ID: 954724626

View in Genome Browser
Species Human (GRCh38)
Location 3:52597101-52597123
Sequence AGTTAGAGCACAGTGATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954724626_954724630 20 Left 954724626 3:52597101-52597123 CCCTCAATCACTGTGCTCTAACT 0: 1
1: 0
2: 2
3: 58
4: 293
Right 954724630 3:52597144-52597166 CTGTGTCACACAGCTGATGCTGG 0: 1
1: 0
2: 2
3: 25
4: 222
954724626_954724632 22 Left 954724626 3:52597101-52597123 CCCTCAATCACTGTGCTCTAACT 0: 1
1: 0
2: 2
3: 58
4: 293
Right 954724632 3:52597146-52597168 GTGTCACACAGCTGATGCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 239
954724626_954724631 21 Left 954724626 3:52597101-52597123 CCCTCAATCACTGTGCTCTAACT 0: 1
1: 0
2: 2
3: 58
4: 293
Right 954724631 3:52597145-52597167 TGTGTCACACAGCTGATGCTGGG 0: 1
1: 1
2: 0
3: 23
4: 202
954724626_954724633 27 Left 954724626 3:52597101-52597123 CCCTCAATCACTGTGCTCTAACT 0: 1
1: 0
2: 2
3: 58
4: 293
Right 954724633 3:52597151-52597173 ACACAGCTGATGCTGGGGTATGG 0: 1
1: 0
2: 3
3: 28
4: 305
954724626_954724634 28 Left 954724626 3:52597101-52597123 CCCTCAATCACTGTGCTCTAACT 0: 1
1: 0
2: 2
3: 58
4: 293
Right 954724634 3:52597152-52597174 CACAGCTGATGCTGGGGTATGGG 0: 1
1: 0
2: 2
3: 33
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954724626 Original CRISPR AGTTAGAGCACAGTGATTGA GGG (reversed) Intronic
904788857 1:33002712-33002734 AGTTAGAGGGCAATGAGTGAAGG - Intergenic
905712491 1:40118242-40118264 TGCTAGAGCTCAGTGAATGAGGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
907406816 1:54258771-54258793 AGTGAGGGGACAGTGAGTGAGGG + Intronic
907978331 1:59455555-59455577 AGTTAGAGCGTAGCAATTGAAGG + Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910328104 1:86034438-86034460 AGTTAAAGCACAGAGAGTGTAGG + Intronic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912895871 1:113588359-113588381 GGTTGGAGCAGAGTGATGGAAGG + Intronic
915966421 1:160312684-160312706 AGTTGGAGCACAGTGAGTAAGGG - Intronic
916361318 1:163972684-163972706 AGCTATAGCACAGTGAGTAAAGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917745567 1:178003346-178003368 AGTGAAAGCACAGTGAATAAAGG - Intergenic
920174645 1:204092919-204092941 AGTGAGAGCATTGTGATTAATGG - Intronic
920601406 1:207328736-207328758 AGGTAAAGCACAATGATTTAGGG - Intronic
920919635 1:210287843-210287865 AGCTTGAGCACAGTGGTTCAAGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922861715 1:228823524-228823546 AGTTAGATCCTATTGATTGATGG + Intergenic
923734286 1:236588328-236588350 AGTGAGAGCCCAGATATTGACGG + Intronic
1065421780 10:25552746-25552768 AGGTACAGCACAGTGAGTCAGGG - Intronic
1067309886 10:45102726-45102748 AGCTGGAACACAGTGAGTGAAGG - Intergenic
1067835611 10:49638388-49638410 AATTAGAAGACAGAGATTGATGG - Intronic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1068548505 10:58379939-58379961 AGTAGGAGCACAGAGAATGATGG - Intergenic
1068755292 10:60646183-60646205 GGTTAGAGTACAATGAGTGAGGG + Intronic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072367560 10:94729104-94729126 AGTTAGAACACTGTTGTTGATGG + Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075677450 10:124305282-124305304 AGCTAGAGCACAGTGACTCAAGG + Intergenic
1077954085 11:6994641-6994663 AGTGACAGCACAGTGGCTGAAGG - Intergenic
1078495867 11:11816302-11816324 ACTTAAAGGACAGTGATTTAAGG + Intergenic
1079064244 11:17276216-17276238 AGTTAAACCACAGTGACCGAGGG + Intronic
