ID: 954714666

View in Genome Browser
Species Human (GRCh38)
Location 3:52521100-52521122
Sequence CACCCAGAGCTCCCCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 9, 3: 44, 4: 566}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954714666_954714675 30 Left 954714666 3:52521100-52521122 CCAGGGCTGGGGAGCTCTGGGTG 0: 1
1: 0
2: 9
3: 44
4: 566
Right 954714675 3:52521153-52521175 GGAGAGGCATGGCGGTAGTGTGG 0: 1
1: 0
2: 1
3: 20
4: 269
954714666_954714670 8 Left 954714666 3:52521100-52521122 CCAGGGCTGGGGAGCTCTGGGTG 0: 1
1: 0
2: 9
3: 44
4: 566
Right 954714670 3:52521131-52521153 ATTTTACTAGCGGGAGTGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 48
954714666_954714673 19 Left 954714666 3:52521100-52521122 CCAGGGCTGGGGAGCTCTGGGTG 0: 1
1: 0
2: 9
3: 44
4: 566
Right 954714673 3:52521142-52521164 GGGAGTGCTCGGGAGAGGCATGG 0: 1
1: 0
2: 3
3: 29
4: 391
954714666_954714668 -2 Left 954714666 3:52521100-52521122 CCAGGGCTGGGGAGCTCTGGGTG 0: 1
1: 0
2: 9
3: 44
4: 566
Right 954714668 3:52521121-52521143 TGGTGAGTAGATTTTACTAGCGG 0: 1
1: 0
2: 2
3: 6
4: 116
954714666_954714674 22 Left 954714666 3:52521100-52521122 CCAGGGCTGGGGAGCTCTGGGTG 0: 1
1: 0
2: 9
3: 44
4: 566
Right 954714674 3:52521145-52521167 AGTGCTCGGGAGAGGCATGGCGG 0: 1
1: 0
2: 3
3: 16
4: 353
954714666_954714669 -1 Left 954714666 3:52521100-52521122 CCAGGGCTGGGGAGCTCTGGGTG 0: 1
1: 0
2: 9
3: 44
4: 566
Right 954714669 3:52521122-52521144 GGTGAGTAGATTTTACTAGCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
954714666_954714672 14 Left 954714666 3:52521100-52521122 CCAGGGCTGGGGAGCTCTGGGTG 0: 1
1: 0
2: 9
3: 44
4: 566
Right 954714672 3:52521137-52521159 CTAGCGGGAGTGCTCGGGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 83
954714666_954714671 9 Left 954714666 3:52521100-52521122 CCAGGGCTGGGGAGCTCTGGGTG 0: 1
1: 0
2: 9
3: 44
4: 566
Right 954714671 3:52521132-52521154 TTTTACTAGCGGGAGTGCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954714666 Original CRISPR CACCCAGAGCTCCCCAGCCC TGG (reversed) Intronic
900113971 1:1020797-1020819 CAGCCTGAGCTCCCAACCCCGGG + Intronic
900146523 1:1161128-1161150 CTCCCAGAGCGGCCCTGCCCAGG + Intergenic
900218291 1:1494099-1494121 CACAGAGAGCTCCCGGGCCCGGG + Intronic
900344198 1:2203374-2203396 CACCCATGGCTGCCCTGCCCAGG + Intronic
900368721 1:2322085-2322107 CACCCGGAGAGCCCCAGCGCGGG - Intronic
900403742 1:2483569-2483591 CACCCTGCCCTGCCCAGCCCTGG + Intronic
900469886 1:2848475-2848497 AACCCAGAGCTGCCCCTCCCAGG - Intergenic
900475742 1:2875618-2875640 GACCAAGAGCACCCCAGGCCAGG - Intergenic
900503684 1:3018719-3018741 CACCGGGAGCTCAGCAGCCCAGG + Intergenic
900507537 1:3037203-3037225 CACCCACCCCTCCCCAGCACAGG + Intergenic
900522954 1:3114988-3115010 CACCCAGATGTCACCAGCCAGGG - Intronic
900563043 1:3317493-3317515 AACCCAAAGATCCCCAGACCTGG - Intronic
900612492 1:3550073-3550095 CCCCCAGCCCTCCCCATCCCGGG + Intronic
900614298 1:3557678-3557700 CACCGAGGGATGCCCAGCCCTGG + Intronic
900750998 1:4397362-4397384 CACCCCCACCTCCACAGCCCTGG + Intergenic
900797109 1:4714804-4714826 CATCCTGAGCTTCCCAGCCAAGG + Intronic
901039700 1:6356480-6356502 CACCCACACCTGGCCAGCCCTGG + Intronic
901066216 1:6495971-6495993 CACTCCCAGCTCCCAAGCCCTGG + Intronic
901227570 1:7622986-7623008 CTCCCAGAGCTCCCCACAGCTGG + Intronic
901475956 1:9489485-9489507 CATCCCCACCTCCCCAGCCCTGG + Intergenic
901882655 1:12203271-12203293 CACCCATCTCTCACCAGCCCTGG - Intronic
902864547 1:19269521-19269543 GACCCACAGATGCCCAGCCCAGG - Intergenic
902866770 1:19284956-19284978 GACCCACAGATGCCCAGCCCAGG - Intronic
902890353 1:19438820-19438842 CACCCAGTGCCCGCCGGCCCCGG - Intronic
903024532 1:20417969-20417991 GAGCCAGGCCTCCCCAGCCCTGG - Intergenic
903048995 1:20587139-20587161 CACCCAGCCCTGCCCAGGCCTGG - Intergenic
903222103 1:21874799-21874821 CCTCCACACCTCCCCAGCCCTGG - Intronic
903231947 1:21927446-21927468 GGCCCAGAGCTCCCCAGGCAAGG + Intronic
903281604 1:22253131-22253153 CACCCAGGGCACCCCCGGCCAGG - Intergenic
903578996 1:24357182-24357204 CACCCAGAGTTGCTCTGCCCAGG + Exonic
904001877 1:27343327-27343349 CACACAGTTCTCCCCAGACCAGG - Intronic
904164600 1:28545747-28545769 CACCCACTGCACTCCAGCCCGGG - Intergenic
904248190 1:29203162-29203184 CATCCAGATCGCCGCAGCCCTGG - Exonic
904354071 1:29927072-29927094 CCCCCAGCACTGCCCAGCCCTGG - Intergenic
904481714 1:30798003-30798025 CCTCCAGGGCTCCCCAGTCCTGG - Intergenic
905309963 1:37042497-37042519 CTCCCAGAGCTACCCAGAACTGG + Intergenic
905907046 1:41626177-41626199 CACCCCGCCCTCCCCAGCACCGG + Intronic
906145678 1:43558741-43558763 CCCCCAGGGCTCCCCCTCCCTGG - Intronic
906209755 1:44006015-44006037 CTGCCAGAGATTCCCAGCCCTGG - Intronic
906728058 1:48058362-48058384 CCCCCACAGCTACACAGCCCTGG - Intergenic
907046312 1:51302314-51302336 CCCCGAGGGATCCCCAGCCCCGG + Intronic
907284030 1:53368920-53368942 TAAGCAGAGCTCCCCAGTCCAGG + Intergenic
907551446 1:55308473-55308495 CCCTCAGAGCTGCCCAGCCCAGG - Intergenic
908360829 1:63367438-63367460 ACCCGAGAGGTCCCCAGCCCCGG - Intergenic
909283936 1:73790893-73790915 TTTCTAGAGCTCCCCAGCCCTGG + Intergenic
909746877 1:79108439-79108461 TACCCAGAGATCCCCACACCTGG + Intergenic
910288299 1:85577516-85577538 CACCCTGAGCACCACTGCCCTGG - Intronic
911149042 1:94579764-94579786 CACCCCAGGCTCCCCATCCCAGG + Intergenic
911468449 1:98284921-98284943 CTCCCCCAGCCCCCCAGCCCCGG + Intergenic
912436762 1:109667858-109667880 CAACCAGTTCTCCCCCGCCCTGG + Intronic
912628878 1:111229362-111229384 GACCTTGAGGTCCCCAGCCCTGG - Intronic
912629289 1:111233233-111233255 AACGCAGATCTCCCCACCCCCGG - Intronic
915314103 1:155018331-155018353 GCCCCAGGTCTCCCCAGCCCTGG - Exonic
