ID: 954720189

View in Genome Browser
Species Human (GRCh38)
Location 3:52554832-52554854
Sequence CTGGGCCCTGCAAAGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 301}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954720183_954720189 -2 Left 954720183 3:52554811-52554833 CCATGCTAACAAGGCCATCAACT 0: 1
1: 0
2: 0
3: 5
4: 108
Right 954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 301
954720178_954720189 25 Left 954720178 3:52554784-52554806 CCCCAGGGTGAAGTGGCTGCATG 0: 1
1: 0
2: 6
3: 19
4: 228
Right 954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 301
954720182_954720189 -1 Left 954720182 3:52554810-52554832 CCCATGCTAACAAGGCCATCAAC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 301
954720179_954720189 24 Left 954720179 3:52554785-52554807 CCCAGGGTGAAGTGGCTGCATGC 0: 1
1: 0
2: 0
3: 6
4: 160
Right 954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 301
954720180_954720189 23 Left 954720180 3:52554786-52554808 CCAGGGTGAAGTGGCTGCATGCT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 301
954720177_954720189 26 Left 954720177 3:52554783-52554805 CCCCCAGGGTGAAGTGGCTGCAT 0: 1
1: 0
2: 2
3: 21
4: 176
Right 954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 301
954720176_954720189 27 Left 954720176 3:52554782-52554804 CCCCCCAGGGTGAAGTGGCTGCA 0: 1
1: 0
2: 0
3: 24
4: 236
Right 954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954720189 Original CRISPR CTGGGCCCTGCAAAGGTGGA AGG Exonic
900470897 1:2854446-2854468 CTGTGCCCTGCTCTGGTGGACGG + Intergenic
900716272 1:4146949-4146971 TTGGGCCCTGCTGAGGTGGGTGG + Intergenic
900740451 1:4327823-4327845 CTGGTCCCAGGAAAGGTGCAAGG - Intergenic
900793503 1:4694100-4694122 CTGGGCCCCGTAAAGCTGGGAGG + Intronic
902335023 1:15749681-15749703 CTGGGTCCTGCATTGGGGGAGGG - Intergenic
902503511 1:16925554-16925576 CTGGCCCCCACAAAGTTGGAAGG + Intronic
903068569 1:20715341-20715363 CTGGGTTCTGAAAAGGTGGTGGG - Intronic
903366356 1:22807671-22807693 CAGTGCCCTACAATGGTGGAGGG + Intronic
903702925 1:25264058-25264080 CTGTACCCTGCAAAGGTACAGGG - Intronic
903712191 1:25334384-25334406 CTGTACCCTGCAAAGGTACAGGG - Intronic
904484543 1:30816179-30816201 CCTGCCCCTGCCAAGGTGGAGGG + Intergenic
904799288 1:33081480-33081502 CTGGCCCCCGCGAAGGAGGACGG + Exonic
904892168 1:33787724-33787746 CCAGTCCCTACAAAGGTGGAAGG - Intronic
907405038 1:54248692-54248714 CTGGGCCCAGACAAGGTTGATGG - Intronic
911449301 1:98044826-98044848 CAAGGCGCTTCAAAGGTGGAAGG - Intergenic
911470179 1:98308637-98308659 CTGGGCCCTGCAAATGTTAGAGG + Intergenic
911743079 1:101408860-101408882 CTGGAAACTGCAAAGCTGGAAGG - Intergenic
914387631 1:147187054-147187076 CAGGGCCCTGGAAAGTGGGATGG - Exonic
915145784 1:153795132-153795154 CTGGGCCCTGGCAACGGGGAGGG - Intergenic
915356067 1:155255684-155255706 CTGGAGCCTGAAAAGCTGGATGG - Intergenic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916253378 1:162761158-162761180 GTTGGCCCTGCTAAGGTGCATGG - Intronic
917120592 1:171641633-171641655 CTGGGCCTTGCAAACGTGAGAGG - Intronic
