ID: 954722761

View in Genome Browser
Species Human (GRCh38)
Location 3:52579775-52579797
Sequence CAGTGGGAATTGAGAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 379}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954722761_954722768 17 Left 954722761 3:52579775-52579797 CCTCCTGCTCTCAATTCCCACTG 0: 1
1: 0
2: 2
3: 48
4: 379
Right 954722768 3:52579815-52579837 AAAAACTGGAGAGGATTTATCGG 0: 1
1: 0
2: 3
3: 23
4: 330
954722761_954722766 3 Left 954722761 3:52579775-52579797 CCTCCTGCTCTCAATTCCCACTG 0: 1
1: 0
2: 2
3: 48
4: 379
Right 954722766 3:52579801-52579823 TTAGAAACAAACAAAAAAACTGG 0: 1
1: 7
2: 39
3: 567
4: 4118
954722761_954722767 8 Left 954722761 3:52579775-52579797 CCTCCTGCTCTCAATTCCCACTG 0: 1
1: 0
2: 2
3: 48
4: 379
Right 954722767 3:52579806-52579828 AACAAACAAAAAAACTGGAGAGG 0: 1
1: 5
2: 71
3: 451
4: 3539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954722761 Original CRISPR CAGTGGGAATTGAGAGCAGG AGG (reversed) Intronic
900377522 1:2362973-2362995 CAGAGGAAAATGAGAGCAGATGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902920620 1:19664637-19664659 CAGGCGGAACTGGGAGCAGGGGG - Intergenic
903002540 1:20276571-20276593 CAGTGGGAAATGGGAACAGGGGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903337818 1:22636677-22636699 CAGTTGGAGTTGACAACAGGAGG + Exonic
903646470 1:24899070-24899092 CAGTGGGGATTGGGAGTAAGCGG - Intergenic
905043595 1:34979105-34979127 CAGTTGGGATTGACAGCAGCAGG - Intergenic
905309082 1:37037196-37037218 CAGTGGGTGTGGAGAGCAAGAGG - Intergenic
907456616 1:54580471-54580493 CTGGGGCAAATGAGAGCAGGTGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908418010 1:63932291-63932313 GAGTGGGAATGGAGAGGAAGTGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909528522 1:76654844-76654866 CAGAGGGAAGTGCGAGGAGGTGG + Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912552047 1:110490724-110490746 CAGTAGGTGCTGAGAGCAGGAGG + Intergenic
912588046 1:110784705-110784727 TAGTGGGAATTGAGAGAAACAGG - Intergenic
913322417 1:117598342-117598364 CTGTGGGGTTTCAGAGCAGGAGG - Intergenic
913594052 1:120356382-120356404 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914093204 1:144522608-144522630 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
914305320 1:146411280-146411302 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
914596737 1:149161532-149161554 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
916520327 1:165557837-165557859 CAGTGGCAATGGAAAGCAAGAGG - Intronic
918485994 1:185028583-185028605 CAGGAGGAAGAGAGAGCAGGGGG + Intergenic
918656862 1:187037654-187037676 TTGTGGTAATTGAGAGCAGAAGG - Intergenic
919139540 1:193553522-193553544 CTGTAGGAATTGGGAGCAAGGGG - Intergenic
920335807 1:205244452-205244474 AAGTGTTTATTGAGAGCAGGAGG + Intronic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
920742540 1:208595297-208595319 CAGTGGTAATAGGGAGGAGGAGG + Intergenic
923124451 1:231023043-231023065 CAGTGGGAACTGAGGACTGGAGG - Intronic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924284694 1:242474458-242474480 CAGTGGGAATTGAGAAGAAAGGG - Intronic
924369890 1:243336552-243336574 CAGGAGGAAGAGAGAGCAGGGGG + Intronic
924430937 1:243995835-243995857 GAGTTGGAAATGAGAACAGGAGG - Intergenic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
1063230711 10:4063277-4063299 CTGTGGGGAGTGGGAGCAGGGGG + Intergenic
1064566040 10:16640355-16640377 CAGTGGAAACTCAGACCAGGGGG - Intronic
