ID: 954725107

View in Genome Browser
Species Human (GRCh38)
Location 3:52601693-52601715
Sequence GCACTGGTGTTAGCAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 7, 1: 11, 2: 20, 3: 56, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954725104_954725107 -5 Left 954725104 3:52601675-52601697 CCAGAGTGGTGTATACTGGCACT 0: 1
1: 1
2: 4
3: 30
4: 230
Right 954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG 0: 7
1: 11
2: 20
3: 56
4: 206
954725099_954725107 9 Left 954725099 3:52601661-52601683 CCATGCTTTGGGCCCCAGAGTGG 0: 1
1: 0
2: 5
3: 33
4: 286
Right 954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG 0: 7
1: 11
2: 20
3: 56
4: 206
954725103_954725107 -4 Left 954725103 3:52601674-52601696 CCCAGAGTGGTGTATACTGGCAC 0: 1
1: 3
2: 7
3: 89
4: 1471
Right 954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG 0: 7
1: 11
2: 20
3: 56
4: 206
954725102_954725107 -3 Left 954725102 3:52601673-52601695 CCCCAGAGTGGTGTATACTGGCA 0: 1
1: 4
2: 8
3: 39
4: 183
Right 954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG 0: 7
1: 11
2: 20
3: 56
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954725107 Original CRISPR GCACTGGTGTTAGCAGGTCC AGG Intronic