918093532 1:181316956-181316978 CTGGGCCTTGTAAAGATGGGTGG + Intergenic
918608551 1:186459209-186459231 CTAGGGCCTGAAAAGGAGGAAGG - Intronic
919653509 1:200174696-200174718 CTGGGGCCTTCAAAGGAAGAGGG - Exonic
920000759 1:202797089-202797111 CTGGGCCATTCAAAGGGGCAAGG + Intronic
920528058 1:206683489-206683511 CTCAGCCCTGCAGCGGTGGATGG - Intronic
920690189 1:208140413-208140435 CTGAGCCCAGCAAAGTGGGAAGG - Intronic
920831581 1:209470370-209470392 CTGCACCCTGCAAAGGTGTAGGG - Intergenic
922513323 1:226187088-226187110 CAGGCCCCTGCAAATGTGAAGGG - Intergenic
922895809 1:229099211-229099233 CTGGGACCTGGTGAGGTGGAAGG - Intergenic
922927755 1:229364565-229364587 CTGGGCCTTCCAAAGCGGGATGG + Intergenic
923033612 1:230268683-230268705 CTGGGCCCTGTGGAGGTGGCAGG + Intronic
923180558 1:231514568-231514590 CTGGGGACTCCAAAGGTAGAAGG - Intergenic
924422863 1:243925402-243925424 CTGGGCCCTGCACTGGGGAAGGG + Intergenic
1063367071 10:5497213-5497235 CTGTGCCCTGTCAGGGTGGAGGG + Intergenic
1063982504 10:11466007-11466029 CTGGGCAAAGCAAATGTGGAAGG + Intronic
1065699997 10:28415590-28415612 CTGGATACTACAAAGGTGGAAGG - Intergenic
1066327893 10:34383799-34383821 CTGTGTGCAGCAAAGGTGGACGG + Intronic
1067319598 10:45205475-45205497 CTGGGCCCTGTACAGCTGCAGGG + Intergenic
1068510387 10:57958224-57958246 CTGTGTCCTCAAAAGGTGGAAGG - Intergenic
1069777029 10:70933254-70933276 CTGGGCCCAGGTATGGTGGAAGG + Intergenic
1070772291 10:79089512-79089534 CTGGGCCCTGAAAACCCGGAGGG + Intronic
1070892080 10:79948472-79948494 CTGGGCACTGCAGGGGTTGAGGG - Intronic
1071354903 10:84784392-84784414 CTGGGCCTTTCAATGGGGGAGGG + Intergenic
1072106785 10:92282117-92282139 CTGGGCCATGCAATGGTCGAGGG - Intronic
1072751797 10:97986078-97986100 CTGGGCTCTGGGAAGGAGGAAGG + Intronic
1073639785 10:105240114-105240136 CAGGGCCCAGCAAGGGTGCAGGG - Intronic
1074535870 10:114328391-114328413 CTGGGCCCTGCACAGCTGCCTGG - Intronic
1074769490 10:116724072-116724094 CTGGGCCCTCCCCAGGTGCAGGG - Intronic
1075084483 10:119405331-119405353 CTGGGCCCTCCATAGATGCAGGG + Intronic
1076013763 10:127011608-127011630 ATGGGCCCTGAAAACGTGGGTGG + Intronic
1076271180 10:129153380-129153402 GTGAGCTCTGCAAAGGAGGAGGG + Intergenic
1076367916 10:129934224-129934246 CTGGGGTCTTCAAGGGTGGAGGG - Intronic
1076621331 10:131790095-131790117 CTCAGCCCTTCACAGGTGGATGG + Intergenic
1077322926 11:1950473-1950495 CATGGGCCTGCCAAGGTGGACGG - Intronic
1077373763 11:2195659-2195681 CAGTGCCCTGCAAAGCTGGGGGG - Intergenic
1078989925 11:16636197-16636219 CTGTGCCCTGCAAAGCTACAGGG + Intronic
1081806704 11:45894823-45894845 CTGGCTGCTCCAAAGGTGGATGG - Intronic
1082130973 11:48489064-48489086 CTGGGCCATGCAAGATTGGAAGG - Exonic
1085198999 11:74690276-74690298 CTGGGCCCTGCAAGTGTGAGGGG + Intergenic
1085425966 11:76404833-76404855 AGGTGCCCTGCAAAGGTGCAGGG + Exonic
1085830494 11:79895623-79895645 CTGAGCCCAGCAAAGCTGTAGGG - Intergenic
1088030049 11:105237578-105237600 CTGAGCCTTGGAAATGTGGAAGG - Intergenic