1064723004 10:18248977-18248999 CAGGTAGAATTGAGTGCAGGTGG - Intronic
1066058766 10:31704299-31704321 CAGTGGGAAGGGGGAGCATGCGG + Intergenic
1066067378 10:31772198-31772220 CAGTGCCAAGGGAGAGCAGGAGG + Intergenic
1066479936 10:35785950-35785972 CAGGGGGACTTGAGTGCACGTGG + Intergenic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067517836 10:46968832-46968854 CAGTGGGAACTGAGAGATGGGGG - Intronic
1067644412 10:48082997-48083019 CAGTGGGAACTGAGAGATGGGGG + Intergenic
1067729229 10:48797203-48797225 CATGGGGACTTGAGAGCAAGTGG + Intronic
1067993670 10:51244490-51244512 CAGGGGGAATTGGGAGGAGGAGG - Intronic
1068919606 10:62468909-62468931 CAATGGGAATTGTAAGCAAGTGG + Intronic
1070104544 10:73418770-73418792 CAGTAGGTATGGAGAGCAAGAGG - Intergenic
1072018954 10:91379781-91379803 CAGGGGCAAGTGAGAGGAGGGGG + Intergenic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1073059495 10:100724798-100724820 CTGTGGGAGTTGGGAGCTGGGGG - Intergenic
1074058071 10:109940675-109940697 AATTGAGAATTGAGAGGAGGAGG + Intergenic
1074301244 10:112234983-112235005 GAGTGGGCGGTGAGAGCAGGAGG + Intergenic
1074912633 10:117925444-117925466 CAGGGGGAGGTAAGAGCAGGCGG - Intergenic
1075262081 10:120971858-120971880 CCGGGGGAGTTGAGAACAGGTGG - Intergenic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1077356062 11:2118517-2118539 GAGTGGGGAGTGAGAGCAAGCGG + Intergenic
1077909144 11:6558921-6558943 CACTGGGAATTGAGGCCTGGAGG - Exonic
1078059716 11:8035423-8035445 CAGCGGGAAGTGAGAGCAGTGGG - Intronic
1078171944 11:8934678-8934700 CAGTGGGATTTCAGTGGAGGAGG + Intergenic
1078579552 11:12527692-12527714 CAGCGAGAATTCAGAGCAGGGGG - Intronic
1078596602 11:12692614-12692636 CCGTGGGCACTGAGAGTAGGGGG + Intronic
1078706442 11:13748312-13748334 CAGTGGTTAAGGAGAGCAGGAGG - Intergenic
1079351766 11:19697861-19697883 CAGTGGGAAAAAGGAGCAGGAGG - Intronic
1079849234 11:25510159-25510181 CAGTGGAATTTGATAACAGGTGG + Intergenic
1081269356 11:41065149-41065171 CAGTGGGAATTGCAAGCCAGTGG - Intronic
1081998741 11:47380670-47380692 GAGTGGGAATTTAAAGCAAGGGG - Intergenic
1083301784 11:61743506-61743528 CAGAGGGAGAGGAGAGCAGGGGG - Intronic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084554202 11:69865981-69866003 CAGATGGAATTGTGAGCATGGGG - Intergenic
1084982720 11:72840017-72840039 GAGTGGGAAGAGAGAGCAGTGGG - Intronic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1086938912 11:92774855-92774877 GAAAGGGCATTGAGAGCAGGAGG + Intronic
1087607512 11:100394680-100394702 CATTGGAAATTGAGATGAGGTGG + Intergenic
1087635609 11:100697864-100697886 CGGTGGGAGTGGAGAGCAAGGGG + Intronic
1088695480 11:112362482-112362504 AAGTAGGAAATGAGGGCAGGGGG + Intergenic
1088908871 11:114175693-114175715 CAGTGGGAAATGAGAGAGGCAGG + Intronic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090687058 11:129133132-129133154 CAGGGGGAAGAGTGAGCAGGAGG + Intronic
1092783077 12:12005213-12005235 AAGTGGGACTTGAAAGCAGAAGG - Intergenic
1094120129 12:26964152-26964174 CATTGGCATTTGAGAGCAGCAGG - Intronic
1096589374 12:52647333-52647355 CAGTGAGTATTGAGGGCAGCTGG - Intronic
1096621429 12:52867996-52868018 CAGGGGGAACTGAGAGGTGGGGG + Intergenic
1097188313 12:57207647-57207669 CAGTGGGAATGGTCAGCAGCTGG + Intronic
1097405954 12:59190584-59190606 AAGTGGGAATTGAGAACACATGG + Intergenic
1097608203 12:61782019-61782041 CAGTGGGATTTGAGACTAGGAGG + Intronic
1097705385 12:62863270-62863292 CTTTGGGAGGTGAGAGCAGGGGG - Intronic
