ID: 954714803

View in Genome Browser
Species Human (GRCh38)
Location 3:52521678-52521700
Sequence GCCACGCTGTGAGGTGCAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954714796_954714803 22 Left 954714796 3:52521633-52521655 CCTTGGGGGCTCTGGCTCCTGCT 0: 1
1: 0
2: 7
3: 58
4: 481
Right 954714803 3:52521678-52521700 GCCACGCTGTGAGGTGCAACTGG 0: 1
1: 0
2: 3
3: 4
4: 73
954714798_954714803 5 Left 954714798 3:52521650-52521672 CCTGCTTCTGTGATGAAGGCTGG 0: 1
1: 0
2: 1
3: 20
4: 224
Right 954714803 3:52521678-52521700 GCCACGCTGTGAGGTGCAACTGG 0: 1
1: 0
2: 3
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954714803 Original CRISPR GCCACGCTGTGAGGTGCAAC TGG Exonic
901883473 1:12207318-12207340 GCCAGGCTGGCAGGTGCAGCTGG - Exonic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
904264870 1:29312581-29312603 GCCACGCTGTGAAGTGGAACTGG - Exonic
905734283 1:40315329-40315351 GCCTCGCTGTGAGCTGCGGCCGG + Intronic
908812412 1:67996603-67996625 GCCAGGCTTAGAGGTACAACTGG - Intergenic
920022409 1:202966369-202966391 TCCAAGCTGTGAGGTGCCACTGG - Intronic
924645898 1:245877093-245877115 GCCACGCTGTTGGGTGCTTCTGG + Intronic
1065122573 10:22543675-22543697 GCCAGGCTGTGAGGTGCACCTGG + Intronic
1065512284 10:26491478-26491500 GACGCACTGTGAGTTGCAACTGG - Intronic
1070793542 10:79203713-79203735 GCCATGCTGTGAGGGGCTTCTGG - Intronic
1083397548 11:62401911-62401933 GCCAGGCTGTGTGGAGCAAGGGG + Intergenic
1083923139 11:65791145-65791167 TCCACGCTGTGAACTGCCACAGG - Intronic
1084236480 11:67791041-67791063 GCCAGGCTGAGAGTTGGAACAGG - Intergenic
1084394498 11:68899955-68899977 CCCAGGCTGTGAGGGGCAGCCGG + Intronic
1090259971 11:125312497-125312519 GACAGGCTGTGAGGTGAATCAGG + Intronic
1092092771 12:5817408-5817430 GACACGCAGTGAGGTGCACTGGG + Intronic
1104436190 12:128758484-128758506 GCCCTGCTGGGAGGTGGAACAGG - Intergenic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1109596401 13:64560605-64560627 GTGTCGCAGTGAGGTGCAACTGG - Intergenic
1110139477 13:72110142-72110164 GCCACGCTGTGTGGTGTCCCAGG - Intergenic
1113591237 13:111502834-111502856 GCCACGCAGTGAACTGCAAGGGG + Intergenic
1116791963 14:49348727-49348749 GTCAGGGTGTGAGGTGCAAGGGG - Intergenic
1121138573 14:91520855-91520877 GCCACCCTTTGAGTTACAACTGG - Intergenic
1133412393 16:5579506-5579528 GCCACGCTGTGAGCAGCAGGAGG - Intergenic
1133699877 16:8298945-8298967 GCCAGGCTGTGAGGTAAGACAGG + Intergenic
1141690043 16:85591498-85591520 GCAAGGCTGTGAGGAGCAAAAGG - Intergenic
1141779730 16:86151434-86151456 GTCACGCTGGGAGGTTCAACTGG + Intergenic
1145249483 17:21289453-21289475 GCCAAGCTGAGGGGAGCAACTGG + Intronic
1149394723 17:56228304-56228326 ACCACACGGTGAGGAGCAACTGG - Intronic
1149641789 17:58207499-58207521 GTCACTCTGTGAGGTGCAGGTGG - Intronic
1152470181 17:80486883-80486905 GCCAAGCTGTGAGCTGAGACTGG - Intergenic
1152732730 17:81980591-81980613 GCCACCCTGCAAGCTGCAACCGG - Intronic
1154094121 18:11394465-11394487 GTCACGCTGAGAGGAGCACCTGG - Intergenic
925664359 2:6237588-6237610 GCCTCGCTGGAAGGAGCAACAGG + Intergenic
925725113 2:6864986-6865008 GCCACGCTGGGAGCTGGAAGCGG + Intronic
926882580 2:17563331-17563353 GCCATGCTGTGGAGTCCAACAGG - Intronic