1088374355 11:109123892-109123914 CCGGGGCCTGGAAAGATGGATGG - Intergenic
1088603524 11:111506467-111506489 CTGGGGACTCCAAAGGTGGGTGG + Intronic
1089288081 11:117420360-117420382 CTGGGCCCAGTGGAGGTGGATGG - Intergenic
1089639481 11:119838332-119838354 GTGTGCACTGCAAAGGTCGAGGG - Intergenic
1089693318 11:120200006-120200028 CTGGGCCCTGTGAGGGGGGAGGG - Intergenic
1090105940 11:123853786-123853808 CTGCACCCTGCAAAGATGCAGGG + Intergenic
1091338913 11:134795277-134795299 CTGGGAGCTGCAGAGGGGGAGGG - Intergenic
1202805944 11_KI270721v1_random:5786-5808 CATGGGCCTGCCAAGGTGGACGG - Intergenic
1091832026 12:3556840-3556862 CTTTGCCTTGCACAGGTGGAGGG + Intronic
1092167966 12:6354679-6354701 GCTGGCCCTGCAAAGCTGGAGGG - Intronic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1100325220 12:93533810-93533832 CAGGGGTCTGCAAAGGGGGATGG + Intergenic
1101946586 12:109141903-109141925 CTGGGGCCTGGAGAGGTGAAGGG - Intronic
1102456937 12:113077003-113077025 CTTGGCCCTGGAGAGGTGGAGGG + Intronic
1103905745 12:124326464-124326486 ATGGGCCCTCCAAAGAGGGAGGG + Intronic
1104393957 12:128415458-128415480 CTGGGCCCGGTAAAGGCCGACGG - Exonic
1104749871 12:131231653-131231675 ATGGGCCCAGCAGAGGTGAATGG + Intergenic
1104822707 12:131687470-131687492 CTGGGCACTGCATAGGGGGAGGG - Intergenic
1106756156 13:32824915-32824937 CTGGGCCCTGAAGAAGAGGACGG - Intergenic
1106906354 13:34413617-34413639 CTGCTCACTGCCAAGGTGGAGGG + Intergenic
1108081503 13:46741884-46741906 AAGGACCCTGCAAAGGTTGAGGG - Exonic
1108845671 13:54676710-54676732 CTGGGCCCGGCAGCTGTGGAGGG + Intergenic
1109667049 13:65553274-65553296 CTGTGCCCTTCAATGGTGGTCGG + Intergenic
1110384586 13:74894002-74894024 CTGGGGCCTGTCAGGGTGGAGGG - Intergenic
1112051696 13:95649465-95649487 CTGTGCCCAGCAAAGCTGCAGGG - Intergenic
1113896040 13:113765048-113765070 CTGGTCCCCTCCAAGGTGGAAGG + Intronic
1118137313 14:63044871-63044893 CTGGGCTCTGGACAGGTGGGAGG + Intronic
1119230371 14:72974744-72974766 CTGGGAGCTGCAGGGGTGGAGGG - Intronic
1119436227 14:74599656-74599678 CTAGCCCCCGCCAAGGTGGAAGG + Intronic
1119560968 14:75589474-75589496 CTGAGCCCAGCAAAGCTGTAAGG - Intronic
1120738457 14:88081118-88081140 CTGAGCCATGCAAAGATGAAAGG - Intergenic
1122350348 14:101085974-101085996 CTGGGCCATCCTATGGTGGAAGG - Intergenic
1122417056 14:101555017-101555039 CTGGGCCCTGCCAGGCTGGGGGG + Intergenic
1122782605 14:104150001-104150023 CTGGCCCCTGCACAGGCTGAGGG - Intronic
1123054345 14:105562078-105562100 CCGTGCCCTGCACAGGGGGACGG - Intergenic
1123078929 14:105682497-105682519 CCGTGCCCTGCACAGGGGGACGG - Intergenic
1124056204 15:26242880-26242902 CAGGGCCCTGGAAGGGTGCATGG - Intergenic
1124598402 15:31110710-31110732 CTGTGCCCTCCAATGGAGGATGG - Intronic
1124835648 15:33194256-33194278 CTTGGCACAGGAAAGGTGGAGGG - Intronic
1125260912 15:37823773-37823795 CTGTGCTCTCCCAAGGTGGAAGG - Intergenic
1125407614 15:39369875-39369897 CTGTGCCCTGCAAAGCTTCAGGG - Intergenic
1126873621 15:53014569-53014591 CTGGGACCTGGAAGGGTGAAAGG - Intergenic
1127010257 15:54617918-54617940 TGGGGCCCAGCAAAGGTGCATGG + Intronic
