ID: 954728838

View in Genome Browser
Species Human (GRCh38)
Location 3:52639975-52639997
Sequence GTTTAGCTCTTGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954728838 Original CRISPR GTTTAGCTCTTGAGAGAAGA GGG Intronic
906180102 1:43810731-43810753 GTTTCGCCCTTGGGAGCAGAGGG + Intronic
907053721 1:51345954-51345976 ATTTAGCTCATCAGAGAAGGTGG + Intergenic
907182339 1:52581858-52581880 TTCAAGCTCTTGAGGGAAGATGG - Intergenic
907410513 1:54280192-54280214 TGTTAACTCCTGAGAGAAGAGGG - Intronic
907635166 1:56126816-56126838 GTTTATCTGCTAAGAGAAGAGGG - Intergenic
907679491 1:56550382-56550404 TTTCAGCTGTTGAGAGAAAAGGG + Intronic
908200628 1:61791375-61791397 GTTGAGCTTGTGAGAAAAGATGG + Exonic
909884619 1:80925368-80925390 GTGGAGATCTAGAGAGAAGATGG + Intergenic
910493860 1:87803569-87803591 ATTTAGCTCATGAGATGAGAGGG - Intergenic
911998378 1:104797210-104797232 GTGTAGATCTTGAGAAAAGTAGG - Intergenic
915293615 1:154903649-154903671 GTTCAGCTCCTGAGAGAATGAGG - Intergenic
917385122 1:174464342-174464364 GTTTAATTCCTGAGAGTAGATGG - Intronic
918672574 1:187238295-187238317 TTTTAGCTCTTTAAGGAAGACGG - Intergenic
919062526 1:192651726-192651748 GGTTATTTCTGGAGAGAAGACGG + Intronic
920626427 1:207606159-207606181 GTTTAGACCATGAGATAAGATGG - Intronic
923992373 1:239453606-239453628 GTTTAGCTATTAAAAAAAGAAGG + Intronic
924293240 1:242559673-242559695 GTTTATCTCAAGAAAGAAGAAGG + Intergenic
1066501315 10:35997448-35997470 GGTAAGGCCTTGAGAGAAGATGG + Intergenic
1068681805 10:59828004-59828026 GTTTAGCTCATCAGATATGAGGG - Intronic
1069138601 10:64796513-64796535 TTTTTGCTCTTGAGAAAAGGGGG - Intergenic
1070073818 10:73115788-73115810 GTTTAGTTCTTGGGGGAAGGGGG - Intronic
1070381903 10:75888559-75888581 GTTTAGCTTCTGTAAGAAGAAGG + Intronic
1072702708 10:97655437-97655459 GTTTGTCTCTGGAAAGAAGATGG + Intronic
1073205658 10:101768069-101768091 GTTTACATCTTGGAAGAAGAAGG - Intergenic
1073558219 10:104473896-104473918 GTTTGGCTTTTGATAGAAGTAGG - Intergenic
1074571747 10:114631016-114631038 TTTTATCTCTAGAGAGGAGAGGG + Intronic
1075178704 10:120189765-120189787 GTTTAGGACCTGAGAGGAGAGGG + Intergenic
1081840136 11:46194323-46194345 GGTTAGCACTAGAGAGAATAGGG - Intergenic
1083553401 11:63607599-63607621 GTTTCGGTCTTGAAAGATGAGGG + Intronic
1088709224 11:112491681-112491703 GTGTAACTCCTGAGAGGAGAAGG - Intergenic
1089660208 11:119980792-119980814 GTTCAGCTCAGAAGAGAAGATGG - Intergenic
1090734932 11:129604172-129604194 ATTTATCTCTAGGGAGAAGATGG + Intergenic
1093287143 12:17278064-17278086 GTTTATTTATTGAGAGAACAAGG + Intergenic
1094325518 12:29233793-29233815 GCCTAGCTCTGGAGGGAAGAAGG - Intronic
1095658911 12:44705543-44705565 ATTTAGCTATTTAAAGAAGAAGG - Intronic
1096165286 12:49417684-49417706 TTTTAGGTCATCAGAGAAGATGG - Intronic
1096235715 12:49924921-49924943 GTTCAGGCCTGGAGAGAAGAAGG - Intergenic
1098303948 12:69083241-69083263 GTTTAGCTCTGAATATAAGAAGG - Intergenic
1098644806 12:72885530-72885552 GTTTATCTTTTGAGAGTTGATGG - Intergenic