915321284 1:155057751-155057773 CACCCGGAGCTCACCTGCCGGGG + Intronic
915579508 1:156805015-156805037 CCTCCAGAGCTGCCCAGGCCTGG - Intergenic
915895656 1:159809125-159809147 CACCCAGAACTCTGCATCCCGGG + Exonic
915920627 1:159973095-159973117 CACCCAGAACTCTGCATCCCAGG - Intergenic
916128745 1:161593275-161593297 CACCCCCAGCTCCCCTGCTCAGG - Intronic
916202353 1:162284026-162284048 CCTCCAGAGCTCACCTGCCCAGG + Intronic
916248110 1:162708596-162708618 CACTCAGTTCTCCTCAGCCCAGG + Intronic
916458455 1:164995686-164995708 CACCCACAGTGCACCAGCCCTGG - Intergenic
916496591 1:165353362-165353384 CCCCCAGCGCCCCCCACCCCAGG + Intronic
918078651 1:181189696-181189718 CACCCACAGCGCCACAGCTCTGG - Intergenic
920295892 1:204956137-204956159 CACTGACATCTCCCCAGCCCCGG + Intronic
920387753 1:205580492-205580514 CACCCATGGCTCCCCATTCCAGG + Intronic
920395790 1:205644930-205644952 CAACCTCAGCTCCCCACCCCAGG - Intergenic
921287799 1:213624612-213624634 GAGGCAGAGTTCCCCAGCCCAGG - Intergenic
922720358 1:227897062-227897084 CACCCAGAGTCCCCCAGCACTGG + Intergenic
922758478 1:228109600-228109622 CTCCCTCAGCTCCCCACCCCGGG - Intergenic
922816274 1:228452111-228452133 CCCCCAGTCATCCCCAGCCCAGG - Intergenic
1063116519 10:3075606-3075628 CACCCAGAGTCCCCCACTCCCGG - Intronic
1063368522 10:5506552-5506574 CAACCAGAGCTCCTAAGCCGAGG - Intergenic
1063369468 10:5511779-5511801 CACCCTGAGGTCCTCAGGCCAGG + Intergenic
1065170936 10:23028099-23028121 CAGCCAGTGCACCCCAGCCTGGG + Intronic
1065662389 10:28019512-28019534 CACCCAATGCACCCCAGCCTGGG - Intergenic
1065694591 10:28368415-28368437 CCCAAAGAGCTCCCCAGACCTGG + Intergenic
1065783462 10:29191676-29191698 GAGCCACAGCTTCCCAGCCCTGG + Intergenic
1065831799 10:29621356-29621378 CGCACAGAGCTCTCCAGCCTCGG - Intronic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1065965558 10:30767804-30767826 TACACAAAGGTCCCCAGCCCCGG + Intergenic
1067101155 10:43335714-43335736 CACCCAGAGGTCCCTTTCCCAGG - Intergenic
1067448900 10:46369210-46369232 GCCCCAGATCCCCCCAGCCCAGG - Intronic
1067464945 10:46490868-46490890 CAGGCAGAGCCCTCCAGCCCAGG + Intergenic
1067588473 10:47491555-47491577 GCCCCAGATCCCCCCAGCCCAGG + Intronic
1067622244 10:47893733-47893755 CAGGCAGAGCCCTCCAGCCCAGG - Intergenic
1067635599 10:47999646-47999668 GCCCCAGATCCCCCCAGCCCAGG + Intergenic
1067877924 10:50020749-50020771 GCCCCAGATCCCCCCAGCCCAGG - Intergenic
1068637411 10:59362749-59362771 GACCCCGACCTCGCCAGCCCAGG + Intronic
1069097569 10:64278156-64278178 CACCCAGTGCACTCCAGCCTGGG - Intergenic
1069424670 10:68279013-68279035 CGCCCAGCGCTCTCCAGCCGGGG + Intergenic
1069624956 10:69861876-69861898 CCCCCAGACCTTTCCAGCCCAGG - Intronic
1069641949 10:69961977-69961999 CAACCACAACTCCCCAGCCTTGG - Intronic
1069759309 10:70797857-70797879 CCCCCTGAGCTCTCCATCCCAGG + Intergenic
1069878548 10:71577822-71577844 CACCCACAGCTTCCCTCCCCAGG - Intronic
1069934243 10:71904495-71904517 CTCCCCAGGCTCCCCAGCCCTGG + Intergenic
1070132157 10:73663653-73663675 GCCCCAGATCCCCCCAGCCCAGG + Intronic
1071336538 10:84605105-84605127 CTCCAAGTGCTCCCCAACCCAGG + Intergenic
1071559383 10:86633163-86633185 TACTCAGAGATCCCCAGGCCTGG + Intergenic
1071609524 10:87020422-87020444 GCCCCAGATCCCCCCAGCCCAGG - Intronic
1071757514 10:88560447-88560469 TACCCTGAGCCCCACAGCCCAGG + Intronic
1072617714 10:97060456-97060478 CCTCCAGAGTTTCCCAGCCCTGG + Intronic
1073755083 10:106572778-106572800 TACCCAGATCTCTCCAGCACAGG + Intergenic
1074184493 10:111088792-111088814 CACCCAGCCCACCTCAGCCCAGG - Intergenic
1074288928 10:112123862-112123884 GTCCCAGAGCTCCCCATCCAAGG + Intergenic
1074424073 10:113335761-113335783 CACCCTGGTCTCCCCAGCCAAGG - Intergenic
1074688686 10:115982844-115982866 CCCCCACAGCCACCCAGCCCTGG - Intergenic
1075198732 10:120383438-120383460 CACCAAAGGCTCCCCAGGCCTGG - Intergenic
1075844798 10:125536483-125536505 CACGCAGGGCACTCCAGCCCGGG + Intergenic
1076453653 10:130574649-130574671 CAGCCAGATCTCCCCCGTCCAGG + Intergenic
1076519585 10:131073364-131073386 CTCCTAGACATCCCCAGCCCAGG - Intergenic
1076679660 10:132165192-132165214 CAGACAGCCCTCCCCAGCCCTGG - Intronic
1076703906 10:132290851-132290873 CACCCAGACCCACCAAGCCCAGG + Intronic
1076747089 10:132519944-132519966 CACCCAGGGGACGCCAGCCCCGG + Intergenic
1076839883 10:133040671-133040693 CACCCACAGCCCCCCGCCCCCGG - Intergenic
1077046734 11:550013-550035 AGCCCAGGCCTCCCCAGCCCAGG - Intronic
1077287375 11:1773542-1773564 CACCCAGGCCTGTCCAGCCCTGG - Intergenic
1077339078 11:2018042-2018064 TTCACAGAGCTCCCCCGCCCAGG - Intergenic
1077437560 11:2550131-2550153 GAACCAGAGCTGCCGAGCCCCGG + Intronic
1077443414 11:2579106-2579128 CTCCCAGAGCTCACTGGCCCCGG - Intronic
1077465925 11:2733636-2733658 CCCCCAGGGCTGCCCAGGCCTGG - Intronic
1077799965 11:5527555-5527577 CACACTGCTCTCCCCAGCCCTGG - Intronic
1077886670 11:6392108-6392130 CAGCCAGGGCTCCCAAGCCTTGG - Exonic
1078025175 11:7688236-7688258 CTCCCAGACCACCCCATCCCAGG + Intergenic
1080581286 11:33645969-33645991 CACCCACTGCACCCCGGCCCTGG - Exonic
1081443903 11:43110948-43110970 CACCCAGCTCTCCCTTGCCCAGG + Intergenic
1081455969 11:43223202-43223224 CACTCAAACCTCCCCAGCCATGG + Intergenic
1081535278 11:43991824-43991846 CCCCCAAAGCCCACCAGCCCAGG + Intergenic
1081536898 11:44002896-44002918 CATCCAGACCCCTCCAGCCCTGG - Intergenic
1081773995 11:45665496-45665518 GACCCGGAGCGCCGCAGCCCCGG + Exonic
1081848040 11:46254462-46254484 CACCCAGGTCTCCCCCGTCCTGG + Intergenic
1081873389 11:46393039-46393061 CACCAAGAGCCCCGCAGCGCTGG - Intergenic
1081979026 11:47254727-47254749 CACACTCTGCTCCCCAGCCCCGG + Intronic
1082732259 11:56814342-56814364 CACCCAGAGATCTCCAGCACTGG + Intergenic