1127883987 15:63183006-63183028 TTGGGCCCTGCATAGGTTCAGGG + Intergenic
1127930544 15:63594259-63594281 CTGGGCCCTGGAAAAGCCGATGG + Intronic
1129700176 15:77763304-77763326 CTGGGGCCTGGAGAGGAGGAGGG + Intronic
1129866108 15:78910019-78910041 CTCGGCCCTGTGAAGGTGGGCGG - Intergenic
1130866207 15:87935257-87935279 CTGAGCCCAGCAAAGGTGCCAGG + Intronic
1131981214 15:97996582-97996604 CTGGGCCCTGCACAGAAGGAGGG + Intergenic
1132639599 16:971540-971562 CTGGGTTGTGCAAAGGCGGAAGG - Intronic
1133032082 16:3015928-3015950 CTGTGCCCTGCCCATGTGGAAGG - Exonic
1133220449 16:4317170-4317192 CTGGGGCCTGGGAAGCTGGAAGG + Intronic
1133580343 16:7138638-7138660 CTGGGGCCTACAAAGGTGAAGGG + Intronic
1135527712 16:23226830-23226852 CTGGGGGCTTCAAAGGAGGAAGG - Intergenic
1136288752 16:29259212-29259234 CTGGGCACTGCCAACGTTGACGG + Intergenic
1136630316 16:31486056-31486078 CTGGGACCTGGAAAAATGGAGGG + Intronic
1136993113 16:35169374-35169396 GTGGGACCTCCAGAGGTGGAGGG + Intergenic
1137056484 16:35748745-35748767 CTGGGCCCTGGAAAGGGCAAAGG - Intergenic
1138315101 16:56062996-56063018 CTGGGGCCTACAAACCTGGATGG + Intergenic
1138518936 16:57559324-57559346 CTGGGCCCTGCATGAGTGCAAGG - Intronic
1139083404 16:63554308-63554330 CTGAGCCATGCAAAGGTCCAGGG + Intergenic
1139506460 16:67400347-67400369 CTGGGACCAGCCAAGGTGGCGGG + Intronic
1139866493 16:70065968-70065990 CGGGGCCCTGTAATGGTGGGCGG + Intergenic
1141253970 16:82383809-82383831 CGAGGCCCTGCAAACGTGCAAGG + Intergenic
1142094476 16:88232118-88232140 CTGGGCACTGCCAACGTTGACGG + Intergenic
1142157663 16:88539968-88539990 CGGGGCCTTGCAGAGGGGGAGGG + Intergenic
1142430180 16:90022238-90022260 GAGGGCCCTTCAAAGGTGGGCGG + Intronic
1142978101 17:3657065-3657087 CTGAGCCCTGCCAGGGAGGAGGG + Intronic
1143099422 17:4497273-4497295 CTCAGGCCTGCAAAGGCGGATGG - Intergenic
1144630952 17:16872218-16872240 CTAGGCCCAGTAAAGGTAGAGGG - Intergenic
1144745177 17:17609217-17609239 CTTGGCCCTTCAGAGGTGGAAGG - Intergenic
1147583245 17:41638498-41638520 CAGGGCCCTGGGAAGGTGGAGGG - Intergenic
1147791321 17:43015836-43015858 CTGGGCCCTGCCAAGGCGACAGG - Exonic
1148434640 17:47673430-47673452 ATGGTCCCAGCAAAAGTGGAAGG + Intronic
1148582080 17:48751263-48751285 CTGGTACCTGCAAAGGAGGGTGG - Intergenic
1149064721 17:52466064-52466086 CTGTGCCCTGCAAAGCTACAGGG + Intergenic
1150082567 17:62253526-62253548 CTGGGCCCTGCTTAGGGGAAAGG - Intergenic
1150247777 17:63689169-63689191 CTGGGCCCTGTAGAGGGGTAAGG + Intronic
1152186568 17:78860463-78860485 CTGTGCCATGGAAATGTGGATGG + Intronic
1152260314 17:79263184-79263206 CTGAGCCCTCCAAAGGTTGGGGG - Intronic
1152590846 17:81211253-81211275 CTGGGCGCTGGAAAGGTGTTCGG + Intronic
1156396502 18:36704455-36704477 CTGGGCTGTGCAAGGGAGGAGGG - Intronic
1157505471 18:48223154-48223176 CTGGGCTCTGCAGAGGTAGTGGG + Intronic
1158799546 18:60890203-60890225 CTGGGACCACCAAAGCTGGAAGG - Intergenic
1159749769 18:72285800-72285822 CTGGGGTCTGCGAAGGTTGAGGG + Intergenic
1160341444 18:78092604-78092626 CTGGGCCCTGCAAAAATTAAGGG + Intergenic