929554642 2:42918152-42918174 GCCACGCTGTCAGCTCCAAGAGG - Intergenic
935061823 2:99615307-99615329 GCCAAGCTGTGTGGTGCAGAGGG - Intronic
937520941 2:122711885-122711907 CCCACCCTGTGAGGAGTAACGGG - Intergenic
941309444 2:163910993-163911015 ACCACACTGTCAGGTGCCACAGG + Intergenic
1171046439 20:21812415-21812437 GCCTGGCTGTGAGGGGCAAATGG - Intergenic
1174475895 20:50795320-50795342 GCCACGCAGAGATGTGCAGCGGG + Intronic
1175918619 20:62439459-62439481 ACCAGGCTGTGAGGTTCACCTGG - Intergenic
1176349102 21:5776097-5776119 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1176355916 21:5896681-5896703 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1176543423 21:8174167-8174189 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1176562374 21:8357212-8357234 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1181460710 22:23084410-23084432 GCTAAGCTGTGAGGTTCAGCAGG + Intronic
1183038023 22:35154955-35154977 GCCAGGCTTTGAGTTGCAAATGG - Intergenic
1203248290 22_KI270733v1_random:90386-90408 GCCACCCTGTGTGTTTCAACTGG - Intergenic
950184390 3:10936370-10936392 GCCACACAGTGGAGTGCAACTGG - Intronic
954714803 3:52521678-52521700 GCCACGCTGTGAGGTGCAACTGG + Exonic
958988493 3:100812347-100812369 GACAAGCTGTGAGGAGCAAGTGG + Intronic
961597715 3:128032085-128032107 GCCAGGCTTTGAGTTGCACCAGG - Intergenic
962485991 3:135842831-135842853 GCCACGCTGTGAGGAAGCACAGG - Intergenic
967854246 3:194104511-194104533 TCTGTGCTGTGAGGTGCAACAGG - Intergenic
967894132 3:194383253-194383275 GTCAAGCTGTGAGGAGCAACTGG + Intergenic
968135954 3:196219731-196219753 GCCACACTGGAAGGTGCTACTGG + Intronic
974991216 4:69093179-69093201 CCCACCCAGTGAGGTGGAACAGG + Intronic
986272593 5:6246733-6246755 TCTATGCTGTGAGGTGCAAATGG - Intergenic
988346462 5:30042915-30042937 GCCTCGCTGTGAGCCGCAGCTGG + Intergenic
993226155 5:85168801-85168823 CCCACCCAGTGAGGAGCAACAGG + Intergenic
999028153 5:148259291-148259313 GCCACCCAGTGAGGAGAAACAGG + Intergenic
1013226317 6:108121418-108121440 GCCAGGCACTGAGCTGCAACTGG + Intronic
1013299700 6:108793248-108793270 GCCACACTGTCAGATTCAACAGG - Intergenic
1013878353 6:114862579-114862601 GCCACCCTGTGAAGTAGAACAGG + Intergenic
1018688632 6:166324364-166324386 GCCACGCTGTCAAGTGCAACAGG + Intronic
1019730065 7:2624617-2624639 GCCACTCTGTGGGCTGCAATTGG - Intergenic
1020086891 7:5315288-5315310 GACAGGCTGTGAGGTCCAGCAGG + Intronic
1025207421 7:57001865-57001887 GACAGGCTGTGAGGTCCAGCAGG - Intergenic
1025664514 7:63575021-63575043 GACAGGCTGTGAGGTCCAGCAGG + Intergenic
1029544594 7:101203549-101203571 GCCAGGCTGCCAGGTGCACCTGG + Intergenic
1036721210 8:11177177-11177199 GGCACGCAGGTAGGTGCAACAGG + Intronic
1037765350 8:21769118-21769140 TCCTCACTGTGTGGTGCAACAGG - Intronic
1044125834 8:88457265-88457287 TCCACCCTGTGAGGAGGAACAGG - Intergenic
1044896181 8:96894059-96894081 GCCACGCTGGGAGGAGCACTTGG + Intronic
1049782955 8:144437128-144437150 GCCAGGCTGTGAGGTACACAGGG - Intronic
1057507124 9:95644149-95644171 GCCAGGCTGTGAGCTCCAAGAGG - Intergenic
1058442730 9:105024714-105024736 GCAACGCTGTGAGCTACAATGGG + Intergenic
1060550745 9:124484004-124484026 GCCAGGCTGTGATGTGCAGCAGG - Intronic
1203464693 Un_GL000220v1:73637-73659 GCCACCCTGTGTGTTTCAACTGG - Intergenic