1082835561 11:57648143-57648165 CACACAGCCCTGCCCAGCCCAGG - Exonic
1083272732 11:61580430-61580452 CACCCGAGGCTCCCCAGCACCGG - Intronic
1083299677 11:61733838-61733860 CCCCCAGCACTCCCCATCCCAGG - Intronic
1083592487 11:63903877-63903899 CTGCCAGAGCTCCCCAGCTCTGG + Intronic
1083780578 11:64915380-64915402 CACCCAGAGACCCACAGCTCGGG + Intronic
1084218755 11:67665387-67665409 CCCCCAGAGCTCCCCAAACCTGG - Exonic
1084269559 11:68021747-68021769 CCCCCAGAGCTCCCCAAACCTGG + Exonic
1084708258 11:70828685-70828707 CTCCCAGCGCTCGCCAGCCAGGG - Intronic
1084978006 11:72813989-72814011 GACCCAGAGGCCCTCAGCCCCGG - Intergenic
1085040562 11:73324109-73324131 CCCCCTCAGCTTCCCAGCCCAGG + Intronic
1085309451 11:75507479-75507501 CAGCCAGTGCCCCCCAGCCTGGG - Intronic
1085323340 11:75588279-75588301 CAGCAAGAGCTGCCCGGCCCAGG - Intronic
1085426901 11:76412759-76412781 CAGCCATACCTCCCCAGCCAGGG + Intronic
1085478584 11:76804035-76804057 CAACCAGCGCATCCCAGCCCTGG + Intergenic
1085510772 11:77087010-77087032 CACGCAGAGCTGCCCTGCCCTGG + Intronic
1085510962 11:77088008-77088030 CACCCTGAGCTCCCAGGCCTGGG - Intronic
1085519034 11:77127416-77127438 CACCCAGAGCTGCCCTGGCGAGG + Intergenic
1088747238 11:112814366-112814388 CACATAAACCTCCCCAGCCCTGG - Intergenic
1088893147 11:114059941-114059963 CCCCCAGACCTCTCCAGCCCCGG - Intronic
1089214473 11:116827432-116827454 CACCAAGAGATCCCCTGCCGGGG + Intergenic
1089282023 11:117381381-117381403 TCCCCAGAGCTCACCAGCACTGG - Intronic
1089366831 11:117925826-117925848 CCCACCCAGCTCCCCAGCCCAGG + Intronic
1089496369 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG + Exonic
1090064048 11:123488381-123488403 CCCCCGGAGCTCTCCAGGCCGGG + Intergenic
1090345307 11:126064183-126064205 CAACAAGAGCACCCCAGCCTGGG - Intergenic
1090424167 11:126595395-126595417 CACACAGAGCCCCCCAATCCTGG - Intronic
1091041458 11:132285090-132285112 CACTCAGACCTTCCCAGCCTAGG + Intronic
1202822062 11_KI270721v1_random:73224-73246 TTCACAGAGCTCCCCCGCCCAGG - Intergenic
1092162526 12:6323941-6323963 CTCCCAGAACTCCCCAGTGCCGG - Intronic
1092182850 12:6457936-6457958 CACCAAGAGATTTCCAGCCCAGG + Intronic
1093648598 12:21617652-21617674 CACCCACAGCACGCCAGCCTGGG - Intergenic
1095727573 12:45470078-45470100 ACCACAGATCTCCCCAGCCCCGG + Intergenic
1096173980 12:49499356-49499378 TCCCCAGAGCTCACCAGGCCAGG - Intronic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1096365831 12:51027412-51027434 CACCAAGAGCACCCCACACCTGG + Intronic
1096783282 12:54003065-54003087 CACGCAGAGCGCCCCAGGCCCGG - Exonic
1096807841 12:54151180-54151202 CATCCAGAACTACTCAGCCCAGG - Intergenic
1097182637 12:57179970-57179992 CACCCCATGCTCCCCGGCCCTGG - Intronic
1097246706 12:57611247-57611269 CAGCCCGTGCTCCCCTGCCCCGG - Intronic
1097955268 12:65478912-65478934 CAACCAGAGCTCCCCAGCTCAGG + Intronic
1099524824 12:83706087-83706109 CACCCATAGCCACCCACCCCAGG - Intergenic
1102075124 12:110053541-110053563 CTCCCAGTGGTCCTCAGCCCTGG - Intronic
1102191106 12:110988912-110988934 TGCCCGGAGCTCCCCATCCCAGG - Intergenic
1102481627 12:113227745-113227767 CTCCCAGTGCTCCCCAGTCAGGG + Intronic
1102820524 12:115905478-115905500 CACCCAGTGCGCTCCAGCCTGGG - Intergenic
1103370252 12:120414042-120414064 GAGCCAGCGCTCCCCAGCCTGGG + Intergenic
1103613405 12:122137686-122137708 CAGCCAGAGCTGCCCAGGCAGGG + Intronic
1104153703 12:126109926-126109948 CTTCCAGAGGTCCCCAGTCCTGG - Intergenic
1104221108 12:126785906-126785928 CACCCAGTGCCTCCCAGGCCAGG - Intergenic
1104727203 12:131085392-131085414 CACCCTGAGCTCCAAGGCCCTGG + Intronic
1104744864 12:131204344-131204366 AGCCCAGAGCTGCCCTGCCCAGG + Intergenic
1104773987 12:131381773-131381795 AGCCCAGAGGTTCCCAGCCCAGG + Intergenic
1104800953 12:131554995-131555017 AGCCCAGAGCTCCCCAGGCAAGG + Intergenic
1104840790 12:131824372-131824394 AAGCCAGAGGTGCCCAGCCCTGG - Intergenic
1104906279 12:132215131-132215153 CACCCAGAGCTGCGGAGACCCGG - Intronic
1105785165 13:23740962-23740984 CACCCAGACCTCCCCTCTCCTGG - Intronic
1105821844 13:24087178-24087200 CTCCCAGAGCCTGCCAGCCCAGG + Intronic
1107065913 13:36214373-36214395 CAATGAGAGCTCCCCAGGCCGGG + Intronic
1107128021 13:36865400-36865422 ATCTCAGAGCTCACCAGCCCTGG + Intronic
1107740446 13:43444919-43444941 AACCCAGGTCTCCCTAGCCCAGG - Intronic
1108313571 13:49218206-49218228 CACCAAGAGCACCACAACCCTGG - Intergenic
1108527292 13:51296726-51296748 CCCCCAGAGTTCCCTTGCCCAGG - Intergenic
1111368218 13:87279019-87279041 CAGCCAGTGCTCTCCAGCCTGGG - Intergenic
1111572403 13:90104971-90104993 CACACAGAGTTCCCCACCCATGG - Intergenic
1113675197 13:112202239-112202261 CATCCAGAGCTCCTGAGCACTGG - Intergenic
1113741887 13:112716741-112716763 CACGCAGAGCCCCCAAGTCCAGG - Intronic
1113896259 13:113766279-113766301 CACCCTGCCCTCCCCGGCCCAGG - Intronic
1113932442 13:113975495-113975517 CACCCGGGGCTCCTCAGCCAGGG + Intergenic
1113950081 13:114066870-114066892 GCCCCAGAGCACCCCAGGCCAGG - Intronic
1114494112 14:23120830-23120852 CACGCAGATCTCCCCACACCAGG - Intergenic
1114669728 14:24402869-24402891 CACACAGAGGTTCCCTGCCCCGG + Intronic
1117537815 14:56718717-56718739 AGCCCAGTGGTCCCCAGCCCTGG + Intronic
1117567509 14:57010077-57010099 CACCCCTAGCTGCCCAGCCAAGG + Intergenic
1119135448 14:72214216-72214238 CACCCACTGCTCTCCAGCCTGGG - Intronic
1119333011 14:73809562-73809584 AGCCCAGCGCTCCCCAGCCGCGG + Intergenic
1119405327 14:74395229-74395251 GCCTCAGAGCTCCCCAGCCAGGG - Intergenic
1121012922 14:90532700-90532722 GACCACCAGCTCCCCAGCCCAGG + Exonic
1122129615 14:99597520-99597542 GACACAGCGCTCCCCAGCCCTGG + Intronic
1122578928 14:102759255-102759277 CACCCAGAGATCCCACTCCCGGG - Intergenic
1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG + Intergenic