1160925464 19:1542877-1542899 CGGGGCCTTGCCAAGGTGCAAGG - Intergenic
1160965515 19:1745446-1745468 CTGGGGCCTGCCACGGTGGGGGG + Intergenic
1161130122 19:2583470-2583492 CTGGGGCGGGCAAAGCTGGAGGG - Intronic
1161130572 19:2586245-2586267 CTGGGGCGGGCAAAGCTGGAGGG - Intronic
1161509085 19:4660744-4660766 CTGGGGCCTGCAGAGGAAGAGGG + Exonic
1161626947 19:5332662-5332684 CTGGGCCTTGCGCAGGAGGATGG - Intronic
1161854252 19:6754419-6754441 CTGATGCCTGCAGAGGTGGAGGG + Exonic
1162825612 19:13249736-13249758 CAGGGCTCTGCTGAGGTGGAGGG + Intronic
1163008244 19:14409544-14409566 CTGGGCCATGCCCCGGTGGATGG + Exonic
1163738858 19:18998501-18998523 CTTGGACCTTCAAAGGCGGAGGG + Intronic
1164686933 19:30172788-30172810 CAGGGCACTGCAAGGGTTGAAGG + Intergenic
1165094607 19:33403317-33403339 CTGGACCCTGCAGACGTGGTGGG - Intronic
1165165199 19:33849215-33849237 TTGGGGCCTGCAAGGGTCGAGGG - Intergenic
1166281895 19:41799702-41799724 CTGGGCCCTGCGCTGGTGCAGGG - Intronic
1166718166 19:44982404-44982426 CTGGGCACTGCAAATATGGCTGG - Intronic
1167335847 19:48885336-48885358 CTGGTCCCTGAGCAGGTGGAAGG + Intronic
1167774508 19:51545857-51545879 CTGGAACCAGCACAGGTGGAGGG + Intergenic
1168313557 19:55473616-55473638 CTGGGGCCTGCAGGGGTGCAGGG + Intergenic
1168721162 19:58555740-58555762 GTGGGACCTCCAGAGGTGGAGGG + Exonic
926802881 2:16675957-16675979 CATGACCCTGCAAAGGTGGCAGG - Intergenic
927151742 2:20200183-20200205 CTGGGCCCTGCAGAGCAGGAGGG - Intergenic
927458177 2:23275394-23275416 CTGGGCCCTGCCTAGGTGAAGGG + Intergenic
928121182 2:28584652-28584674 CAGGGCACTGCAGAGGTGGCAGG - Intronic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
930033833 2:47073618-47073640 CTGGGCCAAGCACAGGTGCACGG - Intronic
931893793 2:66705860-66705882 CTGGTCCTTGCACAGGTGAATGG - Intergenic
931899614 2:66772914-66772936 CTGAGCCCTCCAGAAGTGGATGG - Intergenic
932639762 2:73432594-73432616 CTGTGCCCTCCCATGGTGGAAGG + Intronic
933840826 2:86284396-86284418 CTGTGCCCTGCACAGCAGGAAGG + Intronic
933992093 2:87641060-87641082 TTGGTTCCTGCAAAGGTGGGAGG + Intergenic
934077020 2:88437176-88437198 CCGGGCCCTGCAGAGGAGGTAGG - Intergenic
935128513 2:100244142-100244164 CTGGGCTCTGCTAGGGTGGCAGG + Intergenic
936145098 2:109975625-109975647 CTGGGCCCTGCACAGGTCGGTGG + Intergenic
936199587 2:110395853-110395875 CTGGGCCCTGCACAGGTCGGTGG - Intergenic
936301751 2:111309758-111309780 TTGGTTCCTGCAAAGGTGGGAGG - Intergenic
936905554 2:117532175-117532197 CTGGGCCCTGCAAAACTTAAGGG + Intergenic
936954558 2:118011735-118011757 CTGGGCCCTGCATCTGTGGTGGG - Intronic
936980006 2:118255531-118255553 CCGGGCCATGTAAATGTGGAGGG + Intergenic
937323793 2:120976846-120976868 CTGCTCCCTGGAAAGATGGATGG + Intronic
938086773 2:128407077-128407099 CTGGGGCCTGGCCAGGTGGACGG + Intergenic
938576816 2:132612060-132612082 CAGGGCACTGCAATGCTGGATGG - Intronic
939096127 2:137835450-137835472 CTGGGCCCTTCCCAGGTGGCTGG - Intergenic
942201349 2:173574559-173574581 CTGGACCCAGCACTGGTGGAGGG - Intergenic
944636478 2:201680392-201680414 CTGGGTCCTCCCATGGTGGAAGG + Intronic