1097823101 12:64147365-64147387 CAGCAGGAATTGGGAGGAGGAGG - Exonic
1099661263 12:85566520-85566542 AAGTGGGAAGTGATACCAGGTGG + Intergenic
1100136161 12:91556322-91556344 CAGTAAGAATTGAGACCATGAGG + Intergenic
1100454165 12:94735670-94735692 CAGAGAGAATTCAGAGCAGTAGG + Intergenic
1102819306 12:115894511-115894533 CACTGGAATTTTAGAGCAGGTGG + Intergenic
1103361279 12:120355865-120355887 CTCTGGGAATTCAGAGGAGGGGG - Intronic
1104581149 12:130011724-130011746 CAGGAGGAAGAGAGAGCAGGAGG + Intergenic
1104672247 12:130688789-130688811 CAGTTGGAATTGGGGGCCGGAGG - Intronic
1104830539 12:131747815-131747837 CAGTGGGAATGTTGAGTAGGTGG + Intronic
1105065523 12:133194057-133194079 GAGTGGGAATTGAGACGATGAGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1106153469 13:27129478-27129500 CTTTGGGAAGTCAGAGCAGGAGG + Intronic
1106977233 13:35234561-35234583 CAGTGGGAAATGAGACTAGATGG + Intronic
1107677619 13:42813134-42813156 CAGGAGGAATAGAGAGCAGGAGG - Intergenic
1108186116 13:47890063-47890085 CAGTGGAAAATGAGTGGAGGGGG - Intergenic
1108878079 13:55073135-55073157 CAGAGGGAAAGGAGAGCAGGAGG + Intergenic
1109844880 13:67975811-67975833 CAGGGGGAAGTGTTAGCAGGGGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113346809 13:109486190-109486212 CAGGAGGAATAGAAAGCAGGGGG - Intergenic
1117375590 14:55115661-55115683 GACTGGGACTTGGGAGCAGGAGG + Intergenic
1117930755 14:60838630-60838652 CAGTGGGAGCTGGGAACAGGTGG + Intronic
1118243104 14:64080925-64080947 TAATGGGAATTTAGGGCAGGTGG + Intronic
1118416405 14:65541511-65541533 CTCTGGTATTTGAGAGCAGGAGG + Intronic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1120949120 14:90024572-90024594 CAGTGGGTATTGTGTGCAGTAGG + Intronic
1121530549 14:94649745-94649767 CAGTGTGAATGGGGAGCACGGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121607659 14:95253135-95253157 CAGTGGGCATGGAGCTCAGGAGG - Intronic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122407521 14:101509140-101509162 CCATGGGAATTGATGGCAGGTGG + Intergenic
1123007703 14:105332392-105332414 CAGTGGGGAGTGAGAGGAGCAGG + Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128378971 15:67097662-67097684 GAGCGTGAAATGAGAGCAGGGGG + Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129875880 15:78975138-78975160 CAGTGGGATTTGAGAGGTTGAGG + Intronic
1130427092 15:83812272-83812294 CAGTGAGAAGTAACAGCAGGGGG - Intronic
1130763963 15:86851451-86851473 CCCTGGGCATTGAGAACAGGAGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130992020 15:88881308-88881330 CACTGGGACCTGAGAGCAGAGGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133080160 16:3312263-3312285 CAGAAGGAATTGAGATCAGATGG + Intronic
1133291492 16:4725076-4725098 CAGTGGGAATAGCCAACAGGTGG - Intronic
1133385336 16:5365186-5365208 CAGTGGGAAATGGGAACAGGCGG - Intergenic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136476246 16:30515458-30515480 CAGTGGGAAGTCACAGAAGGTGG - Intronic
1136490634 16:30605535-30605557 CACTAGGAATTGAGACCAGGGGG - Intronic
1137327015 16:47450150-47450172 CAAGAGGAATTGAGTGCAGGTGG - Intronic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1138711566 16:58976335-58976357 CAGTGGGAGTAGTGAGCTGGAGG + Intergenic
1140051080 16:71481791-71481813 CAGAGGGAATTGTGAGAACGAGG - Intronic
1140191708 16:72823091-72823113 GAGTGGGGAGTGAGAGAAGGGGG + Intronic
1140943861 16:79749198-79749220 GAGTGGGAAGTGAGAGAGGGAGG - Intergenic