1122649960 14:103220768-103220790 CGCGCAGAGCTCCCCAAGCCTGG - Intergenic
1122718517 14:103709117-103709139 CTCCCAGCGCTCCCCTCCCCAGG - Intronic
1122813929 14:104303101-104303123 CACTGAGAGCTCCCCAGCCCAGG - Intergenic
1122882928 14:104698091-104698113 TCCTCAGAGCTCCCCAGCCCCGG - Intronic
1123004988 14:105316762-105316784 CACTTAGTGCTACCCAGCCCAGG - Intronic
1123017344 14:105381739-105381761 CACAGAGAGGTCACCAGCCCTGG - Intronic
1123033819 14:105463691-105463713 CAGCCAGAACCCCCCAGCCCTGG - Intronic
1123702771 15:22928070-22928092 CACCCAGCTCCCCCCATCCCGGG + Intronic
1127949409 15:63789757-63789779 CACCCAGGTCTCTCCAGCCTGGG + Intronic
1128264015 15:66252579-66252601 TGCCCAGAGCCCCCGAGCCCGGG - Intronic
1128527705 15:68423734-68423756 CTCCCTGAGGTCCCCAGCTCAGG - Intronic
1128759019 15:70202703-70202725 CAGCCAGAGCTGCCCAGAACAGG - Intergenic
1128766163 15:70252449-70252471 GCCCCAGAGCTCCCCTGCCGTGG - Intergenic
1129239735 15:74244326-74244348 CACCCTGTCTTCCCCAGCCCTGG - Intronic
1129243911 15:74268462-74268484 ACCCCAGAGGGCCCCAGCCCTGG - Intronic
1130696885 15:86140025-86140047 CACCCAGTGCTACCCAGACAGGG - Intergenic
1130931031 15:88428196-88428218 CATCCAGGGCTGCCCGGCCCCGG - Intergenic
1131467353 15:92666429-92666451 CATCCAGAGTTCCCCTGCCTAGG - Intronic
1132408928 15:101562059-101562081 CACACAGAGCCCTCCAGACCAGG + Intergenic
1132420003 15:101657345-101657367 AGCCCCGAGCTCCGCAGCCCTGG + Intronic
1132481111 16:166512-166534 CCCCCAGAGCCCCCCCACCCCGG - Intronic
1132498331 16:274157-274179 CACCCTGAGGCCCCCAGTCCTGG + Intronic
1132616163 16:842078-842100 AGCCCAGAGTTCCCCAGCCCAGG - Intergenic
1133102237 16:3486467-3486489 CCTCCAGAGCTGCCCAGCCACGG + Exonic
1133378415 16:5308932-5308954 GACCTAGAACTCCCAAGCCCAGG - Intergenic
1134047892 16:11114687-11114709 CCCCCAGGGCTCCACAGCCAGGG + Intronic
1134229160 16:12415787-12415809 CTCCCTGTGCTCCCCAACCCAGG + Intronic
1134317003 16:13127811-13127833 GAGCCAGAGCTCCCAAGCACAGG + Intronic
1134390061 16:13811268-13811290 CACCCACAGCACTCCAGCCTGGG + Intergenic
1135323798 16:21513341-21513363 CACCCACAGCCCCCCGACCCTGG + Intergenic
1136003687 16:27314241-27314263 CACCCAGCGCTCCCCAAAGCCGG + Intronic
1136335281 16:29606606-29606628 CACCCACAGCCCCCCGACCCTGG + Intergenic
1136418412 16:30117262-30117284 CATCCTGGGCTCCCCATCCCAGG - Exonic
1137019094 16:35405925-35405947 CACACAGAGGTCCCCAGAGCTGG + Intergenic
1137446364 16:48534891-48534913 AACCCCCACCTCCCCAGCCCAGG - Intergenic
1137672050 16:50284710-50284732 AAACCAGGGCTCCTCAGCCCAGG - Intronic
1139371832 16:66473804-66473826 CACTCACAGCCCCCCAGCTCTGG + Intronic
1139430932 16:66910742-66910764 CTCCCGGGGCTCCCCACCCCAGG + Intronic
1140213559 16:72989721-72989743 CACACAGAGTTCTACAGCCCAGG + Intronic
1140403667 16:74692955-74692977 TCCCCAGAGCTCCTCAGTCCTGG - Intronic
1141177520 16:81730622-81730644 CTCACAGAGCCTCCCAGCCCGGG - Intergenic
1141424563 16:83936545-83936567 CCCCCAGAGCTCCACACCCTCGG + Intronic
1141652563 16:85401424-85401446 CATCCAGAGCCCCCGAGCTCCGG - Intergenic
1142036006 16:87862448-87862470 CACCCATAGCCCCCCGACCCTGG + Intronic
1142129991 16:88428073-88428095 CACCCCCAGGCCCCCAGCCCCGG + Exonic
1142169203 16:88611688-88611710 AACCCAGAGCTCTCCAACGCAGG + Intronic
1142684715 17:1571242-1571264 CACCCTGACCACCCCACCCCAGG + Intronic
1142908138 17:3062487-3062509 CTCCCAGACCTCACCAGCCTTGG - Intergenic
1142926426 17:3241774-3241796 CTCCCAGACCTCACCAGCCTTGG + Intergenic
1143526691 17:7477361-7477383 ACGCCAGAGCTCCTCAGCCCTGG + Intronic
1143574060 17:7779450-7779472 CACCCAGTTCTTCCCACCCCAGG - Intronic
1143590896 17:7885347-7885369 CGCCCAGCGCTCTCCAGCCGGGG - Intronic
1144621865 17:16823177-16823199 CAGGCAGCTCTCCCCAGCCCTGG + Intergenic
1144704039 17:17355746-17355768 TATCCAGAGCTGCCCAGGCCTGG + Intergenic
1144830477 17:18128353-18128375 GACCCAGACTTCCCCAACCCTGG + Intronic
1144884559 17:18449537-18449559 CAGGCAGCTCTCCCCAGCCCCGG - Intergenic
1145193358 17:20866995-20867017 CAGCCAGCGCTCCCCACCCAAGG + Intronic
1145280964 17:21466726-21466748 CGCCCAGCGCTCCACAGGCCTGG + Intergenic
1145396949 17:22503839-22503861 CGCCCAGAACTCCACAGGCCTGG - Intergenic
1145760315 17:27421824-27421846 CACCCAGAGGACCGCAGGCCTGG + Intergenic
1145798742 17:27670516-27670538 CACCCAGAGGACCACAGGCCTGG - Intergenic
1145908740 17:28530673-28530695 CACCCCAAGCCCCCCACCCCTGG - Intronic
1145942079 17:28747836-28747858 CCCCCAGATCTACCCAGACCCGG + Exonic
1146257052 17:31397687-31397709 CCCCAAGGGATCCCCAGCCCTGG - Intronic
1146397531 17:32480653-32480675 AAGACAGAGCTGCCCAGCCCTGG - Intronic
1146788763 17:35739739-35739761 CATGGAGAGCTCACCAGCCCAGG + Intronic
1146793459 17:35765749-35765771 CACACACAGCTGCCTAGCCCTGG + Intronic
1147342523 17:39762233-39762255 CACCCTCACCTCCCCAGCCCTGG + Intergenic
1147927056 17:43952780-43952802 CACACACAGCCCTCCAGCCCAGG + Exonic
1148180284 17:45600513-45600535 GAGCCAGAGCACCCGAGCCCTGG + Intergenic
1148268616 17:46245381-46245403 GAGCCAGAGCACCCGAGCCCTGG - Intergenic
1148688700 17:49514580-49514602 CAACCACCGCTCCCCAGCCCAGG + Exonic
1148792826 17:50183330-50183352 TCCCCAGACCACCCCAGCCCAGG + Exonic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1149660402 17:58331680-58331702 CAGCCACAGCTCCCCTGCCAAGG + Intergenic
1149995083 17:61402060-61402082 CCCCCAGAGTGCCCCTGCCCGGG + Intronic
1150289235 17:63972100-63972122 CTCCCTGAGCTCCCCAGCCCTGG - Intronic
1151453038 17:74211060-74211082 CATGCAGTGCTTCCCAGCCCTGG + Intergenic
1151714278 17:75823528-75823550 CACCCAGTGCTCCCCGACCTGGG - Intronic
1151953613 17:77369583-77369605 CTCCCAGAGCTGCCGAGCCCTGG - Intronic