1098816827 12:75176263-75176285 TTTCAGCTCAGGAGAGAAGAAGG - Intronic
1099079495 12:78158951-78158973 GTTTAACTTCTGAAAGAAGATGG - Intronic
1100761699 12:97814571-97814593 GTTTGACTCTTGAGAGAACTTGG + Intergenic
1101693482 12:107102807-107102829 GTTTAGCTCTAGAAAAATGAAGG + Intergenic
1104479233 12:129093004-129093026 GCTTATCTCTTGACAGAAAAGGG - Intronic
1106367524 13:29096834-29096856 GTTCAACACTTGAGAGAAAAAGG - Intronic
1107471873 13:40698654-40698676 GTTTTGCTCTTGCGAGAATGGGG + Intergenic
1108834721 13:54528974-54528996 GTTTACTTCTTTAGAAAAGAAGG - Intergenic
1110271955 13:73600944-73600966 GTTCAGCTGTCTAGAGAAGAAGG + Intergenic
1113252268 13:108466913-108466935 GTTTAGCTCTGGAGAAAAAAGGG - Intergenic
1114773969 14:25460545-25460567 GTTCAGGCCTTGATAGAAGAGGG + Intergenic
1115105930 14:29762083-29762105 GTGGGGCTCTTGAAAGAAGATGG + Intronic
1119345765 14:73922673-73922695 GTTAAGTTTTTCAGAGAAGAGGG - Exonic
1119345871 14:73923868-73923890 GTTAAGTTATTCAGAGAAGAGGG + Intronic
1120713466 14:87816572-87816594 GTTCAGCTGCTGAGAAAAGAGGG - Intergenic
1123387276 15:19826138-19826160 GTCTAGTTCTTAAGTGAAGATGG + Intergenic
1128863369 15:71093247-71093269 TGTTAGCTCTTGAGAGAACTGGG - Intergenic
1129942281 15:79508879-79508901 ATTAAGATCTTCAGAGAAGAAGG - Intergenic
1130711887 15:86291248-86291270 GCTTAGATCTTGAAAGAAGAGGG - Intronic
1131944208 15:97601267-97601289 TTTTAGTTCTTTGGAGAAGAGGG + Intergenic
1133857988 16:9567451-9567473 GTTTAGCTCAAGAGACAATATGG - Intergenic
1135353217 16:21747930-21747952 GTTTGGCTATGGAGAAAAGATGG - Intronic
1135451704 16:22564053-22564075 GTTTGGCTATGGAGAAAAGATGG - Intergenic
1135884348 16:26291960-26291982 GTTTAAGTCAAGAGAGAAGAAGG + Intergenic
1137861906 16:51855399-51855421 GTTTTGCTCTTGAGAGAAAGAGG + Intergenic
1139279748 16:65760119-65760141 GTTTAGATCGTGATGGAAGAGGG + Intergenic
1139566654 16:67781768-67781790 ATCTAGCTCAAGAGAGAAGAGGG + Intronic
1141303602 16:82840217-82840239 GTTTAGCAGGTTAGAGAAGAGGG + Intronic
1142391685 16:89805199-89805221 GCAGAGCTCTTGAGAGCAGAAGG + Intronic
1143031543 17:3970711-3970733 GTATAGCTTGAGAGAGAAGAGGG - Intergenic
1143802487 17:9395751-9395773 TTTTGGCTGTTGAGAAAAGAAGG - Intronic
1145924676 17:28637393-28637415 GTTTAGTTCTAGAGAGTAAATGG - Intronic
1146306716 17:31735580-31735602 GATTAGCCCTTGTGTGAAGAAGG - Intergenic
1146500182 17:33357275-33357297 GTTTAGCGAGGGAGAGAAGAAGG + Intronic
1147142686 17:38468233-38468255 GGTTGGCTTTTGAGAGCAGAGGG + Intronic
1149394735 17:56228411-56228433 GATTAGTTCTGGAGAGAATACGG - Intronic
1150914543 17:69423202-69423224 GTATAGCCCGTGAGCGAAGATGG + Intronic
1156558927 18:38099474-38099496 GTTCATCTCTTGAGAGATCACGG + Intergenic
1158300390 18:56045622-56045644 GTTTACCTCTTGAAACAATATGG - Intergenic
1159908212 18:74117873-74117895 GTCTAGAACTTCAGAGAAGAGGG - Intronic
1162915966 19:13874599-13874621 GTTTATTTCATGAGAGAAAAGGG + Intronic
1168093372 19:54100406-54100428 TCTTAGCTCCTGAGAGAAGAGGG - Intronic
925621172 2:5794258-5794280 GTTTTCCTCTGGAGAGAAGGTGG - Intergenic