1141506912 16:84483848-84483870 CAGTGGGGCTTGAGAGCATCGGG + Intronic
1142350032 16:89575664-89575686 CGGCGGGAAATGAGGGCAGGGGG - Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142888845 17:2929974-2929996 CAGAGGGAAGGGTGAGCAGGTGG - Intronic
1143020938 17:3916939-3916961 CAGTGGGAGAGGAGAGCTGGGGG - Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146499750 17:33354304-33354326 TAGTGGGGATGGAGAGCATGAGG - Intronic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146797191 17:35790813-35790835 AAGTGGGAAGTGAGAGATGGAGG - Intronic
1146951174 17:36907613-36907635 CGGTGGGACTGGAGAGCTGGTGG - Intergenic
1148144600 17:45355127-45355149 CAGTGGGGAATGAGAGCCAGAGG + Intergenic
1148736145 17:49865951-49865973 CAGTGAGCTCTGAGAGCAGGAGG + Intergenic
1149256975 17:54837354-54837376 CAGTGGGAGCTGGGAACAGGGGG - Intergenic
1150862139 17:68811640-68811662 CAGGAGGAAGAGAGAGCAGGAGG - Intergenic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1153017648 18:597846-597868 CAATGGGGATTGAAATCAGGGGG - Intronic
1153518421 18:5927497-5927519 CAGTGCTTGTTGAGAGCAGGAGG + Intergenic
1153552222 18:6273584-6273606 CAGTCGGAAGTGGGAGCAGGCGG + Intronic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1155215638 18:23641211-23641233 CAGTGGGAGCTGGAAGCAGGTGG + Intronic
1156130321 18:33965229-33965251 CATTGGGAAGTCAAAGCAGGAGG + Intronic
1157203086 18:45675907-45675929 CAGGAGGCAGTGAGAGCAGGAGG + Intronic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1162241809 19:9361279-9361301 CAGTGGGAATTGTCAGCAGCAGG + Intronic
1162569056 19:11460335-11460357 CAGTGGGGGATGGGAGCAGGGGG - Intronic
1162794193 19:13078248-13078270 CATTGGGAAAGGAGTGCAGGAGG - Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165856399 19:38881242-38881264 CAGTGGGAGTTGGGAGCAGTGGG + Intronic
1166050302 19:40255277-40255299 CAGAGGGAACAGACAGCAGGGGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166565650 19:43763864-43763886 CAGTGGAGAATGAGGGCAGGCGG + Intergenic
1166827014 19:45616114-45616136 CAATGGGAGTTTAGAACAGGTGG + Intronic
1167320272 19:48793359-48793381 CAATGGGAAATGAGAGGATGTGG + Intergenic
1167449529 19:49558797-49558819 CAGAGGGAACTGAGATCAGAGGG + Intronic
1168148511 19:54432585-54432607 CATTGGGCATTGAGAGTAGATGG - Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925602737 2:5625753-5625775 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
925651251 2:6091891-6091913 AAGATGGAATTGAGAGAAGGAGG - Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926879925 2:17533668-17533690 CACTGGGAGGTGAAAGCAGGAGG + Intergenic
928035046 2:27815138-27815160 CAATGGGCATTGAGGGCAGTGGG + Intronic
928077476 2:28278358-28278380 CAGTGGGAATAGGGAGGAAGAGG + Intronic
928449494 2:31365852-31365874 CTGTGAGAATTCAAAGCAGGGGG + Intronic
929425655 2:41841972-41841994 CAGTGGCAGTTGAGAACAGCAGG + Intergenic
930743673 2:54859602-54859624 CAGTGGGTGTTGAGCACAGGAGG + Exonic
931157824 2:59655354-59655376 CGGTGAGTATTGAGAGCAGAGGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
933684808 2:85134100-85134122 CAGCGGGAATCGAGAGTGGGGGG - Intronic
935058393 2:99587577-99587599 CAGTGGGAACTCAGACCAGTTGG - Intronic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935860584 2:107324771-107324793 CAATGAGAATTGAAACCAGGAGG - Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938137463 2:128770845-128770867 CAGTGGGAAAGGGGTGCAGGGGG - Intergenic
938969269 2:136417255-136417277 CAGTGGGAAGTTAGGGCAGTAGG + Intergenic