1152029387 17:77832291-77832313 AGCCCAGGGGTCCCCAGCCCCGG + Intergenic
1152206671 17:78977924-78977946 GACCCGGACCTCCCCAGTCCTGG - Intronic
1152287765 17:79422480-79422502 CACCCAGGGCTTCCCGGCCCAGG + Intronic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152314733 17:79573541-79573563 CACCCTGACTTCCCCAGCACGGG + Intergenic
1152540484 17:80972015-80972037 CACCAACTGCTCCCCAGTCCTGG + Intergenic
1152584903 17:81184643-81184665 CTCTCAGAGCTCCCCTGCTCTGG - Intergenic
1152637158 17:81434916-81434938 CACCCAGGGTGCACCAGCCCTGG - Intronic
1153149092 18:2069863-2069885 CACACACATCTCCCCAGCCCTGG + Intergenic
1154304253 18:13218633-13218655 CACCGCGCGCTCCCCGGCCCCGG + Intronic
1157342578 18:46792320-46792342 AACCCAGTGATTCCCAGCCCTGG - Intergenic
1157500780 18:48189130-48189152 TAACCATAGCTCCCCTGCCCAGG + Intronic
1157701924 18:49766741-49766763 CACACGGATCTGCCCAGCCCTGG - Intergenic
1160100435 18:75915949-75915971 CCCCCAGAGGACCCCGGCCCAGG + Intergenic
1160163427 18:76491843-76491865 CTCCCAGGGCTGCCCAGTCCCGG + Intronic
1160168385 18:76532402-76532424 TGCCCAGAACTCCCCTGCCCAGG - Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160303601 18:77709311-77709333 CTCCCGGGACTCCCCAGCCCTGG - Intergenic
1160306752 18:77747323-77747345 CACCCAGAGCTCACCACCCTTGG + Intergenic
1160703251 19:518098-518120 CTCCCAGCACCCCCCAGCCCGGG - Intronic
1160803150 19:979768-979790 CCCCCAGCTCTCCCCAGCCAGGG + Intergenic
1160859595 19:1232062-1232084 CCCCCAGCGCTCTCCAGACCAGG - Intronic
1161021435 19:2013418-2013440 AACCCAGAGACCCCCAGCTCCGG - Intronic
1161703397 19:5806499-5806521 CACCCAGGCTTCCTCAGCCCGGG - Intergenic
1161962235 19:7529270-7529292 CACGCAGCCCTCACCAGCCCCGG + Intronic
1162031240 19:7918090-7918112 CGCCCAGCGGTCCCCAGCCCAGG + Exonic
1162442478 19:10701543-10701565 CAGCCACAGCTCGCCTGCCCGGG - Exonic
1162497375 19:11030814-11030836 CAGGCCGAGCCCCCCAGCCCGGG - Exonic
1162514350 19:11139032-11139054 GCCCCAGAGCAGCCCAGCCCAGG - Intronic
1162673962 19:12284441-12284463 CTCTCAGAGCTCCGCGGCCCCGG - Intronic
1162758532 19:12874578-12874600 CACCCAGCGCTCCCGGCCCCGGG - Exonic
1162818614 19:13210057-13210079 CACCCAGAGCTCCCTAGCTTGGG - Intronic
1162860892 19:13505520-13505542 CCCCCATAGTTCCCCTGCCCTGG + Intronic
1163451439 19:17379557-17379579 CACCCAGAGCCCCCCAGAGCTGG + Intergenic
1163797489 19:19345889-19345911 CTCACGGAGCGCCCCAGCCCAGG + Intronic
1164787042 19:30941756-30941778 CATCCAGGTTTCCCCAGCCCAGG + Intergenic
1165365668 19:35363345-35363367 CCCCCAGACCACCCCTGCCCAGG + Intergenic
1165410638 19:35658712-35658734 TACCCAGTGATCCCCACCCCAGG + Exonic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1165879433 19:39032044-39032066 CCACCAGGGCTCGCCAGCCCCGG + Exonic
1166130884 19:40744834-40744856 CACCCCCAGCCCTCCAGCCCTGG - Intronic
1166784961 19:45362262-45362284 CACCCAGAACCCCCCAGTCATGG + Intronic
1167299921 19:48672399-48672421 GCCCCAGAGATGCCCAGCCCAGG - Intronic
1168045762 19:53793157-53793179 CACCCAGCCCTGCCAAGCCCTGG - Intergenic
1168069685 19:53942651-53942673 TCCCCAGAGCTCCCCAACCTCGG + Exonic
1168714337 19:58518320-58518342 CACCCAGAACCACCCTGCCCAGG - Intronic
926142064 2:10373730-10373752 CCCCCACAGCAGCCCAGCCCAGG + Intronic
926277091 2:11412405-11412427 CACCCAGAACTCCAGTGCCCAGG + Intergenic
926633379 2:15157535-15157557 CACCCAGAATTCCCCTCCCCGGG + Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
927104474 2:19811500-19811522 CACCAAGAGCACCCCACACCAGG + Intergenic
927466509 2:23340691-23340713 AACCCAGAGATCCCCTCCCCAGG + Intergenic
927516561 2:23675075-23675097 CACCCAAGTCTCCCAAGCCCTGG + Intronic
927553251 2:24016719-24016741 CACCCAGGGCGCCCCAGCCTAGG + Intronic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
928433490 2:31239134-31239156 CACCCTGACATCCCCACCCCAGG + Intronic
929000625 2:37344524-37344546 CACCCAGGGCCGCCCAGCCCCGG + Intergenic
931143082 2:59485136-59485158 CACCCAAAGCCCCCTACCCCAGG + Intergenic
931649482 2:64454768-64454790 AGCCCAGAGCCCCGCAGCCCGGG - Intronic
931835494 2:66094677-66094699 CTCCCCCAGCTCCCCACCCCAGG + Intergenic
932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG + Intronic
932573387 2:72950021-72950043 TGCCCAGAGCTCCAGAGCCCTGG - Intronic
932780560 2:74556104-74556126 CTCCCACAGCTGCCCAACCCAGG - Intronic
933547230 2:83729889-83729911 AACCCAGATATCCCCATCCCTGG - Intergenic
933765687 2:85707029-85707051 CACTCAGATCTCCCCGACCCAGG - Intergenic
934613169 2:95755402-95755424 CACCCAGAGAGACCCAGCCAGGG - Intergenic
934647726 2:96069021-96069043 CACCCAGAGAGACCCAGCCAGGG + Intergenic
934841100 2:97624842-97624864 CACCCAGAGAGACCCAGCCAGGG + Intergenic
934851061 2:97701512-97701534 CACCCAGGGATCCCCAAACCCGG - Intergenic
935061113 2:99608615-99608637 GACCCTCAGCTCCCCAGCCGAGG + Intronic
936106227 2:109626854-109626876 CAACAAGGGCTCCCCTGCCCAGG - Intergenic
936455270 2:112668307-112668329 CCCCCAGAGCACTCCAGCCTGGG - Intergenic
937281805 2:120722423-120722445 CACCCAGAGCCCCTCACCCGGGG - Intergenic
937348541 2:121143663-121143685 CACCCAGCACGCCCCAGCCTCGG - Intergenic
938249445 2:129802766-129802788 CACCCCCAGCTCCAGAGCCCTGG + Intergenic
940214386 2:151289523-151289545 CACCCCCGGCTCTCCAGCCCGGG + Intronic
940869123 2:158845072-158845094 CACCCAGAGGTCCTCAGTCATGG - Intronic
940894903 2:159072021-159072043 CACCCACTGCACTCCAGCCCAGG - Intronic
941365685 2:164608326-164608348 CACCCACTGCACCCCAGCCTGGG + Intronic
942189050 2:173453249-173453271 CTGCCCCAGCTCCCCAGCCCTGG - Intergenic
946027218 2:216679139-216679161 CACCCCAAACTGCCCAGCCCTGG - Intronic
946404093 2:219483619-219483641 CACCCAGGCCTCCCCGGGCCAGG - Exonic
947476072 2:230448767-230448789 TCCCCAGAGCTACCCTGCCCAGG - Intronic