1079280571 11:19083396-19083418 AGTTAGAGCACAATGCAAGAAGG + Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081811548 11:45917104-45917126 GGTTAGAGAACAGTCACTGATGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1087864363 11:103205821-103205843 ACCTGGAGCAGAGTGATTGAGGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1091860371 12:3776128-3776150 GATTAGTGCACAGTGATGGAGGG + Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1094782588 12:33809351-33809373 AATTAGACCAAGGTGATTGAAGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095372542 12:41486510-41486532 AGTAAGAACCCAGTGAATGAGGG + Intronic
1095849982 12:46791907-46791929 AGTTGGAGCAGAATGAGTGAAGG + Intronic
1096550783 12:52370305-52370327 AATGAGGGCACAGTGAATGAGGG - Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098768555 12:74521910-74521932 GGCTAGAGCACAGTGAGTAAAGG + Intergenic
1102053060 12:109877301-109877323 AGTAAGGGCTCAGTGAGTGACGG + Intronic
1103171405 12:118823266-118823288 AGTGTGAGCACAGGGACTGATGG + Intergenic
1106556466 13:30812836-30812858 AGTTAGAGCTAAATGTTTGATGG + Intergenic
1107057528 13:36123491-36123513 AGTTACTTCACATTGATTGAGGG + Intronic
1107939661 13:45372590-45372612 AGCCAGAGCACACTGAATGATGG + Intergenic
1109006455 13:56883554-56883576 ATTTAGAGCACATGAATTGAAGG - Intergenic
1109117045 13:58401602-58401624 AGGTAGAGCTCTGTGATTGGTGG + Intergenic
1109386892 13:61641955-61641977 AATTAGAGCCAGGTGATTGATGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110077801 13:71271430-71271452 TTTAAGAGCACAGTGAATGAAGG - Intergenic
1111060497 13:83012405-83012427 ATTCAGAGCACTGGGATTGAAGG - Intergenic
1111242311 13:85491077-85491099 AATTGTAGCACAGTAATTGAAGG - Intergenic
1111428912 13:88126589-88126611 ATTAAGTGCAGAGTGATTGAAGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112204798 13:97314138-97314160 GGCTAGAGCAGAGTGAGTGAGGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113402735 13:110009444-110009466 AATTAGACAACAGTGATGGATGG - Intergenic
1114362538 14:21990914-21990936 ACTTAGAGCACAGTAATACATGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115302852 14:31903742-31903764 AGTTGGAGCAGAATGAGTGAAGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116943744 14:50816419-50816441 AGTTAGAGCACGGGCTTTGAAGG - Intronic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118076503 14:62305320-62305342 AGATAAAGGACAGTGATGGATGG + Intergenic
1118155234 14:63233930-63233952 AGTCAGAGCACAGAAAATGAAGG - Intronic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118949120 14:70418060-70418082 AGTTAGACCACAGGGATTGGTGG + Intergenic
1119044445 14:71305651-71305673 AGTCAGAGCTTAGTGATAGAGGG - Intergenic
1119884816 14:78131455-78131477 GGTTAGAGCACAGGGCTTGTTGG + Intergenic
1122168451 14:99850220-99850242 GGTTGGAGCACAGTAAGTGAAGG + Intronic
1122500064 14:102191464-102191486 AGTTAGAACTCAGTGATTAATGG + Intronic
1125587210 15:40829204-40829226 AGTTGGAGGTCAGTTATTGATGG + Intergenic
1126591354 15:50343332-50343354 GGCTAGAGCACAGTGACTAAGGG - Intronic
1127620986 15:60734174-60734196 AGTTGGAGAACACTGATTTAGGG - Intronic
1127708197 15:61567918-61567940 AGTTGGACCACAGTAATTGGTGG + Intergenic
1129279268 15:74471024-74471046 AATCCCAGCACAGTGATTGATGG - Intergenic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1131379847 15:91954693-91954715 GGTTAGAGCCCAATGAGTGAGGG + Intronic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1133997428 16:10759130-10759152 AGTCAGAGCTCAGTGAGTGCTGG - Intronic
1135186746 16:20322234-20322256 TGTTAGAGTTCAGTGATGGAGGG + Intronic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1138935929 16:61723208-61723230 AGTTAGAACACAGTTATGGAAGG + Intronic
1139035105 16:62936508-62936530 AGTAAAAGAATAGTGATTGAAGG - Intergenic
1139662566 16:68431086-68431108 AGTGGGAGGACAGGGATTGAGGG + Intronic