925742051 2:7014469-7014491 GTTGAGCTCTTGATCAAAGAAGG + Exonic
925958216 2:8990256-8990278 GTTTAGCCCTTGTGAAATGAAGG - Intronic
928207088 2:29292935-29292957 GTTGTGCACTTGAGAGAAAAGGG - Intronic
928935872 2:36677427-36677449 AGTGAGCTCTTGAGAGAAAATGG - Intergenic
929717419 2:44327125-44327147 ATGTAGCTCTTTAGAGAAAAAGG + Intronic
929848811 2:45561942-45561964 GTTTAGCTCTTTAAGGATGATGG - Intronic
931948997 2:67340394-67340416 ATTTAGCACTTGTGACAAGATGG - Intergenic
936669937 2:114645477-114645499 GTTTACCTCATAAGAGAAGCAGG - Intronic
937549001 2:123063305-123063327 GTTTATCTGTGGAGAGAAGGAGG - Intergenic
942929747 2:181475365-181475387 GTTTAGATGTTCAGAGGAGAGGG + Intronic
942954512 2:181758665-181758687 GTTCTGCTCTAGAGAGAAAATGG - Intergenic
945397005 2:209331436-209331458 ATTTAGGTCTGGAGATAAGATGG - Intergenic
946989312 2:225310111-225310133 AATTAGCTTTTGAGAGAAGGCGG + Intergenic
948364701 2:237447137-237447159 ATTTTGCTCTAGAGCGAAGAGGG - Intergenic
1169458167 20:5771067-5771089 GTTTTGCTTTTGAGAGCACATGG + Intronic
1170085916 20:12531385-12531407 GTTTTGAACTTGAGGGAAGAAGG + Intergenic
1170142170 20:13135618-13135640 GTTTAGATCTTCAGATAAGTGGG - Intronic
1170374051 20:15680377-15680399 GTTTAGTTGATGAGAGGAGAAGG - Intronic
1172823869 20:37763330-37763352 GTGTAGCTCTTGGCACAAGATGG + Intronic
1172962838 20:38810595-38810617 GTTTCTCACCTGAGAGAAGAGGG + Intronic
1173131223 20:40395530-40395552 GTTTAGATCTTCTGAGAAGTGGG + Intergenic
1173354775 20:42277011-42277033 GCTTAGCTCTTATGAAAAGAAGG + Intronic
1173453740 20:43188261-43188283 GATTAGCAAGTGAGAGAAGAGGG - Intronic
1173860028 20:46277320-46277342 GTTTACCTCTGGAGAGCAGCGGG + Intronic
1174856564 20:54051029-54051051 TTTTAGCTTTTGAGTGAAAAAGG + Intronic
1175398457 20:58684601-58684623 GTTTAGTTCCTGAGACATGAAGG + Intronic
1178005556 21:28216159-28216181 TTTTAGATATTGAGAGCAGAAGG + Intergenic
1178759175 21:35384173-35384195 CATTAGCCCTTGAGAGAATAGGG - Intronic
1179228313 21:39476245-39476267 GCTTGGCTCTTTACAGAAGAGGG + Intronic
1182638231 22:31746270-31746292 GTTTAGATCTTGAGAAATAATGG - Intronic
1184483700 22:44763582-44763604 ATTTAGCTCATGAGAGAATCAGG + Intronic
1185393043 22:50573008-50573030 CTTTAGCTCTGGAAAGAATAAGG - Exonic
950272033 3:11624540-11624562 GTTTGCCTCTTGAGAGATCAGGG + Intronic
951506963 3:23457778-23457800 GTTTAGCTCATGAGACACAAAGG - Intronic
952062815 3:29530976-29530998 ATTAAGCTCTTGAGAGGAAAGGG - Intronic
954208320 3:49077332-49077354 GCTTGGCTCTGCAGAGAAGATGG - Intronic
954728838 3:52639975-52639997 GTTTAGCTCTTGAGAGAAGAGGG + Intronic
954985232 3:54784726-54784748 GTTTGCCTCCTGAGAGAAGAGGG + Intronic
956043576 3:65172046-65172068 TGTTATCTCTTTAGAGAAGATGG - Intergenic
956506351 3:69944338-69944360 TTTTAGCCCTTGAGGGGAGAAGG + Intronic
957315178 3:78567384-78567406 CTCTAGCTCTTAAGAGTAGAAGG + Intergenic
957338842 3:78866790-78866812 ATTTATCTCTTGAGAATAGAGGG + Intronic
957396844 3:79651198-79651220 CATTAGCTCTTAGGAGAAGAAGG + Intronic