947489593 2:230582127-230582149 TTCCCAGAGCTACCCTGCCCAGG + Intergenic
947707689 2:232289807-232289829 CTCCCACAGCTACACAGCCCTGG - Intronic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
948158211 2:235801589-235801611 AACCCAAAGCCCCCCAGCCTGGG - Intronic
948386909 2:237586122-237586144 CACACAGGACCCCCCAGCCCAGG - Exonic
948454191 2:238097146-238097168 GCCCCAGCCCTCCCCAGCCCCGG - Intronic
948464783 2:238147304-238147326 CACCCAGGGCTCCCGAGCCCAGG + Intronic
948588416 2:239035394-239035416 CACCCAGTGCCCGCCAGCCCTGG - Intergenic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
1169075160 20:2755769-2755791 CCCCCCAAGCTCCCCACCCCAGG + Exonic
1169331579 20:4720817-4720839 CACCCAGAGCCCAGAAGCCCGGG + Intergenic
1172313466 20:33935392-33935414 GACCCCCTGCTCCCCAGCCCTGG + Intergenic
1172634299 20:36399537-36399559 CACCCATAGCTCCCCAGTGCTGG - Intronic
1172692151 20:36797364-36797386 CACCTTGGGCTCCTCAGCCCTGG - Intronic
1172801213 20:37577510-37577532 CACCCCAAGCACCCCAGCCTGGG - Intergenic
1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG + Intronic
1173251430 20:41366091-41366113 CACGCGGGGCTCCCCCGCCCCGG - Intronic
1174114306 20:48216349-48216371 CACCCACAGCCCCAAAGCCCAGG - Intergenic
1174365327 20:50053205-50053227 CTCCAAATGCTCCCCAGCCCCGG + Intergenic
1174564924 20:51457737-51457759 ACCCCAGACCTGCCCAGCCCAGG + Intronic
1175227140 20:57451258-57451280 CACCCGCAGCTAGCCAGCCCCGG + Intergenic
1175415920 20:58800920-58800942 CAGCAAGACCTCCCCAGGCCAGG + Intergenic
1175952233 20:62589552-62589574 CCCCCGGACCTCCCCAGGCCAGG - Intergenic
1175959253 20:62626684-62626706 CACCCAGAGGGCACCAGCCTTGG + Intergenic
1176054917 20:63140059-63140081 CAAACAGAGCTGCCCCGCCCCGG - Intergenic
1176216733 20:63951626-63951648 CACCCAGGGCTCACCACCCAGGG + Intronic
1176299887 21:5094631-5094653 CCCCCAGAGCCCCCCAGGCTTGG - Intergenic
1178439113 21:32584237-32584259 CACCCAGAGGACCCGTGCCCAGG - Exonic
1178486051 21:33020748-33020770 CATCCAGAGCTCCCCCACGCAGG - Intergenic
1179005846 21:37513318-37513340 CACTCAGACCTCCCCAGGACTGG - Intronic
1179150877 21:38806693-38806715 GACCGAGGGGTCCCCAGCCCGGG - Intronic
1179187571 21:39096693-39096715 CACCCAGGTCTCACCAGCCAGGG + Intergenic
1179722603 21:43324152-43324174 CACCCTCAGCTCCCCATCCCAGG + Intergenic
1179857135 21:44167280-44167302 CCCCCAGAGCCCCCCAGGCTTGG + Intergenic
1179928315 21:44550560-44550582 CAGCCACAGCCGCCCAGCCCCGG - Exonic
1179939365 21:44628159-44628181 CAGCCACAGCCGCCCAGCCCCGG + Exonic
1180087573 21:45514857-45514879 CCCCCAAGGCTGCCCAGCCCAGG + Exonic
1180189830 21:46157590-46157612 CACACAGAGTTCCCCAGCCAGGG + Intergenic
1180623685 22:17179684-17179706 CACCCAGAGGGCCCCAACCCCGG - Exonic
1180830880 22:18905673-18905695 CACCAGAAGCTCCCCAGCCCCGG + Intergenic
1180855358 22:19041724-19041746 CTCCATGAGCTCCCCAGCCCTGG - Intronic
1181068959 22:20320638-20320660 CACCAGAAGCCCCCCAGCCCCGG - Intergenic
1181077786 22:20393135-20393157 TGCCCAGACCTCCCCTGCCCAGG - Intergenic
1181590234 22:23879706-23879728 AACCCAGAGCTCCTGGGCCCAGG + Intronic
1182059894 22:27389278-27389300 CTCCCAGGTCTCCCCAGCTCAGG + Intergenic
1183481018 22:38065615-38065637 CACCCAGAGACCCCCCTCCCAGG + Intronic
1183582491 22:38734229-38734251 CACAGATAGCTCCCCAGACCTGG - Intronic
1183884695 22:40869094-40869116 CACCCACACCTCCTCAGACCAGG + Exonic
1184405225 22:44297043-44297065 TACCCCGAGCCTCCCAGCCCTGG + Intronic
1184470295 22:44692242-44692264 CACCCAGGGCTCCTCCTCCCGGG + Intronic
1184470422 22:44692563-44692585 CACCCAGGGCTCCTCCTCCCGGG + Intronic
1184850451 22:47116690-47116712 CAGCCCGAGCTGCCCAGCCTGGG + Intronic
1185018936 22:48362307-48362329 CACCCTGTGCTCCCCAGGGCAGG + Intergenic
1185062869 22:48616128-48616150 CCAACAGAGCTCACCAGCCCCGG + Intronic
1185376196 22:50483608-50483630 CACCCAGCCCTGCCCTGCCCTGG - Exonic
1203280968 22_KI270734v1_random:130944-130966 CACCAGAAGCTCCCCAGCCCCGG + Intergenic
950430552 3:12948441-12948463 CCCCATGAGCTCCCCAGTCCAGG - Intronic
950718707 3:14867605-14867627 TGCCCAGAGCTCCCCAACCACGG + Intronic
951527656 3:23669254-23669276 TAGCCAGTGCACCCCAGCCCAGG - Intergenic
953026245 3:39146846-39146868 CACACAGAGCTCCACAGGCAGGG - Intronic
953366709 3:42351567-42351589 CATCCCCAGCTCCACAGCCCAGG - Intergenic
954584467 3:51721273-51721295 CTCCCATAACCCCCCAGCCCAGG - Intergenic
954634372 3:52063629-52063651 CACCCGCACTTCCCCAGCCCGGG + Intergenic
954704208 3:52470406-52470428 CACCCAGAGCTAACCCTCCCTGG - Intronic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
958191237 3:90187796-90187818 CTCCCCCAGCTCCCCACCCCAGG + Intergenic
958839242 3:99183730-99183752 CACCGCGAGCTCCCCCTCCCGGG + Intergenic
958853678 3:99358717-99358739 CACCCAGTGCTCCTGAGCCTTGG + Intergenic
959530700 3:107431434-107431456 AACCCAGAGCGCCCGGGCCCAGG - Intergenic
960884717 3:122382925-122382947 TACCCAGAGCTTCCCAGACAAGG + Intronic
961321734 3:126081950-126081972 TACCTAGAGAGCCCCAGCCCTGG + Intronic
961329338 3:126129485-126129507 GACCTAGAGAGCCCCAGCCCTGG - Intronic
961463314 3:127066828-127066850 CCCCCATGTCTCCCCAGCCCAGG - Intergenic
966836448 3:184053029-184053051 CACCAGGAGCTCCCAAACCCTGG - Exonic
966849795 3:184157143-184157165 CACCAGGAGCACCCCACCCCAGG - Intronic
967685295 3:192409931-192409953 CACCCTGAGCGCCCCCTCCCGGG - Intronic
967963383 3:194942412-194942434 GACCCAGAGCTCCCAGGCCCTGG - Intergenic
968466314 4:753128-753150 CTCCCAGAGCTGACAAGCCCCGG + Intronic
968528329 4:1076247-1076269 CAGCCTGAGGTCCCCAGGCCTGG + Intronic
968591355 4:1461231-1461253 CACCCAGAGCCCCACAGCAAAGG - Intergenic
968622049 4:1608265-1608287 CACCCTGAGACCCCCACCCCAGG + Intergenic