1140571017 16:76106310-76106332 GGTCAGAGAAAAGTGATTGAGGG + Intergenic
1140576886 16:76181095-76181117 AATTAAAGCATAGTGACTGATGG - Intergenic
1141708500 16:85683384-85683406 AGTTAGAGCTCAGGGGCTGATGG - Intronic
1143703359 17:8678713-8678735 AGTTAGAGTGCAGGGTTTGATGG - Intergenic
1144826983 17:18110793-18110815 GGCTGGAGCAGAGTGATTGAGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150239191 17:63618617-63618639 AGCTAGAGGACAGTGATGGAGGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151104131 17:71592735-71592757 TGTTAGAGAACTGGGATTGAAGG + Intergenic
1152721133 17:81924297-81924319 AGTGAGAGCAGAGTGCTGGAGGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155364927 18:25040286-25040308 AGTGATTGCACGGTGATTGAGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156225922 18:35107712-35107734 AGTTAGATCAAGGTGTTTGATGG + Intronic
1156966747 18:43103729-43103751 AGGTAGATGACAGTGATGGAAGG + Intronic
1157235485 18:45961388-45961410 GGTTAGTGCAGAGTGAGTGAGGG - Intronic
1158889883 18:61862884-61862906 TGTCAGAGCCCACTGATTGAGGG - Intronic
1159270961 18:66149860-66149882 AGTAAAAGAACAGTGATTCAAGG - Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1162150141 19:8639181-8639203 GGTTGGAGCAGAGTGATAGAAGG + Intergenic
1163205848 19:15802189-15802211 GGCTAGAGCAGAGTGACTGAGGG + Intergenic
1163863360 19:19753972-19753994 AGTTGGAGCCCAGTGAGTGAGGG - Intergenic
1164790715 19:30977499-30977521 AGTTAGAGCCAGCTGATTGATGG + Intergenic
1165698483 19:37919324-37919346 AGTAAGAGCTCAGTGAATGCTGG - Intronic
925347654 2:3181976-3181998 GGTCAGAGGACCGTGATTGATGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928175059 2:29027886-29027908 TGGTGGAGCACAGTGAGTGAGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931813431 2:65877077-65877099 ACTGAGATCACAGTGATAGAAGG + Intergenic
932693436 2:73933285-73933307 AGTATGAGAACAGTGATGGAGGG - Intronic
933411226 2:81927294-81927316 TGTTAGTGCTTAGTGATTGAAGG - Intergenic
933547449 2:83732605-83732627 AGTCAGATCACAGTACTTGAAGG - Intergenic
933995991 2:87670279-87670301 AGTTAGAGCAGAGAAACTGAAGG - Intergenic
935188749 2:100758562-100758584 GGCTAGAGCATAGTGACTGAGGG - Intergenic
935793895 2:106621320-106621342 AATTAGATCAAATTGATTGATGG + Intergenic
936297866 2:111280633-111280655 AGTTAGAGCAGAGAAACTGAAGG + Intergenic
939216005 2:139239108-139239130 AGTTGGAGTCCAGTGTTTGAGGG - Intergenic
939495279 2:142921015-142921037 ACTTAGGTCAAAGTGATTGAGGG + Intronic
940209867 2:151245311-151245333 AGTCAGAGCAGAGTGGTTGAGGG - Intergenic
940356210 2:152745777-152745799 AGTGACAGCACTGTAATTGATGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940931887 2:159442331-159442353 AGTTAGAGCATAGTGAACCAGGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941982905 2:171479235-171479257 AATTAGTGCATAGTGATTGAGGG + Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943271617 2:185812229-185812251 ATCTAGGGCACAGTGATGGAAGG - Intronic
947191049 2:227504935-227504957 AATTATAGCTCTGTGATTGATGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168889415 20:1284736-1284758 GGCTAGAGCAGAGTGAATGAGGG + Intronic
1169432692 20:5553303-5553325 AGTCAGAACACACTGATTTATGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170833544 20:19863918-19863940 TGTGAGAGCACAGTGAATAATGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1175686743 20:61035511-61035533 AATTAGATCAAATTGATTGATGG + Intergenic
1177292034 21:19125965-19125987 AGTTAGAGTACAATGTATGATGG + Intergenic
1178513147 21:33224098-33224120 AGTTAGATCAAATTAATTGATGG + Intergenic
1179369909 21:40795506-40795528 AATTAGATAACAGTGAATGAGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1182039593 22:27226366-27226388 AGTTAGAGAACAGTGTTCAAAGG + Intergenic