945866615 2:215182851-215182873 TCAGGCCCTGCAATGGTGGAGGG + Intergenic
946172264 2:217902499-217902521 CGGGAGCCTGCAAAGGTGCAGGG + Intronic
946249800 2:218405246-218405268 CTGGGCCCAGGAAAGGGGCAAGG - Exonic
946404203 2:219483986-219484008 CTGGGCCGTGCAGGGCTGGATGG - Exonic
946578039 2:221097663-221097685 GTGGGGCCTGCACAGATGGAGGG - Intergenic
947516435 2:230808904-230808926 CTGGGCACTGCATAGGTGCTGGG + Intronic
948059290 2:235031635-235031657 CCTGGCCCTGCAAGTGTGGAGGG - Intronic
1168991685 20:2101825-2101847 CCCGGTCCTGCAAAGGTCGACGG - Exonic
1169056619 20:2627227-2627249 TTAAGCCCTGCCAAGGTGGAGGG - Intronic
1170928281 20:20745445-20745467 CTGGGGCCTGCTAAGTGGGAAGG - Intergenic
1171374777 20:24685152-24685174 CTGAGCCCTGCAGAGGTGAAGGG - Intergenic
1171396674 20:24838894-24838916 CTGAGCCCTGGTGAGGTGGATGG + Intergenic
1172280821 20:33706750-33706772 CTGGGTCCTGAAAATGTGGGTGG + Exonic
1173010452 20:39177003-39177025 CTGGGCCCTGCACAGGTGGGTGG + Intergenic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1175930825 20:62493000-62493022 CTGGGGCCTGCAGAGTGGGATGG + Intergenic
1176109235 20:63404036-63404058 CTGGGCCCTGGGAAGAGGGAAGG - Intergenic
1176168829 20:63688065-63688087 CTGGGCCCTGCTGGGGTGGGAGG + Intronic
1177657748 21:24041251-24041273 CTGGACCCTCCCATGGTGGAAGG - Intergenic
1177755034 21:25335767-25335789 CTGGGGCTAGCAAAGGTGGTAGG - Intergenic
1178111764 21:29376342-29376364 CAGGGCTCTGCAGAGGTGGGAGG - Intronic
1178590077 21:33902345-33902367 CTGGTTCCTGGAAAGGTTGAGGG + Intronic
1178590086 21:33902380-33902402 CTGGTTCCTGGAAAGGTTGAGGG + Intronic
1179640841 21:42746388-42746410 CTGGGGCCTTCAGAGGTGGCAGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180613493 22:17112588-17112610 CTGGGCCCAGGAAATGGGGAGGG - Exonic
1180997021 22:19970737-19970759 CTGGGCCCTGCAGAGGGAAAGGG + Exonic
1181028273 22:20137935-20137957 CTGGGCCCTGGACAAGAGGAAGG + Intronic
1182698189 22:32210268-32210290 ATGGGTCATGCAAAGGTGAAGGG - Intergenic
1184219409 22:43089575-43089597 CTGGGCCCCGAGAGGGTGGACGG - Intergenic
1184247581 22:43243442-43243464 CTGGGCCCTGCAGGGGAGGCCGG + Intronic
1184425527 22:44406991-44407013 CTGAGCCCTGCTAAGCTGGGAGG + Intergenic
1184632040 22:45789319-45789341 TTGGACCCTGCAAGGGTGGAAGG + Intronic
951405796 3:22296013-22296035 CTGGGCCATGCAAAGGTTATAGG - Intronic
951449324 3:22818912-22818934 CTGAGCCCTGCAAAGTCGCAGGG - Intergenic
952827823 3:37538591-37538613 CAGGGCCCTGGGAAGGTGGGTGG - Intronic
953256644 3:41297129-41297151 TTGGGCCCCTCAAAGATGGATGG - Intronic
953902334 3:46850310-46850332 CTAGCCCCGGGAAAGGTGGATGG - Intergenic
954140723 3:48603799-48603821 CTGGGCCCTGGAGGGGTGGGTGG - Intronic
954615498 3:51967164-51967186 CTGAGGCCTGCACAGGTGGGAGG - Intronic
954720189 3:52554832-52554854 CTGGGCCCTGCAAAGGTGGAAGG + Exonic
954792409 3:53143083-53143105 CTGGACACTGTAGAGGTGGAGGG + Intergenic
954888551 3:53900906-53900928 CTGTCCCCTGCAAAGAAGGAAGG - Intergenic
955499849 3:59572931-59572953 CGGAGCCTTGCAAAGGTGCAGGG - Intergenic
