ID: 954717260

View in Genome Browser
Species Human (GRCh38)
Location 3:52533068-52533090
Sequence CCTTTGGTCCGGCCGTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954717254_954717260 -10 Left 954717254 3:52533055-52533077 CCAACCGGTGTCCCCTTTGGTCC 0: 1
1: 0
2: 1
3: 12
4: 74
Right 954717260 3:52533068-52533090 CCTTTGGTCCGGCCGTCCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 53
954717248_954717260 24 Left 954717248 3:52533021-52533043 CCTCCAGGGCGACATCGAGGTGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 954717260 3:52533068-52533090 CCTTTGGTCCGGCCGTCCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 53
954717249_954717260 21 Left 954717249 3:52533024-52533046 CCAGGGCGACATCGAGGTGTGTC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 954717260 3:52533068-52533090 CCTTTGGTCCGGCCGTCCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 53
954717246_954717260 29 Left 954717246 3:52533016-52533038 CCGGACCTCCAGGGCGACATCGA 0: 1
1: 0
2: 0
3: 5
4: 46
Right 954717260 3:52533068-52533090 CCTTTGGTCCGGCCGTCCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954717260 Original CRISPR CCTTTGGTCCGGCCGTCCCT AGG Intronic