950922226 3:16705971-16705993 GGCTAAAGCACAGTGAGTGAGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951219530 3:20054675-20054697 AGTAATATCATAGTGATTGATGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952026482 3:29088480-29088502 TGTGAGAGAACAGTGTTTGATGG - Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953419073 3:42740709-42740731 GGCTGGAGCACAGTGAGTGAAGG + Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
954731040 3:52662134-52662156 AATCAGGGCACAGTGACTGAAGG - Exonic
956318974 3:67974116-67974138 AGGTAGAGGAGAGTGACTGATGG - Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957253173 3:77801225-77801247 GGTTAAAGCAAAGTGATGGAAGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958683989 3:97369117-97369139 AGTCAGACTACAGTGAATGATGG + Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
959968150 3:112379482-112379504 AGTTATACCACGGTGATTAAGGG - Intergenic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
962963401 3:140332054-140332076 AGATAAAGAACAGTGATAGAGGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
966257263 3:177931049-177931071 AGTGATAGGACAGTAATTGAGGG + Intergenic
967608831 3:191481054-191481076 AGGAAGAGCACAGTGATAAAGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
970679158 4:18487504-18487526 AGCTGAAGCACAGTGAGTGAAGG - Intergenic
971873603 4:32275705-32275727 AGTTGGAGCAAAGTGACAGAGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973210967 4:47615164-47615186 GGTTAGAGCCCAGTGAGTGATGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
974214282 4:58824973-58824995 GGTTGGAGCACAGTGACAGATGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
977822240 4:101486968-101486990 AGTTATATCCCATTGATTGATGG + Intronic
977992748 4:103464610-103464632 AATGAGAGGACAGTGAGTGATGG + Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982344459 4:154341710-154341732 ACTTAGAGCCTAGTAATTGATGG - Intronic
982817635 4:159906374-159906396 AGTTAGAGCTCAGTGATGGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982861722 4:160460119-160460141 AGTTTGAACACAGTGAGTGAGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983959017 4:173730028-173730050 AATGATAGCACAGTGATGGAAGG + Intergenic
986066714 5:4241113-4241135 AGTAAGAGGACAGTGATTCCAGG + Intergenic
988064579 5:26218349-26218371 ACTTAGAGCACAGTGATGATAGG + Intergenic
989227697 5:39049153-39049175 AGTTAGTGGGGAGTGATTGATGG - Intronic
990251430 5:53919524-53919546 AGTGAGAAGAAAGTGATTGAGGG + Intronic
990390413 5:55314019-55314041 ATTCAGAGAACATTGATTGAAGG - Intronic
991202330 5:64008831-64008853 AGTTGCAGCTCAGTGGTTGAGGG - Intergenic
992094778 5:73352957-73352979 ACTTAGAACACAGTGTTGGAGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994170355 5:96652970-96652992 GGCTTGAGCACAGTGCTTGAAGG + Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995245155 5:109927120-109927142 AGTGAAAGCACAATGATTGGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995614354 5:113944306-113944328 AGTGAAAGCACAGTGAATGCTGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996657653 5:125960586-125960608 AGTTAAAGCACAGACCTTGATGG + Intergenic
999298228 5:150473979-150474001 AGTTAAATGACAGTAATTGAGGG + Intergenic
999680274 5:154052031-154052053 AGTCAGAGCCAAGTTATTGAAGG + Intronic
1000631820 5:163599324-163599346 AATTAGAGCACAGTGTGTGATGG - Intergenic
1001130890 5:169062518-169062540 ACCTGGAGCACAGTGAGTGAGGG - Intronic
1002842861 6:921315-921337 AGTTAGGGCAGAGTTTTTGAAGG - Intergenic
1009557777 6:65196697-65196719 AGTAAGAGCACAGCGAATGAAGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012180263 6:96144016-96144038 AGGAAGAGCACAGGGATTAAGGG - Intronic