968697527 4:2040513-2040535 CCCCCAGGGCTCCGCGGCCCCGG + Intronic
968953627 4:3707282-3707304 CACCCAGAGCTCTCCTAACCAGG - Intergenic
969239506 4:5889353-5889375 CACCAAGGTCTCCACAGCCCTGG + Intronic
969449107 4:7262934-7262956 CTCCCAGAGCTCCTCAAACCTGG - Intronic
969517491 4:7655721-7655743 CAGCCAGAGCTGCCCTGCCTGGG + Intronic
970506928 4:16741134-16741156 CAGGCAGAGCTCACCATCCCTGG - Intronic
970651121 4:18179093-18179115 CTCCCCCAGCCCCCCAGCCCCGG - Intergenic
971278831 4:25224217-25224239 CACCCAGACAGCCACAGCCCAGG + Intronic
971454124 4:26828042-26828064 CAGTCAGAACTCCCCAGCTCTGG + Intergenic
971458933 4:26873478-26873500 GACCCAGAGCCCCCCTGCTCTGG - Intronic
974016033 4:56650090-56650112 CACCCAGGGCTCTGCAGCCCTGG + Intronic
975769990 4:77710429-77710451 TACCCAAATATCCCCAGCCCAGG - Intergenic
977338612 4:95729371-95729393 CACTCAGAGCTGTCCAACCCTGG - Intergenic
981527388 4:145720245-145720267 GACTCACAGCTCCCCAGCCAAGG + Intronic
982219695 4:153113953-153113975 CACCAAGAGCTTCCCATGCCAGG - Intergenic
985652050 5:1111867-1111889 GAGCCCGAGCGCCCCAGCCCGGG - Exonic
989989403 5:50743238-50743260 GTCCTAGAGCTCCCCAACCCTGG + Intronic
990906150 5:60805564-60805586 CACCCTTAGTTACCCAGCCCTGG - Intronic
997530189 5:134577165-134577187 CACCCAGGACCCCCCAGCCAGGG - Intronic
998166736 5:139848500-139848522 CACCCGGCGCCCCCCGGCCCGGG - Exonic
999316238 5:150585855-150585877 CTCCAAGAGCTCCCCAGACTTGG - Intergenic
999381974 5:151127672-151127694 CAGCCAGTTCTCCCCAGCACAGG + Intronic
1002422254 5:179154755-179154777 CACCCTAGGATCCCCAGCCCTGG - Intronic
1002524443 5:179807272-179807294 CACCCAGAGCCCCTCACGCCCGG - Intronic
1003116986 6:3289564-3289586 CAGCCGGTGCCCCCCAGCCCAGG - Intronic
1003712547 6:8608900-8608922 AATCCTGAGCTGCCCAGCCCAGG + Intergenic
1004378245 6:15109614-15109636 CAGGCAGACCTCCCCAGACCAGG - Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006108515 6:31730381-31730403 CACCCAGATCTGGCCGGCCCTGG + Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006444940 6:34074868-34074890 CCCCCAGAGGTCCCTACCCCAGG + Intronic
1006446319 6:34081709-34081731 CACCCAGCGCTTCCCACCTCAGG - Intronic
1006834137 6:36986392-36986414 CCGCCACAGCTCCCGAGCCCGGG - Intergenic
1007176689 6:39902155-39902177 CACACACAGCCCCCCATCCCAGG - Exonic
1007732288 6:43954515-43954537 CACCCTGACCTCAGCAGCCCTGG + Intergenic
1007759534 6:44125616-44125638 CACCCAGATCTCCCCAGCCTGGG + Intronic
1010175718 6:73025848-73025870 AACCCACAGCTACTCAGCCCTGG - Intronic
1011785922 6:90844996-90845018 AAGCCAGAGCTGCTCAGCCCAGG + Intergenic
1013336135 6:109164496-109164518 CACCCTTAGCTCCTCAGCCCTGG + Intergenic
1013369801 6:109458848-109458870 CAGCCACAGCTTCCCGGCCCAGG - Intergenic
1013656710 6:112254179-112254201 GACCCACAGCGCCCGAGCCCTGG - Exonic
1015220620 6:130801450-130801472 CGCCCAGCGCTCTCCAGCCGGGG + Intergenic
1015902618 6:138083346-138083368 CACCCAGATGTCCCCATCCCAGG - Intergenic
1016982297 6:149864288-149864310 CACCCAGCGCGCCGCAGGCCGGG - Intergenic
1017014698 6:150090646-150090668 CACGCTGAGCTCCCCACCCAGGG + Intergenic
1017747848 6:157462766-157462788 AGCCCAGTGCCCCCCAGCCCTGG + Intronic
1018627485 6:165793477-165793499 CACCCCACGCCCCCCAGCCCCGG - Intronic
1018632764 6:165834965-165834987 GCCCCTGAGCTCCCAAGCCCTGG - Intronic
1018794046 6:167172190-167172212 CACCCAGAGGACCCGTGCCCGGG + Exonic
1018874151 6:167804953-167804975 CCCCCAGAGCTCGCCACTCCAGG + Intergenic
1018880868 6:167878789-167878811 CAACCAGACTTGCCCAGCCCTGG + Intronic
1019004502 6:168784780-168784802 CACCCAGAGCTGCTCAGCGCAGG - Intergenic
1019171615 6:170136281-170136303 CACTCAGACGTCCCCAGGCCCGG - Intergenic
1019565396 7:1676390-1676412 CACCAGAGGCTCCCCAGCCCGGG - Intergenic
1019601218 7:1884742-1884764 CGCCCTGAGGCCCCCAGCCCAGG + Intronic
1019603172 7:1895426-1895448 TGCCCAGAGCTCCCCATGCCAGG + Intronic
1019878533 7:3838044-3838066 CACACAGGGCTCCCCAACCATGG - Intronic
1019937439 7:4265674-4265696 ACCTCAGACCTCCCCAGCCCTGG + Exonic
1020098885 7:5383348-5383370 GACCCAGGGCTCCCCTGCACAGG + Intronic
1021259299 7:18433676-18433698 CACACACACCTCCCCACCCCAGG + Intronic
1021877575 7:25063051-25063073 GGACCAGAGGTCCCCAGCCCTGG + Intergenic
1022801536 7:33781465-33781487 AACACAGAGCTGCCCAGACCAGG - Intergenic
1023741938 7:43288864-43288886 CATTCAGGGCTCCCCAGACCTGG + Intronic
1024056066 7:45660504-45660526 TTCACAGAGCTCCCCATCCCTGG - Intronic
1024603723 7:51008631-51008653 CACCCACAGGACCCCAGTCCTGG + Intergenic
1024701299 7:51906905-51906927 AACCCACAGCCCCCCAGTCCTGG - Intergenic
1026522804 7:71131702-71131724 CACCGAGAGCCACACAGCCCCGG - Intergenic
1026773658 7:73217816-73217838 CACCCTGAGGTCCCCAGCCCTGG - Intergenic
1027014517 7:74771210-74771232 CACCCTGAGGTCCCCAGCCCTGG - Intergenic
1027073516 7:75174747-75174769 CACCCTGAGGTCCCCAGCCCTGG + Intergenic
1028163134 7:87508575-87508597 CACCCATAGGACCACAGCCCAGG + Intronic
1029544554 7:101203366-101203388 CACCCAGCACCCCACAGCCCAGG + Intergenic
1029548765 7:101225261-101225283 CACCCAGGGCCACCCAGACCAGG - Intergenic
1029595902 7:101537581-101537603 CAACCAGGGCTCCTCTGCCCAGG + Intronic
1029610265 7:101622874-101622896 TACCCTGTGCTCCCCAGCACAGG + Intronic
1029927135 7:104329388-104329410 CCCCCGGGGTTCCCCAGCCCCGG + Intronic
1030267668 7:107636893-107636915 CAGCCAGTGCACCCCAGCCTGGG + Intergenic
1032011570 7:128351178-128351200 CCCCCGGAGCTCCCCTCCCCTGG - Exonic
1034273939 7:149815942-149815964 CCCCAAGAGCTCCACACCCCAGG - Intergenic
1034368158 7:150569969-150569991 CATTCAGTGCTCCCCAGACCAGG + Intronic
1034405407 7:150899483-150899505 CCTCCTGTGCTCCCCAGCCCAGG + Intergenic
1034451569 7:151139789-151139811 GTCCCAAAGCTCCCCAGCCTTGG - Intronic