939152128 2:138485511-138485533 AAGTGGGAGCTGAGAGAAGGAGG + Intergenic
939360209 2:141161850-141161872 CCTTGGGATATGAGAGCAGGGGG + Intronic
940043678 2:149387041-149387063 CAGTGGCCATTGAGACCAAGTGG + Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940973691 2:159921042-159921064 CATTGGGAGTTCAGAGCAGGAGG - Intergenic
943960112 2:194253852-194253874 CAGTGGTAATAGAGAGCAAGGGG + Intergenic
945989873 2:216386823-216386845 CCTTGGGATTTGAGAGCAGTAGG + Intergenic
946178631 2:217937132-217937154 CAGTGGGAATGTCAAGCAGGAGG - Intronic
946310669 2:218880930-218880952 CAGTGGGACTGGAGAGCCAGGGG - Exonic
947040429 2:225912174-225912196 GAGTGGGAATGGACAGCAGTGGG - Intergenic
947330892 2:229028063-229028085 CAGTGGGAAAGGACAGGAGGAGG + Intronic
948010108 2:234645678-234645700 CAGTGGGAGTAGACAGCAGTGGG - Intergenic
948272831 2:236687439-236687461 CAGTGGGGATTAAGAGGAGGTGG + Intergenic
948315682 2:237026812-237026834 CATTGGGAATGGAGACCAGGTGG + Intergenic
1168752113 20:290185-290207 CCGTGAGAGTGGAGAGCAGGTGG + Intronic
1170793548 20:19527195-19527217 AAGTGGGAATTTAGAGTAGAGGG - Intronic
1170960985 20:21025835-21025857 CAGTGAGAATTAACAGCTGGGGG - Intergenic
1170987142 20:21268795-21268817 CGGTGAGAATTGGGACCAGGAGG - Intergenic
1171327869 20:24311553-24311575 CAGTGAGATTAGAGAGGAGGTGG + Intergenic
1172116424 20:32576043-32576065 GAGAGGGAATTGAGAGCAGTGGG + Intronic
1172200020 20:33119023-33119045 CGGGGTGATTTGAGAGCAGGGGG + Intergenic
1172719515 20:36988866-36988888 CAGGAGGAAGAGAGAGCAGGGGG - Intergenic
1173430117 20:42980285-42980307 CATTGGGAATTGGGAGCCTGGGG + Intronic
1174724737 20:52849795-52849817 AAATGGGAATTGAGAACAGGTGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1176892760 21:14338467-14338489 CTGTGAGAATTCAGAGCAAGGGG + Intergenic
1177572629 21:22906960-22906982 CAGTGGGAATTTAGAGAATCAGG - Intergenic
1177614892 21:23503941-23503963 TAGTGGGAGTTGGGAGCAGGTGG + Intergenic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179367147 21:40769112-40769134 CCTTGGGAAGTGAGAGCAGAGGG - Intronic
1180645948 22:17339183-17339205 CAGTGGGAAGTCAGAGCAATGGG - Intergenic
1180874850 22:19170392-19170414 GAGGATGAATTGAGAGCAGGTGG - Intergenic
1182118924 22:27774484-27774506 CAGTGGGAGCTGAAAGCAGGAGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183135101 22:35879590-35879612 CTGTGAGAAATGAGAACAGGAGG + Intronic
1183361331 22:37384741-37384763 GAGTGGGAATTGGGGTCAGGTGG - Intronic
1183387326 22:37522428-37522450 CAGTGGGAAGTGGGAGGCGGGGG - Intergenic
1183485209 22:38084670-38084692 CAGGTCGAAATGAGAGCAGGTGG + Intergenic
1184127990 22:42501054-42501076 GAGTGGAAATTTAGGGCAGGCGG - Intergenic
1184136779 22:42554369-42554391 GAGTGGAAATTTAGGGCAGGCGG - Intronic
1184274730 22:43403922-43403944 CAGTGGGCAAAGGGAGCAGGTGG + Intergenic
1184317036 22:43702539-43702561 CAGAGGGAAAAGAGAGCTGGAGG + Intronic
949962169 3:9321549-9321571 AAGTGGGAAGTGACAGCAGTCGG + Intronic
950863220 3:16168876-16168898 CCTTGGGTATGGAGAGCAGGTGG + Intergenic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
953451998 3:43013453-43013475 CAGTGGGAAGTAACAGCAAGGGG + Intronic
953694197 3:45145502-45145524 CAGTGGACTTTGAGGGCAGGAGG - Intronic
953836536 3:46350908-46350930 CAGCTGGAATTGAGAGCTGCAGG - Intergenic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
957847421 3:85755684-85755706 CAGGAGGAAGTGAGAGAAGGGGG + Intronic
