ID: 954715334

View in Genome Browser
Species Human (GRCh38)
Location 3:52524010-52524032
Sequence CCAACCCAGCCCTACCTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954715334_954715342 -1 Left 954715334 3:52524010-52524032 CCTTCCAGGTAGGGCTGGGTTGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 954715342 3:52524032-52524054 GGGCTGCCATGGCGGGTCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 230
954715334_954715340 -9 Left 954715334 3:52524010-52524032 CCTTCCAGGTAGGGCTGGGTTGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 954715340 3:52524024-52524046 CTGGGTTGGGGCTGCCATGGCGG 0: 1
1: 0
2: 3
3: 49
4: 424
954715334_954715344 12 Left 954715334 3:52524010-52524032 CCTTCCAGGTAGGGCTGGGTTGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 954715344 3:52524045-52524067 GGGTCCTTGGATCTCGCTTGAGG 0: 1
1: 0
2: 2
3: 3
4: 73
954715334_954715341 -8 Left 954715334 3:52524010-52524032 CCTTCCAGGTAGGGCTGGGTTGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 954715341 3:52524025-52524047 TGGGTTGGGGCTGCCATGGCGGG 0: 1
1: 0
2: 2
3: 37
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954715334 Original CRISPR CCAACCCAGCCCTACCTGGA AGG (reversed) Exonic
900074572 1:802673-802695 CCAACTCAAGCCTACCTGGCTGG - Intergenic
901027150 1:6284735-6284757 TCACCCCAACCCCACCTGGATGG - Intronic
901104341 1:6743678-6743700 CCAGCCGAGCGCTACCAGGAGGG - Intergenic
901494816 1:9614918-9614940 GGGACCCTGCCCTACCTGGAAGG - Intergenic
901538907 1:9901968-9901990 TCTACCCAGCCCTGGCTGGAGGG + Intronic
902246233 1:15122622-15122644 CCTGCCCAGCCCCACCTGCAGGG - Intergenic
903604855 1:24568073-24568095 CAGGCCCAGCCCTGCCTGGAAGG - Intronic
904162568 1:28532343-28532365 CAGACCCAGCCTTACCCGGAAGG - Exonic
904425163 1:30418134-30418156 CCAACCCAGCTCTGCCTGGCTGG - Intergenic
905747680 1:40433170-40433192 CCAACCCATCCCTGCCTGGCAGG + Intergenic
905894322 1:41535267-41535289 CCACCCCAGCGCTGGCTGGAAGG - Intronic
905897727 1:41559425-41559447 CCACCCCAGGCCTCCCTGGCAGG + Intronic
908360941 1:63367827-63367849 CCTCCCCAGCCCTTCCTGCAGGG + Intronic
909741843 1:79038628-79038650 CCTACCCAGCCCAAGTTGGAAGG - Intergenic
909850997 1:80463855-80463877 ACAAGCCAGCCCAAGCTGGAGGG + Intergenic
912474741 1:109928242-109928264 GCAACCCAGCCCCTCCTGGATGG - Intronic
913321601 1:117592393-117592415 CCAACCCCGCTCTGCTTGGATGG + Intergenic
915731221 1:158055870-158055892 CAACCCCAGGCCTTCCTGGAGGG - Intronic
916188330 1:162154534-162154556 CCCCTCCAGCCCTACCTAGAAGG - Intronic
918076586 1:181175538-181175560 AGACCCCAACCCTACCTGGAAGG - Intergenic
919814249 1:201427877-201427899 CCCACCCAGGCCTTCCTGGAGGG - Intronic
920203891 1:204277507-204277529 CCATGCCAGCCCGACCTGTAGGG + Intronic
921587478 1:216965236-216965258 CCAAACCATCCCAACCTGAATGG + Intronic
922095348 1:222438735-222438757 CCAGACCAGCCTTACTTGGAAGG - Intergenic
922270418 1:224027579-224027601 CCAACTCAAGCCTACCTGGCTGG - Intergenic
922469248 1:225865828-225865850 CCAACACAGCCCCACCCGCAGGG - Intronic