1034815849 7:154171296-154171318 CTCCCAGAGTTCCCAAGCCTAGG - Intronic
1035206976 7:157300132-157300154 AACCCCGGGCTCCCCCGCCCCGG - Intergenic
1035520666 8:273518-273540 CACCCAGAGCTCTAGGGCCCTGG + Intergenic
1035612191 8:973919-973941 CGCCCAGCGCTCTCCAGCCGGGG - Intergenic
1036210136 8:6834812-6834834 AACCCAGAGCCCGCCAGCCGCGG - Intronic
1036359187 8:8065579-8065601 CAGGCAGAGCCCCCCAGCCGTGG + Intergenic
1036649743 8:10634746-10634768 CACACAGAACCCACCAGCCCCGG + Intronic
1036891771 8:12601373-12601395 CAGGCAGAGCCCCCCAGCCGTGG - Intergenic
1037106689 8:15117281-15117303 CACCGCGAGCTCCCCCTCCCAGG - Intronic
1037743107 8:21622847-21622869 ACCCCAGAGCCCACCAGCCCTGG + Intergenic
1038255683 8:25948768-25948790 CTCCCAGAGTTCCCAAACCCGGG - Intronic
1038397476 8:27257725-27257747 CACCCAGAACTGCCACGCCCTGG - Intronic
1038658335 8:29474593-29474615 AACCCACAGCTCCCGACCCCAGG - Intergenic
1038854273 8:31314104-31314126 CACCCTGATCTCCCTAACCCTGG - Intergenic
1040063481 8:43124855-43124877 CACCCAGACTGCCGCAGCCCAGG + Intergenic
1040604714 8:48920369-48920391 CAACCAGAGATCCTCAGCTCAGG - Exonic
1041175675 8:55193811-55193833 TACCCAGAGCTCCCAAACACTGG - Intronic
1043082651 8:75785041-75785063 CAGCCACAGCTGCCCAGCCATGG - Intergenic
1044573020 8:93740815-93740837 CGCCCAGCCCTCCCCACCCCCGG + Intronic
1045006519 8:97920927-97920949 CACCCCCATGTCCCCAGCCCTGG - Intronic
1045224274 8:100229379-100229401 CACCCACCGCACTCCAGCCCGGG + Intronic
1045314002 8:101027598-101027620 CAACAGGAGCTGCCCAGCCCAGG - Intergenic
1046071631 8:109262527-109262549 CAGTCAGAGCTCACCTGCCCTGG + Intronic
1047436461 8:124839177-124839199 CCGACAGAGCTCCCCAGACCAGG + Intergenic
1047745197 8:127839819-127839841 CAGCCAATCCTCCCCAGCCCTGG - Intergenic
1048825177 8:138417281-138417303 CAGCCTCAGCTGCCCAGCCCAGG + Intronic
1049064454 8:140301906-140301928 CTCCCAGAGCTCAGCTGCCCTGG + Intronic
1049200742 8:141339481-141339503 CACCCAGGCCACCCCAGCCAGGG - Intergenic
1049275645 8:141718812-141718834 CACCCAGACCCCCACAGCCCAGG - Intergenic
1049348659 8:142152542-142152564 CCCCGAGAGCTCTCCAGCCTTGG - Intergenic
1049355086 8:142183634-142183656 AACCCAGAGCTCTACTGCCCCGG + Intergenic
1049665526 8:143841072-143841094 CCCCGAGAGCTGCCGAGCCCGGG + Intergenic
1049687418 8:143944492-143944514 CACCCAGACCCCCTCAGCCCTGG - Intronic
1049688611 8:143949220-143949242 CACCCTGAGAGCCCCACCCCAGG + Intronic
1049688821 8:143949968-143949990 CACCCGAAGGTCCCCAGCCGAGG + Intronic
1049694507 8:143976811-143976833 CACCCAGAGCTGCGCCGCGCGGG + Intergenic
1049764363 8:144346954-144346976 CACCCAGCGCCCACCAGCCTGGG + Intergenic
1049772916 8:144392036-144392058 CACCCTGAGACCCCCACCCCTGG - Intronic
1049775497 8:144402008-144402030 CACCTACAGCAGCCCAGCCCCGG + Intronic
1052112842 9:24610012-24610034 CACACAGAGCTAGCCAGCCAAGG - Intergenic
1052818882 9:33123567-33123589 CCCCCAGGGCTGCCCAGCCCAGG + Intronic
1053010113 9:34628124-34628146 CCCCCAGAGCCCCCCAACACAGG + Intergenic
1055394082 9:75854922-75854944 CACCCAGAGTTGGCCAGCACTGG + Intergenic
1055513538 9:77016801-77016823 CACGCAGAGCTCCTCAGCAGCGG + Intergenic
1056830307 9:89911823-89911845 CACCCTCAGCTCCCCTGCCATGG - Intergenic
1056935903 9:90914573-90914595 CATCCAGAGCTCCTGGGCCCAGG + Intergenic
1056969180 9:91188102-91188124 GCCCCAGACCTGCCCAGCCCTGG - Intergenic
1057182432 9:93037368-93037390 CCCCCAGAGCCCCACAGCTCCGG + Intergenic
1057314599 9:93960374-93960396 CACCCACCGCTCGCCAGCCCCGG + Intergenic
1058164520 9:101605024-101605046 CAGCCTGGGCTCCCCATCCCTGG - Intronic
1058663592 9:107288673-107288695 CACCCAGATCTCCTGAGCTCAGG - Intronic
1059451899 9:114376212-114376234 ACCCCAGGGCTCCCCACCCCAGG + Intronic
1059923170 9:119180018-119180040 CAGCCTGGGCTCCCCAGCCAGGG - Intronic
1060113070 9:120920300-120920322 CACTCAGAGCTCCCCAGGGTAGG + Intronic
1060877843 9:127096068-127096090 GACCCAATGCTCCCCACCCCAGG + Intronic
1061060939 9:128250378-128250400 GCCCCAAAGCCCCCCAGCCCGGG + Intronic
1061149383 9:128820309-128820331 CATCCTGAGCTCTCCAGGCCTGG - Exonic
1061192437 9:129089515-129089537 CACCCAGGCCACCCCGGCCCAGG - Exonic
1061203889 9:129152170-129152192 CACCCTCCGCTTCCCAGCCCAGG - Intergenic
1061288429 9:129637428-129637450 CAACAAGAGCCCCGCAGCCCTGG + Exonic
1061289787 9:129644028-129644050 CAGCGAGAGTTGCCCAGCCCAGG + Intergenic
1061395472 9:130341339-130341361 CACCCTGAGCTCCACCTCCCAGG - Intronic
1061820799 9:133226324-133226346 CTCCCAGAGCTCCCTGACCCAGG + Intergenic
1061877860 9:133553918-133553940 AACCCAGAGCCCCACTGCCCAGG - Intronic
1062017091 9:134296446-134296468 CACCCCCAGCTCCCCCTCCCAGG - Intergenic
1062134696 9:134918981-134919003 CACCCAGACCTCTCCCGCCTGGG - Intergenic
1062238477 9:135523742-135523764 CTCCCAGAGCTCCCTGACCCAGG - Intronic
1062440733 9:136568194-136568216 CGCCCAGAGCAGGCCAGCCCGGG + Intergenic
1062732898 9:138119495-138119517 GATCCACAGCTCCACAGCCCAGG - Intronic
1185446871 X:262612-262634 CCCCCAGAGACCCCCAACCCTGG - Intergenic
1189293276 X:39901006-39901028 CACCGAGTGATCCTCAGCCCTGG - Intergenic
1192282055 X:69697988-69698010 TAACCAAACCTCCCCAGCCCTGG - Intronic
1192894000 X:75420802-75420824 CTCCCCTAGCTCCCCACCCCAGG - Intronic
1193928914 X:87527701-87527723 ATCCCAGAGCTCCACAGCCTAGG + Intronic
1196742035 X:119033558-119033580 GACTGAGAGGTCCCCAGCCCAGG + Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1200045198 X:153397271-153397293 TGCCCAGGCCTCCCCAGCCCAGG - Intergenic
1200299073 X:154954184-154954206 CACCCTCAACTCCCAAGCCCTGG - Intronic
1200989216 Y:9334279-9334301 TTCCCAGCGCTTCCCAGCCCTGG + Intergenic
1201338772 Y:12908756-12908778 CACCCCAAGCTCCCCCTCCCAGG + Intronic
1201486076 Y:14495876-14495898 CACCCACTGCTCCTCAGCCTGGG + Intergenic