958898192 3:99853911-99853933 CAGTGAGAACTGAGAGCAGGAGG + Intronic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
961543507 3:127616812-127616834 GAGTGGGAAGTGAGAGGAGGAGG - Intronic
961798114 3:129424434-129424456 AAGGAGGAAGTGAGAGCAGGGGG - Intronic
961828904 3:129613243-129613265 CACTGGGAAGTCAGAGCTGGGGG - Intergenic
961958178 3:130825845-130825867 CTCTGGGAATTGGGAGGAGGGGG + Intergenic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
965602427 3:170468537-170468559 CATTGGGAAGTGGAAGCAGGCGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
968403263 4:316817-316839 CAGTGGGAGGTGAGCTCAGGGGG + Intergenic
968772217 4:2514691-2514713 CAGTGGGAACTGAGGACTGGAGG - Exonic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
970697153 4:18691645-18691667 GAGTGAGAATTCTGAGCAGGGGG + Intergenic
971759459 4:30746401-30746423 CAGCGTGAAGGGAGAGCAGGGGG + Intronic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972688523 4:41373931-41373953 CAGGAGGAAGAGAGAGCAGGGGG - Intronic
972689463 4:41382482-41382504 GAGGGGGAATTGGAAGCAGGAGG + Intronic
975366401 4:73534205-73534227 GAGTGGGAACTGTGGGCAGGAGG + Intergenic
977274148 4:94954592-94954614 GAGTGGGACTTGAGAGCCTGCGG + Intronic
977883404 4:102232855-102232877 CAGTTTGATTTGAAAGCAGGTGG - Intergenic
978498332 4:109384011-109384033 CGGTGGGAACTGGGAACAGGTGG + Intergenic
979203845 4:118011022-118011044 AAGGAGGAATAGAGAGCAGGGGG + Intergenic
980124749 4:128763418-128763440 CTTTGGGAAGTGGGAGCAGGAGG - Intergenic
980126077 4:128775674-128775696 AAGTGGGAGTTAAGAGCCGGAGG + Intergenic
981027182 4:140088461-140088483 CAGTGGGAATGGAAAGGAAGAGG - Intronic
981173896 4:141658180-141658202 CAGGAGGAAAAGAGAGCAGGGGG - Intronic
982547244 4:156749277-156749299 CAGTGGGCATGGAGAGTGGGGGG + Intergenic
982814778 4:159871252-159871274 GAGAGGGTATGGAGAGCAGGAGG + Intergenic
982968319 4:161945172-161945194 CAGTGGAAGAAGAGAGCAGGAGG - Intronic
983192325 4:164767849-164767871 CAGTAGAAATTGAAAGCTGGGGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
985025702 4:185737318-185737340 CAGGGGGTGTGGAGAGCAGGTGG + Intronic
985359666 4:189159131-189159153 CATTGGGAATTGAGATTTGGGGG + Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
987147316 5:15004982-15005004 CAGGGGGAATTTAGATCTGGAGG + Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988619014 5:32803421-32803443 CAGTGGGAATTGAGAGTTTCTGG - Intergenic
989200108 5:38754675-38754697 AAGTGGGAAATGAGAGAAAGAGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989404173 5:41042063-41042085 AAGAGGAAATTGAGAGCAAGGGG + Intronic
990049582 5:51481030-51481052 CAGTGTAAGCTGAGAGCAGGTGG - Intergenic
990153871 5:52852011-52852033 CAATGGGAATTCAAAACAGGAGG + Intronic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992107336 5:73460781-73460803 CAGTCGGAATTCAGAGCAGGTGG - Intergenic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
993859359 5:93115940-93115962 CAGAGAGAATGGAAAGCAGGAGG + Intergenic
994116719 5:96069742-96069764 CATTGGGAAGTGAAGGCAGGAGG - Intergenic
995621806 5:114033739-114033761 CAGTGGGAAGTGAGTACATGAGG + Intergenic
996117116 5:119631293-119631315 GAGTAGGCATGGAGAGCAGGGGG + Intronic
996509015 5:124298352-124298374 CAGGGGGAATTGCAGGCAGGTGG + Intergenic
996589273 5:125127762-125127784 CAGTCTTAATTGAGAGCAGTGGG + Intergenic
997582950 5:135028627-135028649 GAGTGGGAAGTGGGAGGAGGGGG + Exonic
998999151 5:147900795-147900817 CAGTGGAAATTGAAAGCACCTGG + Intronic
