ID: 954717248

View in Genome Browser
Species Human (GRCh38)
Location 3:52533021-52533043
Sequence ACACCTCGATGTCGCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954717248_954717252 -4 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717252 3:52533040-52533062 GTGTGTCTGGGAAGTCCAACCGG 0: 1
1: 0
2: 0
3: 10
4: 123
954717248_954717253 8 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717253 3:52533052-52533074 AGTCCAACCGGTGTCCCCTTTGG 0: 1
1: 0
2: 0
3: 0
4: 50
954717248_954717255 13 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717255 3:52533057-52533079 AACCGGTGTCCCCTTTGGTCCGG 0: 1
1: 0
2: 1
3: 5
4: 49
954717248_954717260 24 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717260 3:52533068-52533090 CCTTTGGTCCGGCCGTCCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954717248 Original CRISPR ACACCTCGATGTCGCCCTGG AGG (reversed) Intronic
900703476 1:4061985-4062007 GCTCCTCCATGTCACCCTGGTGG - Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
920284070 1:204867121-204867143 ACCCCTAGATGTCAGCCTGGAGG + Intronic
922226238 1:223648283-223648305 ACAGCTCCATGTGGCCCAGGGGG - Intronic
1080647009 11:34194694-34194716 ACAGCCCGACGGCGCCCTGGTGG - Intronic
1084352607 11:68613566-68613588 ACAACTCCTTGTCGGCCTGGAGG - Exonic
1095975621 12:47939126-47939148 ACAACATGATGTGGCCCTGGAGG - Intronic
1096155691 12:49340170-49340192 ACACCTAGCTATAGCCCTGGGGG - Intergenic
1102952966 12:117042294-117042316 ACACCTCGGATTCTCCCTGGGGG - Intronic
1104478186 12:129087679-129087701 ACACCTTGATGTCGGCCCAGTGG + Intronic
1113767485 13:112890212-112890234 ACCCCTCACCGTCGCCCTGGGGG + Intergenic
1141951626 16:87343594-87343616 ACACCTGGATGTGGCCGTGGTGG + Exonic
1144633386 17:16887741-16887763 CCACCTCGCTGTCCCACTGGGGG - Intergenic
1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG + Intronic
1164004415 19:21135567-21135589 AAACCTGGAAGTCGCCCTGCTGG + Intergenic
1167209464 19:48124184-48124206 ACACGTGAATGTCCCCCTGGAGG - Intronic
932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG + Intronic
934551072 2:95261922-95261944 ACACCTCCATGTAGCTCTGAAGG - Intergenic
934735510 2:96687914-96687936 ACACCGCTGTGTCACCCTGGCGG - Intergenic
935740526 2:106143618-106143640 ACACCTTGATTTCTGCCTGGGGG - Intronic
936153253 2:110033027-110033049 ACACTTCGAGGGCTCCCTGGCGG - Intergenic
936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG + Intergenic
1171113696 20:22506202-22506224 ACACCAAGATGTCCACCTGGCGG - Intergenic
1182609872 22:31538385-31538407 ACACCTCCATTTCGACCTGCAGG - Intronic
1182904363 22:33922254-33922276 ACTCCTCGAGGTCGGGCTGGGGG + Intronic
1183069544 22:35386705-35386727 CCACATCTATGTGGCCCTGGAGG + Exonic
954717248 3:52533021-52533043 ACACCTCGATGTCGCCCTGGAGG - Intronic
955915688 3:63905752-63905774 ACACCTTGATGTAGACGTGGGGG + Intronic
959461215 3:106628290-106628312 ACACCTTGATGTCAACCTTGTGG + Intergenic
971253357 4:24991953-24991975 ACACCTCCATCTCCCCTTGGGGG - Intergenic
973203941 4:47538611-47538633 ACACCTCTATTTCAACCTGGTGG - Intronic
979629823 4:122887755-122887777 ACACCTCAAGGTTCCCCTGGAGG - Intronic
985139966 4:186829789-186829811 ACACCTCGATTTTGGCCTTGTGG + Intergenic
1002636082 5:180609518-180609540 ACATCTCCAAGTGGCCCTGGAGG + Intronic
1018928425 6:168222976-168222998 CTACCTCGATGAGGCCCTGGCGG - Intergenic
1033366813 7:140678340-140678362 ACACCTGGATGTGGCCCGGTGGG - Intronic
1034354541 7:150442400-150442422 ACACAACACTGTCGCCCTGGTGG - Intergenic
1043464046 8:80487241-80487263 AGACCTCGGTGTGGCCCTTGAGG + Exonic
1048624112 8:136165938-136165960 ACACCTGGATTTCAGCCTGGTGG - Intergenic
1188702503 X:33282226-33282248 CCACCTCGATGTCTTCCTGTCGG + Intronic
1196764749 X:119233020-119233042 ACACCTCTGTGTCCCCTTGGAGG - Intergenic