955820739 3:62893124-62893146 CTGTGACCTGAAAAGGTGGAAGG + Intergenic
956364386 3:68484239-68484261 CTGAGCCCTGGAAAGGTGGCTGG - Intronic
958893396 3:99804844-99804866 CTGAACCCTGCAAAGCTGTAGGG - Intergenic
959719415 3:109470147-109470169 CTGTGCCCTGCAAAGCTACAGGG + Intergenic
960587021 3:119329566-119329588 TGGGGCCTTGCAAAGGAGGAGGG - Intronic
961567823 3:127776178-127776200 CTGGGGCCTGGAAGGATGGAAGG - Intronic
961780554 3:129317867-129317889 CAGGTCCCTGCAGAGGAGGATGG + Intergenic
964780391 3:160330807-160330829 CTGGGCCATGGAGAAGTGGATGG - Intronic
966646601 3:182252505-182252527 CTGGTCCCTGGAGAGGTGGAGGG + Intergenic
967138331 3:186531432-186531454 CTGGGTCCTGCCATAGTGGAAGG - Intergenic
967567947 3:190993305-190993327 CTAGCCCCTGTAAATGTGGAGGG - Intergenic
968846328 4:3043804-3043826 CTGGGCCCTGCAACCCTGGTCGG - Intergenic
969956240 4:10893896-10893918 CTGAGCCCTGCAAAGGAGAAGGG - Intergenic
970901610 4:21165944-21165966 CTGTGTCCTCCCAAGGTGGAAGG - Intronic
973913192 4:55604782-55604804 CTGGGCCTTCCAAAGTTGAAGGG + Intronic
976050791 4:81009549-81009571 CTGTACCCTGCAAAGCTAGAGGG + Intergenic
977097890 4:92769312-92769334 CTGTGCCCTGCAAAGCTACAGGG - Intronic
977309999 4:95374180-95374202 CTGAGCCCGGCAAATGTTGAGGG - Intronic
978443924 4:108762911-108762933 CAGGGCGCTGCGAAGGTGCAAGG + Exonic
980541326 4:134200885-134200907 CTGGTCCCTGCAAATGCGGATGG + Exonic
982169644 4:152648516-152648538 CTGGGCCCTGGAAAAAGGGATGG + Intronic
982281201 4:153684721-153684743 CCGGGGCCTGCAAGGTTGGAAGG - Intergenic
982640047 4:157946949-157946971 CTTAGCTCTGCAAATGTGGAAGG + Intergenic
986516937 5:8574162-8574184 CTGGGACTTGGAAAGGAGGAAGG + Intergenic
995559393 5:113364425-113364447 CTGAACCCTGCAAAGCTGTAGGG - Intronic
997865126 5:137455278-137455300 CTGAGGCCAGAAAAGGTGGAGGG + Intronic
1001546141 5:172571481-172571503 CTGGGCTCTGCAAGGGGAGAAGG - Intergenic
1001603335 5:172943347-172943369 CTGGGCCCTGGAAAGGCTGGGGG - Intronic
1001855231 5:175004905-175004927 CTGGGCCCTGCAATTGGTGATGG + Intergenic
1002297389 5:178239173-178239195 CGGGGCCCTGGAAAGGAAGAAGG + Exonic
1002690030 5:181044209-181044231 CTGGGCCATGCAGAGGCAGAAGG - Intronic
1003439977 6:6131487-6131509 CTGGGCTCTGCGAAGATGGAGGG + Intergenic
1011567648 6:88694851-88694873 CTGGGCCATGCTGTGGTGGAAGG - Intronic
1012627240 6:101419235-101419257 ATGGGTCCTGGAAAGGTGAAAGG - Intronic
1012788133 6:103658139-103658161 CTGTGCCCTGCAAAGCTACAGGG - Intergenic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1013767997 6:113595983-113596005 CTGGGCCCTGCAAATGTTAGGGG + Intergenic
1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG + Intergenic
1017372093 6:153723022-153723044 CTGGCCCCTACCAAGGTGGTGGG - Intergenic
1017412617 6:154185219-154185241 ATGGGTCCTGCCAAGGAGGAGGG + Intronic
1018197904 6:161370916-161370938 CTGCTGTCTGCAAAGGTGGAAGG - Intronic
1019068395 6:169321795-169321817 CTGGGCCCTGCAGGGGCGCAAGG + Intergenic
1019109011 6:169694818-169694840 CAGCGCCCTGCAACGGTGGGAGG - Intronic
