ID: 954720831

View in Genome Browser
Species Human (GRCh38)
Location 3:52561457-52561479
Sequence GTAAGCACACATGTTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954720831_954720834 30 Left 954720831 3:52561457-52561479 CCTAGCTCAACATGTGTGCTTAC 0: 1
1: 0
2: 1
3: 8
4: 103
Right 954720834 3:52561510-52561532 TTTTTAGTAGCAAAATATTTTGG 0: 1
1: 0
2: 8
3: 83
4: 833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954720831 Original CRISPR GTAAGCACACATGTTGAGCT AGG (reversed) Intronic
900416240 1:2536023-2536045 TTGAGCACACATGCTGAGCTGGG + Intergenic
902178714 1:14671089-14671111 CTAATCACAGATGTTGAGCCAGG + Intronic
902236725 1:15062433-15062455 GCATGCACACCTGTTGAGATGGG - Intronic
913988029 1:143583661-143583683 GGAAGCACTCATGTTGAGTGAGG - Intergenic
915002105 1:152603093-152603115 TTAAGCACACATGTAGGCCTGGG + Intergenic
916444341 1:164858128-164858150 GCAAGCACACTGATTGAGCTGGG - Intronic
921654989 1:217723914-217723936 GGCAGCAGACATGCTGAGCTTGG - Intronic
923030636 1:230246700-230246722 GTAGGCACAGGTGTTGGGCTGGG - Intronic
924413150 1:243828249-243828271 CTAATCACACATTATGAGCTTGG + Intronic
1063856806 10:10264273-10264295 GTAACCACACAGCTTCAGCTTGG - Intergenic
1064246317 10:13670140-13670162 GCAAGCAGCCACGTTGAGCTTGG - Intronic
1064513801 10:16124383-16124405 GGAGGAACACAAGTTGAGCTTGG - Intergenic
1072962782 10:99944286-99944308 TTGAGCACACATGATGAGCCAGG - Intronic
1076004402 10:126936733-126936755 GTAAGCACACATGTTCACCAGGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1083876507 11:65526783-65526805 GTCAGCAGACATGTGGCGCTTGG + Exonic
1084305208 11:68278220-68278242 GAAAACCCACATGTTGGGCTGGG - Intergenic
1085824124 11:79825004-79825026 ATTAGCACACATGTTTAGCCAGG - Intergenic
1089166279 11:116479180-116479202 TTAAGCACACAGGTTGTGCACGG - Intergenic
1092490914 12:8944059-8944081 GTAAGCAAACAAGTTTAGCTTGG - Intronic
1093363336 12:18259973-18259995 GTAAGCGTACATGTTAAGCAAGG + Intronic
1094278706 12:28709654-28709676 ATAAACACACATATAGAGCTAGG - Intergenic
1094649642 12:32362759-32362781 GTTAATACACATGCTGAGCTTGG + Intronic
1095541442 12:43312837-43312859 GTAAGCTTACAAGTTGATCTGGG - Intergenic
1103976221 12:124704651-124704673 GGAAGCACCCATGGGGAGCTTGG - Intergenic
1108582342 13:51838093-51838115 GTAAGGAGACAGGTTGAGGTAGG + Intergenic
1110969134 13:81739481-81739503 ATCAGCACCCATGTTGAGCTGGG + Intergenic
1111927817 13:94481887-94481909 GAAAGCACACATGGGGAGGTGGG - Intergenic
1112186811 13:97135788-97135810 GTAAGCATTCATGTTGAGAGTGG + Intergenic
1112968227 13:105225685-105225707 ATAAGTACACATTTTGAACTTGG + Intergenic
1114570622 14:23664815-23664837 GTAAGCACACATGCTGATGGTGG + Intergenic
1122505431 14:102228796-102228818 GTAAGGACACATGTTGGACTCGG + Intronic
1130106256 15:80930898-80930920 ATAAGCATACATGTTGGGTTTGG + Intronic