959895827 3:111604758-111604780 ATCTAGCTCTTTACAGAAGAAGG - Intronic
961999983 3:131285624-131285646 GTTTTGCTCTTGAGAAACGTGGG - Intronic
963025583 3:140915810-140915832 GGTTAGATCTTGAAAGAAGATGG + Intergenic
964694281 3:159489960-159489982 AGTTACCTCTGGAGAGAAGAGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969893467 4:10280735-10280757 GGTTGGCTCTTGAGGAAAGATGG + Intergenic
970359933 4:15298815-15298837 GTTTAGCTCTTGAAAGGAAAAGG + Intergenic
971285080 4:25281152-25281174 GTTCAGATAATGAGAGAAGAGGG + Intergenic
971809778 4:31409624-31409646 ATTTAGCTTTTTAGAGAACAAGG - Intergenic
981038748 4:140199991-140200013 GATTAGGTCATGAGAGTAGAAGG - Intergenic
984947306 4:184979817-184979839 GTTTAGCTGGTGGGAGCAGAAGG + Intergenic
985980549 5:3458810-3458832 CTTTTGCTCTTGACAGAAGAGGG - Intergenic
987550998 5:19381436-19381458 GTTTATGTCTTCAGAGAGGATGG + Intergenic
988722732 5:33894089-33894111 GTTATGGTCTTGAGAGTAGATGG - Intergenic
989405325 5:41054612-41054634 GTTTATCTCTTTGGAAAAGATGG + Intronic
991109737 5:62885786-62885808 GTTTACTTCTTGAGAGAAATTGG - Intergenic
991132554 5:63140743-63140765 TTTGAGCTTTTGAGAGAACAAGG - Intergenic
992714652 5:79498088-79498110 CTTTAACTCTTGACTGAAGAAGG - Intronic
993463180 5:88211027-88211049 GTACAGCTCTTGAGCTAAGATGG - Intronic
994066730 5:95552020-95552042 GTTTACTTCTTGAGAGAGCAAGG - Intronic
994133170 5:96254606-96254628 ACTTAGCTCTTGAGAGAGAAAGG + Intergenic
994984747 5:106918271-106918293 GTTTATCTCCTCAGAGAAGGTGG + Intergenic
996694258 5:126376491-126376513 ACAAAGCTCTTGAGAGAAGAGGG - Intronic
996726140 5:126674756-126674778 TTTAAGTTCTTGAGAGAAGAAGG + Intergenic
997047865 5:130341641-130341663 GTTTAGAGCTTGAGTGAAAATGG - Intergenic
997050664 5:130375928-130375950 TGTTTGCTCCTGAGAGAAGATGG + Intergenic
998664862 5:144285211-144285233 GTTTAGCACTTGAGAAAATCTGG + Intronic
1000352544 5:160363244-160363266 CTTTAGCTTTTCAGAGAAGCTGG - Intronic
1000667324 5:164014878-164014900 GGTAAGCTATTTAGAGAAGACGG - Intergenic
1000701436 5:164456200-164456222 ATTTAGCTTTGGATAGAAGAAGG - Intergenic
1002849814 6:983673-983695 GTTTAACTTTGGAGAGAAGCTGG + Intergenic
1002940133 6:1708577-1708599 GTTTAGATCTTGGGAAAAGCAGG + Intronic
1003143616 6:3491858-3491880 ATTAAGCTCTTGAAAGAAGTTGG - Intergenic
1003643840 6:7898415-7898437 GATTAGGTCATCAGAGAAGATGG + Intronic
1004847896 6:19665890-19665912 GTTGAGCCCTTAATAGAAGAAGG + Intergenic
1004963184 6:20815970-20815992 CTATAGCTCTGGAGAGAACATGG - Intronic
1007939186 6:45761446-45761468 GATTAGCTCTTAAGAGAAGCTGG - Intergenic
1009581694 6:65543547-65543569 GTTTATCTCTTCATAGAAAAGGG + Intronic
1010374145 6:75146981-75147003 GTTGGGCTCTAGGGAGAAGAAGG - Intronic
1010402696 6:75465063-75465085 GTTTAGCTCCTGTGTTAAGAAGG - Intronic
1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG + Intergenic
1014282062 6:119452734-119452756 AGATAGCACTTGAGAGAAGATGG - Intergenic
1015048191 6:128804335-128804357 ATTTAGCTAGTGAGACAAGATGG + Intergenic
