ID: 954717252

View in Genome Browser
Species Human (GRCh38)
Location 3:52533040-52533062
Sequence GTGTGTCTGGGAAGTCCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954717236_954717252 27 Left 954717236 3:52532990-52533012 CCTTCGCTGCCCGGGCTGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 188
Right 954717252 3:52533040-52533062 GTGTGTCTGGGAAGTCCAACCGG 0: 1
1: 0
2: 0
3: 10
4: 123
954717248_954717252 -4 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717252 3:52533040-52533062 GTGTGTCTGGGAAGTCCAACCGG 0: 1
1: 0
2: 0
3: 10
4: 123
954717243_954717252 17 Left 954717243 3:52533000-52533022 CCGGGCTGAGAGGGGGCCGGACC 0: 1
1: 0
2: 3
3: 19
4: 196
Right 954717252 3:52533040-52533062 GTGTGTCTGGGAAGTCCAACCGG 0: 1
1: 0
2: 0
3: 10
4: 123
954717246_954717252 1 Left 954717246 3:52533016-52533038 CCGGACCTCCAGGGCGACATCGA 0: 1
1: 0
2: 0
3: 5
4: 46
Right 954717252 3:52533040-52533062 GTGTGTCTGGGAAGTCCAACCGG 0: 1
1: 0
2: 0
3: 10
4: 123
954717242_954717252 18 Left 954717242 3:52532999-52533021 CCCGGGCTGAGAGGGGGCCGGAC 0: 1
1: 1
2: 4
3: 26
4: 289
Right 954717252 3:52533040-52533062 GTGTGTCTGGGAAGTCCAACCGG 0: 1
1: 0
2: 0
3: 10
4: 123
954717249_954717252 -7 Left 954717249 3:52533024-52533046 CCAGGGCGACATCGAGGTGTGTC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 954717252 3:52533040-52533062 GTGTGTCTGGGAAGTCCAACCGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954717252 Original CRISPR GTGTGTCTGGGAAGTCCAAC CGG Intronic