ID: 954716383

View in Genome Browser
Species Human (GRCh38)
Location 3:52528923-52528945
Sequence TCCCTTCTGGGTACTGCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954716376_954716383 17 Left 954716376 3:52528883-52528905 CCACGGATGGCAAAGCTGGGGTT 0: 1
1: 0
2: 1
3: 6
4: 139
Right 954716383 3:52528923-52528945 TCCCTTCTGGGTACTGCCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954716383 Original CRISPR TCCCTTCTGGGTACTGCCGG GGG Exonic
900417784 1:2543033-2543055 TCCCTGCTGGTCACTGCCGAGGG - Intergenic
904319610 1:29688556-29688578 TCCCTCCAGGGTTCTGCCAGAGG - Intergenic
904750801 1:32740730-32740752 GCCCTTCTGGGGACTGACGGAGG + Intergenic
906106873 1:43299975-43299997 TCCGTTCTGGGAACTGCCAGTGG + Intergenic
909056469 1:70826633-70826655 TCCCTTCTGACTCCTGCAGGAGG - Intergenic
912882234 1:113427179-113427201 TTCCCTCTTGGTACTGCCAGAGG + Intronic
913698083 1:121347165-121347187 TCTCTTCTGGATACTGACTGTGG + Intronic
914139467 1:144932887-144932909 TCTCTTCTGGATACTGACTGTGG - Intronic
914826368 1:151140437-151140459 TCCCTTCTTGGAACTGCCTTAGG + Intronic
915129569 1:153687387-153687409 TCCCTACTGGGTGGTGCTGGGGG - Intronic
917741655 1:177967201-177967223 TCCATTCCGGGTACTGTCGTAGG + Intronic
919775578 1:201192083-201192105 TCCCTTCGGCGTAGTGCCTGTGG + Intronic
920485478 1:206365815-206365837 TCTCTTCTGGATACTGACTGTGG + Intronic
1063109398 10:3021306-3021328 TCCCTTCTGGGTGCTGAGGAGGG - Intergenic
1065870871 10:29955529-29955551 TCCCTGCTGGCTGTTGCCGGAGG - Intergenic
1068300493 10:55132035-55132057 GCCCTTCTGGGTACAGCTGCAGG - Intronic
1069830327 10:71278937-71278959 CCGCTTCTGGGCACTGGCGGTGG + Intronic
1070386460 10:75929108-75929130 TCCTTTCTGGGCACTGTAGGTGG - Intronic
1074831350 10:117251719-117251741 TGCCGTTTGGGTACTGGCGGAGG + Intronic
1077304486 11:1862997-1863019 TTCCTCCTGGGTTGTGCCGGGGG + Intronic
1078367899 11:10721851-10721873 GGCCATCTGGGAACTGCCGGTGG - Intergenic
1080244068 11:30159663-30159685 TCCCTTCTGAGAACTGACTGGGG - Intergenic
1085120321 11:73963504-73963526 TAGCTTCTGGGCACTGCCTGAGG - Intronic
1085427231 11:76415326-76415348 TCCCTCCTGGGCACTGCCTTTGG - Intergenic
1089197793 11:116705011-116705033 TGCCTTCTGGGTACTGCTCTAGG + Intergenic
1096914877 12:55020400-55020422 TCTCTTCTGGGTAAGGCAGGAGG + Intronic
1101498975 12:105283652-105283674 CTCCTTCTGGGTACTGCCAATGG - Intronic
1103407453 12:120686340-120686362 TCCACTCTGGGCACCGCCGGCGG + Intergenic
1104405167 12:128510990-128511012 TCCCTTCCAGGTCCTGCTGGAGG + Intronic
1109190015 13:59312949-59312971 TACCTTCTGGATGCTGCCGCTGG + Intergenic
1111657831 13:91175059-91175081 TTCCTTCCGGGTTGTGCCGGAGG - Intergenic
1120327763 14:83051721-83051743 TCTCTTCTTGGTACAGCAGGTGG - Intergenic
1121730042 14:96180360-96180382 TCCATCCTGGGTCCTGCTGGTGG - Intergenic
1123041742 14:105493063-105493085 TCCCTCCTGGGCACTGGAGGGGG + Intronic
1124112713 15:26806985-26807007 TCCCTTTTGGGTACTGACGTTGG - Intronic
1125041749 15:35195818-35195840 TACCTCCTGGGTGCTGCCAGTGG + Intergenic
1126506109 15:49406383-49406405 TCCCTGCTGGTGACTGCAGGCGG + Intronic