922592243 1:226785958-226785980 CCTGCCCAGCCCCACATGGAAGG - Intergenic
922744278 1:228035574-228035596 CCATCCCCGCCCTGCCCGGAGGG - Intronic
922797417 1:228347314-228347336 CCAAACCAGCCAGACCTAGATGG + Intronic
922807317 1:228397117-228397139 CGAACCCAGCCTCTCCTGGAGGG - Intronic
923995954 1:239494696-239494718 CCAACCCAGCCTTCCCTGATAGG + Intronic
1065774348 10:29105644-29105666 CAACCCCAGCCCTCCCTGAAAGG + Intergenic
1070828662 10:79405646-79405668 CCAGCCCAGCCTTCCCTGGCTGG + Intronic
1072206077 10:93206462-93206484 CCAACCCAGCCCTCCCTAGCAGG + Intergenic
1072539030 10:96384455-96384477 CCAAGGCAGCCATACCTGGAGGG + Intronic
1073541045 10:104316274-104316296 CCTACCCAGACATTCCTGGATGG + Intronic
1075004084 10:118818128-118818150 CCACCCCAGCCCCACCTGAGCGG - Intergenic
1077026391 11:441821-441843 CCCCGCCAGCCCCACCTGGAAGG - Intronic
1077630400 11:3807818-3807840 CCATCCCAGCCCAACAGGGAAGG - Intronic
1079243452 11:18736850-18736872 CGATCCCAGCCCTACCTGGAGGG - Intronic
1079251399 11:18790647-18790669 CCAGCCCTGCCCCACTTGGAGGG - Intronic
1082097989 11:48146635-48146657 CCAATCCACTACTACCTGGATGG - Intronic
1083897005 11:65625009-65625031 GCAAGCCACCCCTACCTTGATGG - Exonic
1084148002 11:67275224-67275246 CCACTGCAGCCCTTCCTGGAAGG + Intronic
1084153520 11:67302097-67302119 CCTCCCCTGCCCTGCCTGGAAGG + Exonic
1084495811 11:69502461-69502483 CCTAACCAGCCCCACCTGGCTGG + Intergenic
1085769201 11:79309969-79309991 CACATCCAGCCCTGCCTGGAAGG - Intronic
1087907024 11:103710081-103710103 CCCACCCAGCTCTGCCAGGAAGG + Intergenic
1089235469 11:117020702-117020724 GCACCCCAGCTCTACCGGGATGG + Intronic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1089764848 11:120755792-120755814 CCACCCCAACTCTCCCTGGAGGG - Intronic
1089842973 11:121434876-121434898 CTAACCCATAACTACCTGGAAGG + Intergenic
1091923132 12:4321408-4321430 CCAAGCCAGCCCTCCCGGGCTGG - Intronic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1094176413 12:27546308-27546330 CCAGCCCAGCCCTCACTGGGAGG + Intronic
1096226449 12:49869546-49869568 CCAGGCCAGCCCCATCTGGAAGG - Exonic
1096412506 12:51387629-51387651 ACACCCCTGCCCCACCTGGAAGG - Intronic
1096755587 12:53796723-53796745 CCAGCCCAGCCCTTCCAGAAAGG - Intergenic
1096842194 12:54386144-54386166 CCACCCCATCCCAACCTTGAAGG - Intronic
1097250448 12:57629834-57629856 CCAACCCACCCCTTACTAGAGGG - Intronic
1097693043 12:62751919-62751941 GCACACCAGCCCTACCTGTAAGG + Intronic
1102447538 12:113015164-113015186 GCAACTCAGCCCAACCAGGAGGG + Intergenic
1104393944 12:128415402-128415424 CCAGCCCATCCTTTCCTGGACGG - Exonic
1104902947 12:132198982-132199004 CCCAGCCCGCCCCACCTGGAAGG - Intronic
1105585414 13:21738646-21738668 CCAGCCCTGCCCTGCATGGAAGG - Intergenic
1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG + Intronic
1113734142 13:112665077-112665099 GCAACCCAGCCCAACCTGGAGGG - Intronic
1118572093 14:67204078-67204100 CCTACCCAGACCTATCTGGGAGG + Intronic
1119420203 14:74503723-74503745 TCAACCCAGCCCAGCCTGGAAGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1123937244 15:25199929-25199951 CCAACCTATCCCTCCCTGGTGGG - Intergenic