1137601096 16:49756774-49756796 GGAAGCACCCATGATGAGTTCGG + Intronic
1137683532 16:50370591-50370613 GTAAACCCACAGGTTGAGCCTGG - Intergenic
1137836142 16:51594426-51594448 GTAAGGACACATGGTAAGATGGG - Intergenic
1140918193 16:79512540-79512562 GTCAGCTCAGATGGTGAGCTGGG - Intergenic
1141354080 16:83327009-83327031 GAAAGAAAAGATGTTGAGCTAGG + Intronic
1141354189 16:83328178-83328200 GAAAGAAAAGATGTTGAGCTAGG + Intronic
1141739057 16:85878176-85878198 GAAAGCACACACTTTCAGCTGGG + Intergenic
1149291663 17:55223833-55223855 GTCAGACCACATCTTGAGCTAGG + Intergenic
1154223480 18:12478465-12478487 GCACGCACACATGTGTAGCTAGG + Intronic
1157321249 18:46636337-46636359 GTAGGCACAGAAGGTGAGCTGGG - Intronic
1158492191 18:57920291-57920313 GTAACCAAGAATGTTGAGCTTGG - Intergenic
1162877996 19:13635219-13635241 GAAAGCTCATAAGTTGAGCTGGG - Intergenic
927315101 2:21672660-21672682 ATAAGCATAAATGTTGGGCTTGG - Intergenic
932759577 2:74430534-74430556 GTAAGAATAGATGTTGAGATGGG + Intronic
934536393 2:95137851-95137873 GTAATCACTAATGTTGAGGTTGG + Intronic
936936108 2:117839666-117839688 GTAAGCAGCCATCTTGGGCTAGG + Intergenic
937773006 2:125744045-125744067 GTAAGTAGATATCTTGAGCTTGG - Intergenic
940637820 2:156320027-156320049 GTGAGCACACGTGTGGAGCATGG + Intergenic
944385625 2:199160886-199160908 TTAAGCACACATTCTGAACTTGG - Intergenic
1173256643 20:41398464-41398486 CTAAGCACAAATGATGAGCAAGG - Intergenic
1173438593 20:43055315-43055337 GGAAGCACATAAGTTTAGCTTGG + Intronic
1174327118 20:49788200-49788222 GTATACACATATGTTGAGATGGG - Intergenic
1175533813 20:59693321-59693343 TTAAAAACACTTGTTGAGCTTGG + Intronic
1176014075 20:62919754-62919776 GCAAGCTCACATGGGGAGCTTGG - Intronic
1177557397 21:22710068-22710090 TAAAGCACACATGTTGAAATAGG + Intergenic
1178192303 21:30298533-30298555 GTTAGCACACATGTTTTGATAGG + Intergenic
1179469048 21:41598294-41598316 GTAAGAAAACATGTTGGGGTTGG - Intergenic
1181267134 22:21636910-21636932 GCAGGCAGACATGTAGAGCTTGG - Exonic
952215125 3:31270784-31270806 GGGAGCATACATTTTGAGCTAGG - Intergenic
954720831 3:52561457-52561479 GTAAGCACACATGTTGAGCTAGG - Intronic
955458666 3:59154768-59154790 GTAAGCACACATATTGGGGTTGG + Intergenic
955549494 3:60068295-60068317 GAAAGCAAACATTTTCAGCTTGG - Intronic
958445616 3:94211081-94211103 GTAATCACAAATATTGAGATGGG + Intergenic
961862025 3:129924838-129924860 GCAAGCAAACATGTAGACCTGGG - Intergenic
963759264 3:149270010-149270032 TTCAGCACACATGGTGAGATTGG + Intergenic
965428400 3:168556084-168556106 GGAAGCAGACATAGTGAGCTAGG + Intergenic
967230459 3:187333009-187333031 GAAAGCAAAGATCTTGAGCTGGG + Intergenic
970272900 4:14366371-14366393 GTTACCACACACGGTGAGCTGGG - Intergenic
971904892 4:32713855-32713877 GTAAGCATAAATGTTTATCTGGG - Intergenic
974666351 4:64967749-64967771 GTAATCACACATGTTTCACTTGG - Intergenic
978729686 4:112011407-112011429 GTAAGCACACTTGGTGTGATAGG - Intergenic
981430575 4:144654276-144654298 GTCACCACATATGTTGATCTGGG - Intronic
981811303 4:148778807-148778829 ATAAGCACACATGTTAGCCTAGG + Intergenic
982539239 4:156646735-156646757 TTAAGCACATATGTTGAGCTTGG + Intergenic
984364306 4:178778407-178778429 ATATGCACACATGCAGAGCTTGG - Intergenic
989785375 5:45321245-45321267 TTAAGCCCCCATTTTGAGCTAGG + Intronic
989815769 5:45735699-45735721 GTTAGCACATATGTTAACCTTGG - Intergenic
990785460 5:59413625-59413647 GTTAGCACATATATTGATCTAGG + Intronic
1001324104 5:170707634-170707656 GTCAGCACAAATGTTGAGGTGGG - Intronic
1003124577 6:3346226-3346248 GTCAGCAGAGACGTTGAGCTGGG - Intronic
1003218170 6:4134436-4134458 TTAAGCACACATAGTGAGCGGGG + Intronic
1004259354 6:14094901-14094923 GTAAGCAGACATCTCCAGCTGGG - Intergenic
1004872972 6:19926102-19926124 GGAAGCTAACATGTTGAGGTGGG - Intergenic
1005509559 6:26500354-26500376 GTAACCACACATACTGACCTGGG - Intergenic
1005649162 6:27870657-27870679 TGAAGCACACATCTTGACCTAGG - Intergenic
1005679858 6:28195799-28195821 GTAAGCAAAAATATTGGGCTGGG - Intergenic
1005699673 6:28387876-28387898 GTCAGTACAAATGTTGGGCTCGG - Intronic
1007303427 6:40886226-40886248 ATGAGCACACAGGATGAGCTAGG + Intergenic
1009757549 6:67958695-67958717 GTAAGCAAAAGTGTTGAGATAGG - Intergenic
1011870643 6:91887798-91887820 GTAAGCATATACGTAGAGCTTGG - Intergenic
1012166265 6:95956533-95956555 GGAATCACACATCTTGATCTAGG + Intergenic
1014554127 6:122825557-122825579 GAAAGCAGACATGTTAAGCAAGG - Intergenic
1017360381 6:153562638-153562660 GTAAGCACACACGTGCAGTTTGG - Intergenic
1020446957 7:8278974-8278996 GTAGGAACACATGATAAGCTTGG + Intergenic
1023337581 7:39186462-39186484 ATAAGCACACATGTAGATATAGG - Intronic
1033255085 7:139793639-139793661 GAAAGCTTACATGTTGAGCCAGG + Intronic
1033846326 7:145436407-145436429 AAAAGCACATAAGTTGAGCTAGG - Intergenic
1034979011 7:155463951-155463973 GTAAACACACATATTTATCTTGG - Exonic
1037018479 8:13938389-13938411 GTAAGGACACATACTGTGCTAGG - Intergenic
1039025872 8:33257256-33257278 TTAGGCATACATGATGAGCTGGG - Intergenic
1041252287 8:55946109-55946131 GGAAGCACACTCATTGAGCTGGG + Intronic
1041510743 8:58652497-58652519 GCAGCCACACATGCTGAGCTGGG + Intronic
1041929176 8:63268327-63268349 ATAAACACACATCTTGAGCATGG - Intergenic
1045499645 8:102735272-102735294 TTCTGCACACATGTTGAGTTAGG + Intergenic
1048204719 8:132406185-132406207 GTCAGAACAGATGTTGGGCTTGG + Intronic
1056694138 9:88832124-88832146 GCAGGCACACATGTTGAGGAAGG + Intergenic
1059831289 9:118099291-118099313 CTAAGAACAGATGTTGAGTTAGG + Intergenic
1061648240 9:132024117-132024139 AGAATCACTCATGTTGAGCTGGG - Intronic
1194698713 X:97087906-97087928 GTAAGAATGCATGATGAGCTGGG - Intronic
1197614747 X:128678862-128678884 GTATGCACATATGGTCAGCTAGG + Intergenic