1127932091 15:63603676-63603698 GCCCTTCTGGGGACTGCCAAAGG + Intergenic
1134109137 16:11503788-11503810 TGGCTTGTGGGTCCTGCCGGAGG - Intronic
1138953640 16:61944403-61944425 TCCCTTCTAAATACTGCTGGGGG + Intronic
1141480237 16:84301571-84301593 CCCCTCCTGGGTGCTGCTGGGGG - Intronic
1143018517 17:3904387-3904409 CCCCTTCTGGGTGCTGGGGGAGG + Exonic
1147592993 17:41697217-41697239 TCCCTACTTGGTAGAGCCGGAGG + Intergenic
1151800506 17:76376725-76376747 TTCCTTTTGGGAACTGCCTGAGG + Intronic
1152460539 17:80439861-80439883 TCCCTTTTGGGTTCTGCCCATGG - Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155553734 18:26995007-26995029 TCACTTCTGGGGAAAGCCGGTGG + Intronic
1158230515 18:55249414-55249436 TCCCTTCAGAGTCCTGCAGGTGG - Intronic
1159816354 18:73078655-73078677 TCCCTTGTGGTTTCTGCCTGTGG + Intergenic
1160574034 18:79838863-79838885 CCTCTTCTAGGTACTGCAGGTGG - Intergenic
1164824726 19:31277032-31277054 TCCCTTCTGAGGTCTGCCGGAGG + Exonic
1165115726 19:33527429-33527451 TCCCTTTTGGCTTCTGCTGGGGG + Intergenic
1166678329 19:44753240-44753262 CCCCTTCTGGGTACCTCTGGGGG + Intronic
1166971083 19:46568335-46568357 TCCATTATGGGAACTGCCTGGGG - Intronic
1167115744 19:47488177-47488199 TCCCATCTGGGGAGTGCCGCGGG - Exonic
925277057 2:2657575-2657597 TCCCTGCTGGGTGCAGGCGGGGG - Intergenic
926246354 2:11124434-11124456 TCCCTTCTGGGCCCTCCCTGTGG + Intergenic
930691888 2:54373083-54373105 TCCCTTCTCCGTACTGCAGCTGG + Intronic
932459200 2:71871619-71871641 TTCCTTCTGGATACTGTCTGAGG + Intergenic
936072441 2:109380363-109380385 TCCCTTCTGGGTCCTGGCACAGG + Intronic
938902525 2:135809905-135809927 GCCCTTCTGGTTACAGCCAGCGG - Exonic
939559706 2:143717991-143718013 TGCATTCTGGGTACTGCTGCCGG - Intronic
948032647 2:234831577-234831599 GCCCTTCTGGGTTCTGTCTGCGG - Intergenic
948600769 2:239106396-239106418 CCCCTTCTGGGGACTGCCCAAGG - Intronic
1169451447 20:5715327-5715349 TCCCTTGAGGGTGCTGCAGGTGG - Intergenic
1171358952 20:24573066-24573088 TTCCTTCTGGCTCCTGGCGGTGG + Intronic
1179989510 21:44939930-44939952 CCGCTTCCGGGTACTTCCGGCGG + Intergenic
1184151970 22:42644599-42644621 TCCCTTCTGGAAACTCCCTGGGG + Intronic
1185027689 22:48425039-48425061 TCCCTGCTGCGTGCAGCCGGTGG - Intergenic
949965886 3:9355869-9355891 TCCCTTCTGCCTTCTGCCGTGGG - Intronic
952936290 3:38400881-38400903 TCCCTTCTAGGTCTTGCAGGTGG + Exonic
953746026 3:45574699-45574721 TGCCTTTTGGGCTCTGCCGGCGG + Intronic
953792935 3:45962380-45962402 TTCCTTCTGGGTCCTGGGGGAGG + Exonic
953857586 3:46511855-46511877 TCCCATCTGGGTTCTGGGGGTGG - Intergenic
954366385 3:50148442-50148464 TCCATTCTGGGTGCTGGAGGAGG + Intergenic
954391718 3:50271096-50271118 TCCTTCCTGGGTCCAGCCGGAGG - Exonic
954716383 3:52528923-52528945 TCCCTTCTGGGTACTGCCGGGGG + Exonic
955360139 3:58267179-58267201 CCCCTTCCAGGTACTGGCGGAGG + Exonic
956043267 3:65169096-65169118 GGCCTTCTGGGTTCTGACGGAGG + Intergenic
966122294 3:176536376-176536398 TGTCTTCTGGGTCCTGCAGGAGG - Intergenic
972567958 4:40285813-40285835 GCCCTTCAGGGTGCTGACGGAGG + Intergenic
983034609 4:162848306-162848328 TCCCTTCTGCATACTGCTGTTGG - Intergenic
985850461 5:2384854-2384876 TCCCCTCTGGGTACAGCTTGCGG - Intergenic
986207218 5:5636238-5636260 TTCCTTCTGGGCTCTGCCAGAGG - Intergenic
987073223 5:14357709-14357731 TTCCTTCTGTGTGCTTCCGGGGG + Intronic
987320455 5:16764380-16764402 TCCCTGCTGTCTACTGCCTGTGG + Exonic
991035367 5:62122852-62122874 TACCTTCTAGGTACTGCTAGAGG + Intergenic
997609119 5:135199791-135199813 TACCTTCTGGGGAATGGCGGAGG - Intronic
998167574 5:139852918-139852940 TCTCCTCTGGGTCCAGCCGGGGG + Exonic
999073496 5:148772777-148772799 TCCCTTCTGGGAACACCCGGAGG - Intergenic
999241572 5:150130823-150130845 TCCCTTCTGGGTACTTCAAAGGG + Intronic
999247251 5:150161769-150161791 GCACTCCTGGGTACTGCTGGAGG - Intergenic
999262727 5:150247601-150247623 TCACTTCTGGGTACAGGCCGTGG + Intronic
1001585770 5:172833214-172833236 TCCCTTCTGAATCCTCCCGGAGG + Intergenic
1002173898 5:177390806-177390828 CCCCTTCTGGGGACTGAAGGAGG - Intronic
1002547140 5:179956729-179956751 GCCCTTCTGGGTCATGCCTGCGG - Intronic
1005146912 6:22701947-22701969 TCCCTTCTGGTTCCTGCCTGGGG + Intergenic
1009618884 6:66046042-66046064 ACCCTGGTGGGTACTGCCTGTGG - Intergenic
1010905411 6:81480619-81480641 TCCTTGCTGGGTACTACTGGGGG - Intergenic
1011182364 6:84635331-84635353 TGCCTTGTGGGGACTACCGGGGG - Intergenic
1013006370 6:106078118-106078140 TCCCTGCTGGGTGCTGCCAGAGG + Intergenic
1015020980 6:128474646-128474668 TCCCTTCTTGCTTCTGCCTGAGG - Intronic
1017985522 6:159440016-159440038 ACCCTGCAGGGTACTGCCTGGGG + Intergenic
1018698428 6:166408309-166408331 GCACTTCTGGGTACAGCAGGAGG + Intergenic
1023492426 7:40758215-40758237 TCCCTTCTTGGTAATGCTGAAGG - Intronic
1023509639 7:40937870-40937892 TCCCCTCTGGCTCCTGCCTGTGG - Intergenic
1024623946 7:51188347-51188369 GGCCTGCTGGGTACTGCTGGAGG - Intronic
1026523347 7:71134444-71134466 TCCCTGCTGGGTACTGGGGGAGG + Intronic
1029613381 7:101640200-101640222 TGCCTTCTGGATACTTCCTGAGG + Intergenic
1031688856 7:124764706-124764728 ACCCTCCTGGGACCTGCCGGCGG - Exonic
1034901230 7:154909298-154909320 TGCCTTGTGGGCACTGTCGGTGG - Intergenic
1035039029 7:155914142-155914164 TCCCTTCTGGGCCCTTCAGGTGG + Intergenic
1035397287 7:158543356-158543378 GCCCTGCTGGGAACAGCCGGCGG - Intronic
1045908245 8:107374762-107374784 TCCCTTCTGGGGACTGAGGGTGG - Intronic
1047967711 8:130058861-130058883 TCCCTTCTGGGCCGTGCGGGTGG + Intronic
1048209653 8:132444109-132444131 TCCTTTCTGTGTATTGCCAGAGG - Intronic
1052489758 9:29150242-29150264 TCATTTCTGGGTACTTTCGGAGG - Intergenic
1052832965 9:33230477-33230499 TCCCTTCTGGGCTGTGCCAGGGG - Intronic
1053739611 9:41125254-41125276 TCCCTTCTGGGTTCAGCGGCCGG + Intergenic
1054688740 9:68306066-68306088 TCCCTTCTGGGTTCAGCGGCCGG - Intergenic
1062724756 9:138065571-138065593 TCCTTTCTGGGTGCTGACGTTGG + Intronic
1192179789 X:68909279-68909301 TCCCTCCTGGGAACTGGCTGAGG - Intergenic
1192574386 X:72231063-72231085 TCACTTCTGGGTACTTCCAAAGG + Intronic
1198990988 X:142514801-142514823 ACCATTCTGGGTTCTGCAGGAGG + Intergenic