1013372914 6:109485451-109485473 GGCTGGAGCACAGTGAGTGAGGG + Intergenic
1014107103 6:117578435-117578457 TGGCAGAGCACAGTGATGGAAGG + Intronic
1014829096 6:126080488-126080510 ATTTAGAGCCCCTTGATTGAAGG + Intergenic
1015144489 6:129970520-129970542 GGCTGGAGCACAGTGAATGAGGG + Intergenic
1015997799 6:139012979-139013001 ACTTAGACTACAGTTATTGAGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016750215 6:147623573-147623595 TGTTAGAGCACATTCATTGAAGG + Intronic
1017728759 6:157295816-157295838 ACTTAGAGAACAGGGATAGATGG - Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023341111 7:39220807-39220829 AGTAAGTGCACAATGAATGATGG + Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023874032 7:44277246-44277268 AGTTAGAGGAAATTAATTGACGG - Intronic
1024120548 7:46233649-46233671 AATTAGATCAAATTGATTGATGG - Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028891994 7:95998480-95998502 AGTTATAGGTCAGTGAGTGAAGG - Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031363746 7:120878576-120878598 GGTTCTAGTACAGTGATTGAGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032391672 7:131558872-131558894 AGTTAGAGCACAATGCTAAATGG - Intergenic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1033112914 7:138598457-138598479 AGTTAGATCCCATTGCTTGATGG - Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1036938008 8:13023768-13023790 AGTTATAGCACAATCATTAAAGG - Exonic
1039195232 8:35023779-35023801 GGTTGGAGCACAGTGAATGAGGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039411754 8:37360622-37360644 CTTTATAGCACAGTCATTGATGG + Intergenic
1040627482 8:49166710-49166732 AGTTAGTGCACATTGGTTAATGG + Intergenic
1041079795 8:54205559-54205581 AGTTAGAGCAGAGTCTTTGTGGG - Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047597659 8:126395015-126395037 AGTTAGAGCCCAGTGCTTACAGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048797914 8:138168249-138168271 AGTTAGAGGACATGGATTGTAGG + Intronic
1049878126 8:145040808-145040830 GGTTAGAGCTAATTGATTGATGG + Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1051022616 9:12562839-12562861 AGTTGGAGCACAGAGAATGTGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051594347 9:18809402-18809424 TGCTGGAGCACTGTGATTGATGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055269247 9:74537928-74537950 AGTGAGAGCTGAGTGAATGAAGG - Intronic
1055705438 9:78995527-78995549 AATTAGATAACAGTGATTGTTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056870048 9:90268792-90268814 CATTAGAGCACAGGGATTCAGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060756495 9:126218129-126218151 AGTTAGATTGCAGTGAGTGAAGG + Intergenic
1060782218 9:126421220-126421242 AGATACAGCACAGTCTTTGATGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1187524312 X:20040098-20040120 ACTTAGAGTCCAGTGTTTGAGGG - Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1191849589 X:65576175-65576197 AGTTGGAGAACAGTCTTTGAAGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194797405 X:98228649-98228671 AATGAGAGCACAGTCAATGAAGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196915024 X:120524978-120525000 AGTTAGAACACTGTTGTTGATGG + Intronic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197079357 X:122393863-122393885 ATTTAGAGTCCAGTGTTTGAAGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1199274618 X:145926477-145926499 AGTGATAGCCAAGTGATTGAGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199520797 X:148733042-148733064 AGGTTGAACACAGTTATTGATGG - Intronic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic