGCCCAATGAGGGCAGGGG - Intergenic
1187957093 X:24530002-24530024 CAGACTCCCAAAGAATGCAGAGG - Intronic
1188981972 X:36734678-36734700 AGTAATCCGCATGAGTGCAGTGG - Intergenic
1190377682 X:49805861-49805883 CACAATGCCAAAGAGTTCAGGGG + Intergenic
1190920332 X:54845394-54845416 CATAATCCTAAAGGTTGCAGAGG + Intergenic
1198431322 X:136569596-136569618 TGTAATCCCAACTACTGCAGAGG - Intergenic
1199534283 X:148884697-148884719 CGTAATTCCCATGAGGGCAGAGG - Intronic