1016493133 6:144629525-144629547 GGTTACTTTTTGAGAGAAGAAGG - Intronic
1023674178 7:42613318-42613340 AGTCAGCTTTTGAGAGAAGAAGG - Intergenic
1027230612 7:76269679-76269701 GTTTAGCTGGTGAGGGAAGAGGG + Intronic
1027262945 7:76478051-76478073 GTATAGTGCTTGAGAGACGAGGG - Intronic
1027314329 7:76976152-76976174 GTATAGTGCTTGAGAGACGAGGG - Intergenic
1028084766 7:86623073-86623095 GTCTAGATCTTGACAAAAGATGG + Intergenic
1030240262 7:107314915-107314937 GTTAAGGGCTTGAGATAAGAGGG - Intronic
1030434151 7:109493926-109493948 ACTTAGGTCTTGAGTGAAGATGG + Intergenic
1033900871 7:146137489-146137511 ATTTAGGACTTGAAAGAAGAAGG + Intronic
1037132489 8:15423856-15423878 GTTTCTCTATTGAGAGAAGGCGG + Intronic
1037143709 8:15548275-15548297 GTTTAAGTATTGAGAGAAGCTGG + Intronic
1038127122 8:24687023-24687045 TTTTATCTCTTGAGAGAAATGGG + Intergenic
1038775580 8:30527775-30527797 GTTTAGCTCTTGAGAAGAGATGG + Intronic
1042840495 8:73118607-73118629 TTCTAGCTCTGGAGAGGAGATGG - Intronic
1044063376 8:87667265-87667287 GATTAGCCCTTGAGAAAAGAAGG + Intergenic
1044156919 8:88859613-88859635 GTTCACGACTTGAGAGAAGAAGG - Intergenic
1044525597 8:93247324-93247346 TTTGAGCTCATGACAGAAGATGG - Intergenic
1044684942 8:94817444-94817466 GTTTGGCTCTGAAGAGAAGAGGG - Intronic
1045373968 8:101552851-101552873 GTTTTGTTCTTGAGAGGAGATGG + Intronic
1046096649 8:109570563-109570585 GTTGAGCTGTTCAGAAAAGAGGG - Intergenic
1048319576 8:133387874-133387896 GGTTGGCTCATGAGGGAAGACGG + Intergenic
1052603420 9:30669984-30670006 TTGTGGCTCTAGAGAGAAGAGGG + Intergenic
1055991084 9:82106465-82106487 GATTAGCCCTTGAGAGAAAAGGG + Intergenic
1056706976 9:88959674-88959696 GTTTCTCTCTTGAGAAATGAAGG + Intergenic
1056921704 9:90796343-90796365 ACTCAGATCTTGAGAGAAGAAGG + Intergenic
1059821494 9:117978300-117978322 GATAACTTCTTGAGAGAAGAGGG + Intergenic
1059857052 9:118411192-118411214 GTAAAGCTCTATAGAGAAGACGG + Intergenic
1060795241 9:126508586-126508608 GTTTAGGGCTTGAGATAGGATGG - Intergenic
1185956673 X:4498439-4498461 GTTTGGAGCTTGAGAGAAGCTGG + Intergenic
1186078346 X:5904288-5904310 GTTTTGCTTGTGAGACAAGAGGG - Intronic
1189088266 X:38049501-38049523 GTTTAGCTCTTGATCCAGGATGG + Intronic
1189828742 X:44948407-44948429 TTTTAGTTCATGAGAGAAGGGGG + Intronic
1191956133 X:66644250-66644272 GAATAGCTCTTCAGAGAGGATGG - Intergenic
1192113203 X:68386244-68386266 TTTCAGCCCCTGAGAGAAGACGG + Intronic
1192338792 X:70244368-70244390 GTTGATATCTTGTGAGAAGAAGG + Intergenic
1192435013 X:71137711-71137733 GTATAGCCCTGGAGGGAAGAAGG - Exonic
1192678262 X:73223105-73223127 GCTTAGCGCTGTAGAGAAGATGG + Intergenic
1192902898 X:75519239-75519261 GCTTAGCTTTTTAGAGAGGAGGG - Intronic
1196211698 X:113002877-113002899 GTTGATCTTTTGAGAGAAAATGG - Intergenic
1199100246 X:143791086-143791108 ATTTAACTCTTGAGGGAAGTTGG - Intergenic
1199641936 X:149870796-149870818 GTTAATTTCTTGAGAGACGATGG - Intergenic
1200270789 X:154680724-154680746 CTTTACCTCTTGGGAGGAGAAGG - Intronic
1201745048 Y:17362886-17362908 GTTTGGAACTTGAGAGAAGCTGG + Intergenic