ID: 954717248

View in Genome Browser
Species Human (GRCh38)
Location 3:52533021-52533043
Sequence ACACCTCGATGTCGCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954717248_954717260 24 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717260 3:52533068-52533090 CCTTTGGTCCGGCCGTCCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 53
954717248_954717252 -4 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717252 3:52533040-52533062 GTGTGTCTGGGAAGTCCAACCGG 0: 1
1: 0
2: 0
3: 10
4: 123
954717248_954717255 13 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717255 3:52533057-52533079 AACCGGTGTCCCCTTTGGTCCGG 0: 1
1: 0
2: 1
3: 5
4: 49
954717248_954717253 8 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717253 3:52533052-52533074 AGTCCAACCGGTGTCCCCTTTGG 0: 1
1: 0
2: 0
3: 0
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954717248 Original CRISPR ACACCTCGATGTCGCCCTGG AGG (reversed) Intronic