1024114290 7:46177755-46177777 CTGTGTCCTGACAAGGTGGAAGG - Intergenic
1024257620 7:47550185-47550207 CTGGGCCTTGGATAGGTGAAGGG - Intronic
1024833110 7:53484885-53484907 CTGTGCCCTGCCATGGAGGAAGG - Intergenic
1026211619 7:68311058-68311080 CTCTGCCCTGCAGAGATGGAGGG + Intergenic
1026731433 7:72914996-72915018 CTCTTCCCTGCAGAGGTGGAGGG - Intronic
1030080676 7:105775183-105775205 CCTGGCCCTGCAAAGGAGCAAGG + Intronic
1031457937 7:122007316-122007338 CTTGGCACTGCCAAGGGGGAGGG + Intronic
1034152241 7:148926112-148926134 GTGTGCCCTTCAAAGGAGGAGGG - Intergenic
1034745980 7:153524299-153524321 CTGGTCTCTGCAGAGGTGGGCGG - Intergenic
1035482903 7:159201877-159201899 CAGGGCCCTGCACATGTGGCCGG - Intergenic
1036719085 8:11155966-11155988 ATAGCTCCTGCAAAGGTGGAAGG - Intronic
1038255507 8:25947570-25947592 CTAGGCCAAGCAAAGGTGTATGG - Intronic
1038353858 8:26807859-26807881 TTGGACCTTGCAAAGGAGGAGGG - Intronic
1041100579 8:54392703-54392725 CGGGGTCCTGCAAGGGTAGAGGG - Intergenic
1045293205 8:100851396-100851418 ATGAGCCCTGCAAGGGTGGCAGG + Intergenic
1045496413 8:102713098-102713120 CTGGGTCCTGCAAATGTTAAGGG + Intergenic
1046795839 8:118370771-118370793 CTGGGGCCTGTCAGGGTGGAGGG + Intronic
1047552499 8:125890359-125890381 CTGGGGACTTCAAAGGTGGGAGG - Intergenic
1049193697 8:141303864-141303886 CTGGGCCCAGTAGAGGTGGGAGG + Intronic
1049225742 8:141449722-141449744 CAGGGCCCTCCACAGCTGGAAGG + Intergenic
1049301597 8:141873537-141873559 CTGGCGCCTGCACAGGTGGGCGG - Intergenic
1052990220 9:34514624-34514646 CGGGGTCCTGCAGAGGTGGAGGG - Exonic
1055674963 9:78648730-78648752 CTGGGGCCTGTCAGGGTGGAGGG + Intergenic
1055864775 9:80799948-80799970 ATGGTCCCTGCAAGGGTGGTTGG - Intergenic
1055985184 9:82051582-82051604 CTGGGGGCTCCAAAGGGGGAAGG - Intergenic
1056628973 9:88276948-88276970 ATGGCCCCTGCAAAAGTGAAGGG - Intergenic
1057719437 9:97520114-97520136 CAGGGCCCTGCAAAGGGTTAGGG - Intronic
1058230386 9:102417562-102417584 CTGTACCCTGCAAAGCTGCAGGG + Intergenic
1058867029 9:109170042-109170064 CTGGGCCCTGAAAAGGCATAAGG - Intergenic
1059405581 9:114096923-114096945 CAGGGCCCTGGAAGGGTGGAGGG + Intronic
1061421691 9:130476221-130476243 CTGGGGCCTCCGAAGGTGGGAGG + Intronic
1062012924 9:134276482-134276504 CTGGGGCCGGCAGGGGTGGATGG - Intergenic
1062578145 9:137218008-137218030 CTGGGCCCTTCCAACCTGGAAGG + Intergenic
1062686876 9:137818301-137818323 CTGTGCCCTGCATGGATGGAGGG + Intronic
1186409196 X:9331285-9331307 CTGGGTCCTATAGAGGTGGAGGG - Intergenic
1186414454 X:9371094-9371116 CTGGGGCATGCAAACGCGGAAGG - Intergenic
1186621495 X:11245476-11245498 CAGGGCCTTGATAAGGTGGACGG - Intronic
1189224603 X:39402325-39402347 CTGGAGCCTGCTAAGGTGGGTGG + Intergenic
1190212430 X:48459198-48459220 ATGGGTCCTGGGAAGGTGGAAGG - Intronic
1194084546 X:89509840-89509862 CTGAGCCCTGCAAAGGGACAGGG - Intergenic
1195411915 X:104576907-104576929 TTGGGCCCTGCAGAGGTGCTAGG + Intronic
1198466522 X:136909231-136909253 CTAGGCCCTGCACAGGTTGGGGG - Intergenic
1200398016 X:156002550-156002572 CTGGGCCCGGGAATGGGGGATGG + Intronic