999475089 5:151891001-151891023 GAAGGGGACTTGAGAGCAGGGGG + Intronic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001691381 5:173635077-173635099 AACTGGGAATTCACAGCAGGTGG + Intergenic
1002139234 5:177128725-177128747 TTGGGGGAAGTGAGAGCAGGAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002312991 5:178325838-178325860 CACTGGGAATGGAGAGCATGTGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1004233212 6:13851323-13851345 CAGTGGTAATTTGGGGCAGGGGG - Intergenic
1004567895 6:16816342-16816364 CACTGAGAATGGGGAGCAGGAGG + Intergenic
1006883196 6:37357062-37357084 CAGTAGGAATTGTGCCCAGGAGG + Intronic
1007811377 6:44488495-44488517 GGGTGGGGATTGAGAGGAGGGGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008356898 6:50565663-50565685 CAGTGGCTATGGAGAGCCGGAGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1011375662 6:86683412-86683434 AATTGGGCATTGAGAGCAAGGGG + Intergenic
1011399833 6:86948550-86948572 CAGTGGGAGGTGAGAGGAAGTGG - Intronic
1011639964 6:89409614-89409636 GAGTGGGGATTGGGAGGAGGAGG - Intronic
1012043166 6:94236560-94236582 AAGGGGGGATTGGGAGCAGGAGG + Intergenic
1012243915 6:96904912-96904934 AAATGGGAATGGAGAGCAAGGGG - Intergenic
1013659314 6:112278627-112278649 GAGTGGGAGTTGAGATGAGGAGG + Intergenic
1013856473 6:114579682-114579704 CAGTGGCAAATGCTAGCAGGTGG + Intergenic
1014167793 6:118245564-118245586 CAGTGAGAATCAAGCGCAGGTGG - Intronic
1014311714 6:119812007-119812029 CAGAAGCAAGTGAGAGCAGGAGG - Intergenic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015564166 6:134549538-134549560 CAATGGGATTTGAGAGCAAAGGG + Intergenic
1015827384 6:137329010-137329032 CAGTCACAATTGAGAGGAGGCGG + Intergenic
1016499110 6:144698947-144698969 CAGTGTGAATAGAGAACAGTTGG - Intronic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1017298676 6:152831084-152831106 CCATGGGACTTGAGAGCAAGAGG - Intergenic
1017647105 6:156549318-156549340 CAGTGAGAATTCAGATCAGAAGG + Intergenic
1017753090 6:157507009-157507031 CAGTTGAAACTGAGAGTAGGGGG - Intronic
1017952458 6:159147523-159147545 CAGGAGGAAGAGAGAGCAGGGGG + Intergenic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019116333 6:169765852-169765874 CAGTGAGATTTGACAGCATGAGG - Intronic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1019818562 7:3220375-3220397 CAGTGGAAATTTTGAGCAAGTGG + Intergenic
1021519811 7:21527748-21527770 CAGGAAGAATAGAGAGCAGGGGG - Intergenic
1022182259 7:27932243-27932265 CAGTTGGACTTGAGAACAGTTGG - Intronic
1022533299 7:31080390-31080412 CAGAGGCATTTGAGAGGAGGAGG - Intronic
1022548261 7:31209442-31209464 CAGTGGGAATGGAGAGGCTGCGG + Intergenic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1022831144 7:34067937-34067959 CTGTGGGAATTGACAATAGGTGG - Intronic
1023281233 7:38572692-38572714 CAATGTGAAGTGGGAGCAGGAGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024309471 7:47956264-47956286 CAGTGGGAAAAGAGAGCGGGAGG + Intronic
1025644759 7:63408076-63408098 CAGTGAGAATTTCGAGCCGGTGG - Intergenic
1026009210 7:66623800-66623822 GAGGGGGAGTTGAGAGCAGTAGG + Intergenic
1028942476 7:96538738-96538760 AAGGGGGAAGTGAGAGCAGAGGG - Intronic
1029403939 7:100362057-100362079 GAGCAGGAATGGAGAGCAGGGGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1030217666 7:107062555-107062577 TAGTGGGAATTGACAGTAAGGGG + Intronic
1030516749 7:110548576-110548598 CAGTAAGAATGGAGAGCAGGAGG - Intergenic
1031003433 7:116444611-116444633 TAGTGGGAATTGAGAGGAAAAGG - Intronic