1125721400 15:41846828-41846850 CCCACCCTTCCCAACCTGGAAGG - Exonic
1125973860 15:43934145-43934167 CCACCCCAACCCTCCATGGAGGG - Intronic
1128252802 15:66174670-66174692 CCAGCCCAGCCCCACCTGTGGGG + Intronic
1129426825 15:75469462-75469484 CCCATCCAGCCCTCCCTGGAGGG - Intronic
1130322610 15:82853511-82853533 CCTGCCCTGCCCGACCTGGAGGG - Intronic
1130554326 15:84912218-84912240 CAAAACCACCCCTACCTTGAGGG - Intronic
1131464695 15:92645829-92645851 CCCACCCTCCCCTACCTGGGTGG - Intronic
1132049061 15:98591968-98591990 CCCATACAGCCCTGCCTGGAGGG + Intergenic
1132353411 15:101154563-101154585 CCCACCCAGCCCAACCCTGATGG - Intergenic
1132485842 16:190427-190449 ACAAGCCAGCCCTACCTGCCAGG + Intronic
1132666489 16:1083416-1083438 CCAACCCAGCCCCATCAGCAGGG + Intergenic
1133132077 16:3682875-3682897 CGCACCCAGCCTGACCTGGAAGG - Intronic
1135510316 16:23077404-23077426 CCAACCCCGGCCCTCCTGGAAGG + Intronic
1136710631 16:32234039-32234061 CCTACCCAGCCATCCCAGGATGG + Intergenic
1136757280 16:32695372-32695394 CCTACCCAGCCATCCCAGGATGG - Intergenic
1136810828 16:33175003-33175025 CCTACCCAGCCATCCCAGGATGG + Intergenic
1136817304 16:33285083-33285105 CCTACCCAGCCATCCCAGGATGG + Intronic
1136823867 16:33341612-33341634 CCTACCCAGCCATCCCAGGATGG + Intergenic
1137670619 16:50276177-50276199 CCAACTAGGCCCTACATGGAGGG + Intronic
1138536005 16:57660631-57660653 CCCACCCAGCCCCATCTGGTGGG - Intronic
1139847284 16:69929911-69929933 AAAACCCAGCCCTGCATGGATGG - Intronic
1141715663 16:85725359-85725381 CCACCGCAGCCCCATCTGGAAGG + Intronic
1203059430 16_KI270728v1_random:955723-955745 CCTACCCAGCCATCCCAGGATGG - Intergenic
1142566613 17:844259-844281 CCCACCCATCCTTAGCTGGAAGG + Intronic
1142597613 17:1037123-1037145 CTCTCCCAGCCCCACCTGGATGG - Intronic
1143891562 17:10106267-10106289 CCACCCGAGCCACACCTGGAAGG - Intronic
1144581422 17:16461528-16461550 GCAGCTCAGCCCTGCCTGGATGG - Intronic
1144772284 17:17766580-17766602 TCAACCCAGCCCCACCTCCAAGG + Intronic
1146527405 17:33578746-33578768 TCAATACAGCCCCACCTGGAAGG + Intronic
1147864894 17:43545698-43545720 CCATCGCAGCCCTCCCTGGACGG - Intronic
1149446684 17:56718636-56718658 CCTCTCCAGCCCTAGCTGGAGGG - Intergenic
1150452501 17:65280482-65280504 CCATCCCAGCTCCACCAGGAAGG - Intergenic
1151961058 17:77405849-77405871 CCAGCCCAGCCCCACATGGAGGG - Intronic
1152607216 17:81297967-81297989 CATAGCCAGCCCTACCTGCAAGG - Intergenic
1156025089 18:32644685-32644707 CCACCCCAACCCTACCAGCAAGG - Intergenic
1157524276 18:48367717-48367739 CCAACCCAGCACTCCCTGCTGGG + Intronic
1157533774 18:48443505-48443527 CCACCCCTGGCCTCCCTGGAGGG - Intergenic
1160571360 18:79819508-79819530 CCAACACAGCCCGATCTGAAGGG - Intergenic
1160875233 19:1293714-1293736 CCAGCCCTTCCCTACCTGGTTGG - Intronic
1162003515 19:7763305-7763327 CCAACCCAGCCTTACCCAGGAGG - Exonic
1162046195 19:8002037-8002059 CCACCCCTGGCCTACCTGCAGGG + Intronic
1163519566 19:17783971-17783993 CCAGCAAAGCCCTACCTGGGTGG - Intronic
1164868520 19:31624960-31624982 CCTACCCAGCCCTTCTTGGAAGG + Intergenic
1165342349 19:35222085-35222107 GCAACCCACCCTTACCTGTAAGG + Intergenic
1165399030 19:35586002-35586024 CCAACCAATCCCTACCAGGGTGG + Intergenic
1166944270 19:46387516-46387538 GCAACCCAGCCCTGCCTCGGAGG + Intronic
1167504501 19:49863949-49863971 CCCTTCCAGCCATACCTGGAAGG + Exonic
1168166103 19:54549049-54549071 CCAACCCCGCCATCCCTGGATGG - Intergenic
1168713341 19:58513841-58513863 CCAGCCCGGCACCACCTGGAGGG + Exonic
927187195 2:20490377-20490399 CCAACCCAGACCAACCTGGGAGG - Intergenic
928195565 2:29214268-29214290 CCAACCCAGACCTCTCTGGGTGG + Intronic
928445477 2:31330075-31330097 CCTACCCAACCTCACCTGGATGG + Intergenic
929242174 2:39665266-39665288 ACCACGCAGCCCGACCTGGATGG + Intronic
930705652 2:54502390-54502412 CCAACCCAGCCCTCTGTGAAGGG + Intronic
931433945 2:62231346-62231368 GCAACCCAGAGCAACCTGGAAGG - Intergenic
931464050 2:62471553-62471575 ACTCCCCAGCCCTACCTGCAAGG - Intergenic
932332594 2:70906221-70906243 CCAACCCAGCTCATCCGGGAAGG + Intronic
934554209 2:95278827-95278849 CCACCCCACCCCTACCAGGGAGG + Intronic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
937291875 2:120786818-120786840 CCAACCCAGCCCTCCCTTAAAGG + Intronic
938300413 2:130207343-130207365 CTAACCCAGCACCACCTCGAGGG - Intergenic
938456315 2:131467134-131467156 CTAACCCAGCACCACCTCGAGGG + Intronic
945296702 2:208178190-208178212 ATAACCCAGCCAAACCTGGAGGG + Intronic
946332690 2:219019233-219019255 CCAAGCCAGCCATCCCTGGGAGG - Intronic
946334153 2:219026315-219026337 CCAACCCAGCCCCTCCTGCGGGG + Intronic
947745770 2:232506594-232506616 CCAGCCTGGCCCTCCCTGGAGGG - Intergenic
948909024 2:240993800-240993822 CCAGCCCAGGCCTGCCTGCACGG + Intergenic
1169732574 20:8802166-8802188 CCCATCCAGTCCTACCTGGCCGG - Intronic
1170608901 20:17895495-17895517 CCTGCCCACCCCCACCTGGAAGG + Intergenic
1170944671 20:20880683-20880705 CAAACCCAGGCCTACCTGTCAGG - Intergenic
1171127132 20:22612176-22612198 TCACACCAGCCCTTCCTGGATGG + Intergenic
1171454418 20:25259475-25259497 CCAACCCATTCCTTCCAGGAGGG - Intronic
1172125939 20:32625364-32625386 TCACCCCAGCCCTCCCTGGCTGG - Intergenic
1174619690 20:51864604-51864626 CCACCCAGGCTCTACCTGGAAGG + Intergenic
1175268023 20:57714283-57714305 CCACCCCCGGCCTGCCTGGACGG + Intergenic
1175281690 20:57808110-57808132 CCAGCCCAGGCCTGCCTGGCTGG - Intergenic
1176018548 20:62951313-62951335 CCCACCCAGCCATCCCTGCATGG + Intergenic
1176071540 20:63229263-63229285 GCAATGCAGCCTTACCTGGACGG + Intergenic
1178738057 21:35170708-35170730 CCACCCCAGCTCAACCTGGTGGG + Intronic
1179657697 21:42855372-42855394 CCACCCCTGCCCCACCTGGCTGG + Intronic
1180951624 22:19723067-19723089 ACAGCCCGGCCCGACCTGGAGGG + Exonic
1181438546 22:22924098-22924120 CCCACCCAGCCCCTCCTGCATGG + Intergenic
1182368287 22:29793200-29793222 CCACCCCAGCCCACCCTGAATGG - Intronic
1183191109 22:36322571-36322593 CCGAGCCTGCCCTGCCTGGAAGG + Intronic
1183277855 22:36912463-36912485 CCAACCCTGCCCTTCCTGGTAGG + Intergenic
1183747487 22:39699997-39700019 GCAGCCCAGCCTTACCTGGCAGG - Intergenic
1184980452 22:48091779-48091801 AGACCCCAGCCCCACCTGGAAGG + Intergenic
950451141 3:13066569-13066591 CCTGCCCAGCCCTGCCTGGAAGG - Intronic
950533365 3:13566032-13566054 CCAAGCCAGCCCTCCCGGGTGGG - Intronic
950537101 3:13585004-13585026 CCAACCCAGCCCCAACTGCCAGG - Intronic
950634224 3:14303689-14303711 CCAACTCCAGCCTACCTGGATGG + Intergenic
953376794 3:42435587-42435609 CCCATCCAGAGCTACCTGGAGGG - Intergenic
953828723 3:46277178-46277200 TCAACCCACCACTGCCTGGAAGG + Intergenic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954583980 3:51718739-51718761 CAGACCCAGCCCTGCCTGGTGGG + Intergenic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
954930371 3:54276098-54276120 CCAACCCATCCCTGCAGGGAGGG - Intronic
956422122 3:69096499-69096521 CCAACCCACTCCTACTTGCAGGG + Intronic
956830047 3:73037991-73038013 CCAACTCAGCCCTAACATGAAGG - Intronic
959568834 3:107860357-107860379 CCTACCCATTTCTACCTGGAAGG - Intergenic
961002438 3:123383133-123383155 CCCACTCACCCCTACCAGGACGG - Intronic
962946087 3:140172382-140172404 CCAACCCACTCCTATCTGGATGG - Intronic
963897582 3:150703464-150703486 CCGACCCACCCCTTCCTCGAGGG - Intronic
964887426 3:161500733-161500755 GAAACCCAGCCCTAAATGGAAGG - Intronic
965223547 3:165958694-165958716 CCAAGCCAGCCATACCTTGAAGG - Intergenic
966124549 3:176560989-176561011 CCATCCCATCCCTACCTAGGAGG + Intergenic
966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG + Intronic
968449146 4:666996-667018 CCGACCCAGCCCCGCCTCGAGGG - Intronic
968629516 4:1642764-1642786 CCTACCCAGCCCCACCTGCCGGG + Intronic
969036356 4:4256962-4256984 CCCACCCACCCCCACCTGCAAGG + Intergenic
969618217 4:8265808-8265830 TCCACCCAGCCCTGCCAGGAGGG - Intergenic
970400390 4:15711882-15711904 TCATCCCAGCATTACCTGGATGG - Exonic
971235638 4:24839659-24839681 CCATTGCAGCCCCACCTGGAAGG - Intronic
971914660 4:32851904-32851926 TTAAACCAGCCCTACCTAGAGGG - Intergenic
972279733 4:37590449-37590471 CCAACTCAACCCTTCCTGGAAGG + Exonic
977894279 4:102345908-102345930 CCAAGCCGGCCCTTCCTGGCGGG + Intronic
977923515 4:102672040-102672062 CCAACCCAGCCCCAGCTGGGAGG + Intronic
981748020 4:148069381-148069403 CCAGCCCTCCCCTCCCTGGAAGG - Intronic
986055015 5:4128279-4128301 CCCACCCAACCCTTCCTGGTAGG + Intergenic
989723240 5:44554200-44554222 TTAAACCAGCCCTAGCTGGAGGG - Intergenic
996884671 5:128341316-128341338 ACAATCCAGCCCTGCTTGGATGG + Intronic
1001266789 5:170279567-170279589 CCAGCCTAGACCTACCTGAACGG + Intronic
1002570222 5:180135988-180136010 CCAGCCCAGCCCTTCTTGCACGG + Intronic
1005249740 6:23930813-23930835 CCAATCCAGGCCTGGCTGGAAGG + Intergenic
1005999839 6:30956207-30956229 CCAAGGCAGCCCCACCTGGACGG + Intergenic
1006419573 6:33924800-33924822 CCAACCCAGTCCTCCCCAGAGGG + Intergenic
1007093060 6:39196462-39196484 CTCACCCAGCCCTCCATGGAGGG + Intronic
1007504259 6:42322881-42322903 CAAACCCAACCACACCTGGAAGG + Intronic
1010805322 6:80228905-80228927 CAAGCCCAGCTCTCCCTGGAAGG - Intronic
1013232989 6:108174145-108174167 GAAACACAGCCCTTCCTGGAAGG - Intronic
1013687345 6:112600979-112601001 TTAAACCAGCCCTAGCTGGAGGG + Intergenic
1016261322 6:142174119-142174141 ACCACCCAGACCTACCTGAATGG + Intronic
1017040958 6:150308314-150308336 CCAACACAGCCCCACCAGGCAGG - Intergenic
1018473083 6:164113568-164113590 CCAACACAGCATTGCCTGGAGGG - Intergenic
1019141099 6:169943802-169943824 CTAACCAAGCCCCACCTGCAGGG + Intergenic
1019147200 6:169983094-169983116 CCTGCCCAGCCCCTCCTGGAAGG + Intergenic
1019543277 7:1560883-1560905 CCCAGCCAGCCCTACCTGCCTGG + Intergenic
1023769401 7:43541286-43541308 CCAACCCAGCCCTGTCTGCAGGG + Intronic
1024577745 7:50778625-50778647 ACAACCCAACCCTACCTCCAAGG + Intronic
1029371552 7:100154078-100154100 ACCTCCCACCCCTACCTGGACGG + Exonic
1029618352 7:101674110-101674132 CCAGCTCAGTCCTAGCTGGAGGG - Intergenic
1032080768 7:128857371-128857393 GCAGCCCAGCCCAGCCTGGAGGG + Intronic
1032091485 7:128913789-128913811 GCAGCCCAGCCCAGCCTGGAGGG - Intergenic
1035261290 7:157663179-157663201 CCACCCCTGCCGTACCTGCAGGG - Intronic
1035541068 8:438807-438829 CCAACTCAAGCCTACCTGGCTGG + Intronic
1036933274 8:12976884-12976906 TCAACCCAGACCTATCTGGGAGG + Intronic
1037667953 8:20987070-20987092 CAACCCCTTCCCTACCTGGATGG + Intergenic
1037994026 8:23339903-23339925 CTGGCCCAGCCCTGCCTGGACGG - Intronic
1039573315 8:38603915-38603937 GAGACCCAGCCCTCCCTGGAGGG - Intergenic
1039983734 8:42430049-42430071 CCAGCCCAGGCTTACCTGGACGG + Exonic
1044932159 8:97260772-97260794 ACAGCCCAGCCCAACCCGGAGGG + Intergenic
1045561577 8:103269155-103269177 TCAACACAGCCCTACTTGCAAGG + Intergenic
1045571035 8:103370107-103370129 CCAACCTGGCCCTACGTGGTGGG + Intergenic
1048335801 8:133501334-133501356 CCAGCCCAGCCCTATCCGGCAGG + Intronic
1048993149 8:139773161-139773183 CCCACACAGCCCTACCTGCTGGG - Intronic
1049172524 8:141170642-141170664 CCCACCCCGCCCTGCCTGGCTGG - Intronic
1051589499 9:18762262-18762284 CCAACCCACCCTGACCTAGAAGG - Intronic
1060225165 9:121786042-121786064 CCAACACAGACCCACCTGCAAGG + Intergenic
1060665167 9:125428368-125428390 CCAACCCAGCCCTCAGTGAAAGG + Intergenic
1061422944 9:130481994-130482016 CCCTCCCAGCTCTCCCTGGAGGG - Intronic
1061547372 9:131312536-131312558 CCAACCCAGCCATATTTAGAAGG - Intergenic
1061840046 9:133353387-133353409 GGACCCCAGCCCTACCTTGAGGG - Intronic
1062091561 9:134681153-134681175 CCACCCCAGCCCTCCCTGCAAGG - Intronic
1062238821 9:135525244-135525266 CCATCCCACTCCTACCTGGGTGG + Intronic
1062283047 9:135760413-135760435 GCACCCCAGCCCACCCTGGAGGG + Intronic
1062444480 9:136587930-136587952 CCAACCCAGCCCTGGCTGCAAGG + Intergenic
1062545881 9:137063615-137063637 CCTGCTCAGCCCAACCTGGAGGG - Exonic
1062673308 9:137724274-137724296 CCACCCCCGCCCTGCCAGGAGGG + Intronic
1194637383 X:96362591-96362613 CCAACACAAAACTACCTGGATGG - Intergenic
1196938081 X:120749446-120749468 ACAGCCCAGCCCTGCCTGGCTGG + Intergenic
1197437868 X:126455246-126455268 CCAACCCAGCACTGGCTGCATGG + Intergenic
1200083884 X:153593346-153593368 CCACCCCAGCCCTGACTGGAAGG + Intronic