1031122885 7:117741203-117741225 ATGGGGGAATGGAGAGCAGGAGG + Intronic
1032074320 7:128829440-128829462 CAGGGGGAAATGTGACCAGGTGG - Intergenic
1033248156 7:139736110-139736132 GAGTGGGAAATGAAAGCATGTGG + Intronic
1033605765 7:142927584-142927606 CAGGAGGAAGAGAGAGCAGGAGG + Intronic
1033605769 7:142927600-142927622 CAGGAGGAAGAGAGAGCAGGGGG + Intronic
1034401515 7:150864596-150864618 CAGGGAGAACTGAGAGCAGCAGG + Intergenic
1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG + Intergenic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1036528254 8:9555875-9555897 CAGTCGGAAGTGAGGGCGGGCGG + Intergenic
1036640301 8:10579455-10579477 AAGAGAGAACTGAGAGCAGGAGG + Intergenic
1037408019 8:18564738-18564760 CAGTGGGATTTCAGGGGAGGAGG - Intronic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1038415028 8:27388923-27388945 CATTGGGAAATGAGACCAGAAGG - Intronic
1041481968 8:58331982-58332004 CAATGGGAATTGCAAGCAAGTGG - Intergenic
1041667893 8:60463691-60463713 CAATGGGAATTGAAAACAGCTGG - Intergenic
1041955935 8:63558415-63558437 CAGTGGGAGCTGGGAACAGGTGG + Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043606768 8:82010064-82010086 AAGTGGGATTTGGGAGAAGGGGG + Intergenic
1043805719 8:84670149-84670171 CAGTGGGAAATTAGTGCAAGAGG - Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043899663 8:85765842-85765864 CAGTGGAAATTTTAAGCAGGAGG + Intergenic
1043906457 8:85817694-85817716 CAGTGGAAATTTTAAGCAGGAGG + Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044412677 8:91901913-91901935 CAGTGGGAATTGGGGACAAGTGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045220249 8:100192078-100192100 CTGTGGGACTTGGGAGCAAGGGG - Intronic
1045881540 8:107046030-107046052 TAGTGAGCAGTGAGAGCAGGTGG + Intergenic
1047406091 8:124586852-124586874 CAGTGGGAATGGGAAGGAGGGGG + Intronic
1047537359 8:125732032-125732054 CAGTGAGCACTGAGAGGAGGGGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048184729 8:132229360-132229382 CAGTGGCAATGGACAGCAAGAGG + Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049275227 8:141716994-141717016 CAGAGGGAAGTGACAGCAAGGGG - Intergenic
1049635789 8:143688431-143688453 CAGTGAGTGTTGAGTGCAGGTGG + Intronic
1050410798 9:5363065-5363087 AACTGCGGATTGAGAGCAGGGGG + Intronic
1055028852 9:71751541-71751563 CAGTGAAAATTGAGAACAGTTGG - Intronic
1055660132 9:78494998-78495020 CAGTGGGAATTGGCAGAGGGAGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057814227 9:98282403-98282425 CAGTGGGAATTTGGAGCAAGAGG - Intergenic
1059710961 9:116867289-116867311 GAGTGAGAAAAGAGAGCAGGAGG + Intronic
1060787488 9:126461847-126461869 CCGTGGGGGTTGAGAGCATGGGG + Intronic
1186223822 X:7376248-7376270 CAGTGGGAGCTGGGAACAGGCGG - Intergenic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1187765712 X:22639570-22639592 CAGTGGCAAATGCCAGCAGGAGG - Intergenic
1188822226 X:34789593-34789615 AAGGGGGAAGAGAGAGCAGGGGG - Intergenic
1189363755 X:40372250-40372272 ACGTGGGAAGTGAGTGCAGGGGG - Intergenic
1190153713 X:47969771-47969793 CAGGAGGAATAGAGAACAGGGGG + Intronic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1193373929 X:80734861-80734883 TAGTGGGTATTTAGAGTAGGGGG + Intronic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1196752198 X:119128307-119128329 CACTGGGGATTTGGAGCAGGAGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197607755 X:128605383-128605405 TAGTGGGAATTGAAAGGAGAAGG - Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic