ID: 954731142

View in Genome Browser
Species Human (GRCh38)
Location 3:52663275-52663297
Sequence GGTCAGGGTCTACCAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954731135_954731142 13 Left 954731135 3:52663239-52663261 CCAAGGCTTCTCTGGGCAGCGAG 0: 1
1: 0
2: 1
3: 26
4: 222
Right 954731142 3:52663275-52663297 GGTCAGGGTCTACCAGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 166
954731132_954731142 27 Left 954731132 3:52663225-52663247 CCAAGCTTTCATTTCCAAGGCTT 0: 1
1: 0
2: 2
3: 26
4: 262
Right 954731142 3:52663275-52663297 GGTCAGGGTCTACCAGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954731142 Original CRISPR GGTCAGGGTCTACCAGAAGC TGG Intronic
901513673 1:9731141-9731163 GGCCAGGGCCTCCGAGAAGCCGG - Intronic
903168297 1:21536667-21536689 AGTCAGGGTCCACCTGGAGCTGG + Intronic
904055670 1:27668477-27668499 GGTCAGGGCCTTCCAGAACCCGG + Exonic
904581023 1:31544444-31544466 GATCAGGGCCTGCCAGAGGCAGG - Intergenic
906168373 1:43704821-43704843 GGCCAGGGGCTGGCAGAAGCTGG - Exonic
907467865 1:54651468-54651490 GGTCTGGGTCTTCCACAGGCTGG - Intronic
908060832 1:60346897-60346919 GGCCAGGGTTTAAAAGAAGCGGG - Intergenic
910162202 1:84285389-84285411 GACCAGGGGCTACAAGAAGCTGG - Intergenic
910872270 1:91845663-91845685 GGTCAGGGTATACTACATGCAGG - Intronic
914976823 1:152373128-152373150 GGTCAGTGGTTACCAGAACCTGG + Intergenic
920256010 1:204654979-204655001 GCTCTGGGACTACCAGTAGCTGG + Intronic
922207537 1:223461518-223461540 GGTCAGGGATTTCCAGAAGGTGG - Intergenic
924088492 1:240478777-240478799 GGTCAGTGTGTGCCAGAAACTGG + Intergenic
924757105 1:246951425-246951447 TGTCTGGGGCTACCAGAAGCTGG + Intronic
1062924823 10:1308186-1308208 GATCAGGGGCTACCAGGAGCTGG - Intronic
1073046383 10:100641387-100641409 TGTCTGGGGCTACTAGAAGCCGG - Intergenic
1075336989 10:121615777-121615799 GGGGAGGGTCTCCCAGAGGCTGG + Intergenic
1075548026 10:123370212-123370234 TGGCAGGGGCCACCAGAAGCTGG + Intergenic
1075713133 10:124541451-124541473 GGTCTGGGGCTAGCAGAGGCTGG - Intronic
1077282252 11:1751056-1751078 GGCCAGGGTCTCCCAGAAGGTGG - Intronic
1078927723 11:15889651-15889673 TGGCAGGGTCAAGCAGAAGCTGG + Intergenic
1081109662 11:39119560-39119582 GGTAAGAGTCTTCCAGAATCAGG - Intergenic
1083397074 11:62399601-62399623 GGCCAGGGTCTGCCTGCAGCGGG + Intergenic
1084443563 11:69190214-69190236 TGTCAGGTTCTACCAGGGGCAGG - Intergenic
1084582049 11:70030107-70030129 GGCCAGGGCCTCCCACAAGCAGG - Intergenic
1084722928 11:70919761-70919783 GGATAGTGGCTACCAGAAGCTGG - Intronic
1084945018 11:72633695-72633717 GGACAGTGTCTGCCAGAGGCAGG + Intronic
1087342183 11:96920771-96920793 TGACAGGAGCTACCAGAAGCTGG + Intergenic
1092293318 12:7178538-7178560 GGTAAGATTCTACTAGAAGCAGG + Intergenic
1094790324 12:33905452-33905474 GGTCATGGAGTAACAGAAGCAGG - Intergenic
1096975397 12:55696886-55696908 GGTCAGTGTCCACCTGGAGCTGG + Exonic
1097445855 12:59670116-59670138 AGCCTGGGTTTACCAGAAGCTGG - Intronic
1099147968 12:79071674-79071696 TGCCTGGGGCTACCAGAAGCTGG - Intronic
1102467526 12:113138569-113138591 GCTCAGGGTTTACCAGAAGAGGG + Intergenic
1105645245 13:22311320-22311342 GGCCTGGGGCCACCAGAAGCTGG + Intergenic
1108318310 13:49260457-49260479 GGTCAGGGTTTTTAAGAAGCAGG - Intronic
1109749756 13:66673552-66673574 TGTCTGAGGCTACCAGAAGCTGG + Intronic
1110655930 13:77998946-77998968 TGTCAGGGTTTTCCAGAGGCTGG - Intergenic
1112189681 13:97163908-97163930 TGCCTGGGGCTACCAGAAGCTGG + Intergenic
1112582209 13:100686246-100686268 GGCCAGCAACTACCAGAAGCTGG - Intergenic
1113164843 13:107428538-107428560 GGACAGGGCCTCCCAGAATCAGG + Intronic
1113509478 13:110841535-110841557 TGCCTGGGGCTACCAGAAGCTGG - Intergenic
1114416145 14:22545966-22545988 GATCAGGGGCCACCAGATGCAGG - Intergenic
1115243171 14:31269490-31269512 TGTCTGGGGCTAGCAGAAGCTGG - Intergenic
1115910779 14:38255041-38255063 AATCAGGGTCGACGAGAAGCTGG - Exonic
1117419001 14:55524985-55525007 GATCAGTGGCTACCAGAGGCTGG + Intergenic
1121918768 14:97860848-97860870 TGTCTGGGGCTACCAGAAGCTGG + Intergenic
1123625940 15:22226832-22226854 TGTCAGGGGTTATCAGAAGCAGG + Intergenic
1124179521 15:27459253-27459275 GCTCAGGGACTCCCAGCAGCAGG - Intronic
1134099226 16:11439859-11439881 GGTCAGGGTCAAGTAGAAGGTGG - Intronic
1135623019 16:23972236-23972258 GATCAGTGTCTACCACAGGCTGG + Intronic
1135738604 16:24954335-24954357 GGTCAGGGTGTACCACAATCAGG + Intronic
1137514767 16:49133493-49133515 TGTCAGGGTTTACCAAAATCAGG - Intergenic
1137645631 16:50070883-50070905 GCTCAGGGTGTACAAGAAGTCGG - Intronic
1139034078 16:62922091-62922113 TGTCTGGAGCTACCAGAAGCTGG - Intergenic
1141748538 16:85942653-85942675 CTTCAGAGTCTACCTGAAGCAGG + Intergenic
1145211566 17:21017073-21017095 GGTTAGGCTCGACCAGAGGCTGG + Intronic
1146543572 17:33718861-33718883 GGTCAGTGACAGCCAGAAGCAGG + Intronic
1147772867 17:42879659-42879681 GGGCAGGCTCCACCAGAAGGCGG - Intergenic
1147772875 17:42879682-42879704 GGGCAGGCTCCACCAGAAGGCGG - Intergenic
1148381223 17:47199651-47199673 AGACAGGGTCTCCAAGAAGCTGG - Intergenic
1149285102 17:55154222-55154244 GGTCAGGGTTTTTAAGAAGCTGG - Intronic
1149638595 17:58189349-58189371 GGTCAGGGCCAACCACATGCAGG - Intergenic
1150836321 17:68567475-68567497 GGTCAGGTTCTCCCTGAAGCTGG + Intronic
1151850775 17:76688314-76688336 GGTCATGGTCAACCAGCAGGTGG + Intronic
1152363084 17:79841313-79841335 TCTCAGGGGCCACCAGAAGCTGG + Intergenic
1152684461 17:81687288-81687310 GGTCAGGGTTTAGCAGGAGCCGG + Intronic
1153504285 18:5779990-5780012 GGAGAGGGTCAGCCAGAAGCAGG + Intergenic
1155738474 18:29255062-29255084 CTCCTGGGTCTACCAGAAGCTGG + Intergenic
1156737451 18:40277849-40277871 TGCCTGGGCCTACCAGAAGCTGG + Intergenic
1157569763 18:48704620-48704642 GCTGAGGGGCTACTAGAAGCTGG - Intronic
1157595986 18:48863873-48863895 GGCCAGGGCCTCCCAGGAGCCGG + Intergenic
1158565545 18:58551315-58551337 GGCCAGGAGCCACCAGAAGCTGG - Intronic
1158866565 18:61643467-61643489 CGTCTGGGGCTACCAGAAACTGG + Intergenic
1160889708 19:1370796-1370818 GGACCGGGCCAACCAGAAGCTGG + Exonic
1161721273 19:5904012-5904034 GGTTAGGGACTACTAGAGGCGGG + Intergenic
1161817874 19:6510942-6510964 GGTCATGGTTTACGAGCAGCGGG - Intergenic
1162013631 19:7831923-7831945 GGTCGGGGCCTGCCAGAAGCAGG + Intronic
1164776082 19:30854803-30854825 AGTCAGAGTCTACCTGCAGCTGG - Intergenic
1167177949 19:47878852-47878874 GGCAAGGGTCAACCAGAAACAGG + Intronic
925231744 2:2238992-2239014 GGTCAGGGTCCCCCAGGAGCTGG - Intronic
927153998 2:20211547-20211569 GGGAAGTGTCTACCTGAAGCTGG + Intronic
928246653 2:29635480-29635502 TGTCAGCAGCTACCAGAAGCTGG + Intronic
928693524 2:33824916-33824938 GGTCAGGCTCTTCCATAAGATGG + Intergenic
929578665 2:43068381-43068403 GGGCAGGGTCCCCCAGGAGCGGG + Intergenic
929816946 2:45240091-45240113 GGGCCAGGTCTTCCAGAAGCTGG + Intergenic
932656082 2:73612180-73612202 TGTCAGGGTCTTTCAGGAGCTGG + Intergenic
935617001 2:105096494-105096516 GGTCAGGGCCTACAAGATCCTGG - Intronic
936770013 2:115900966-115900988 GGAAAGGGTCTAACAGAAGAAGG - Intergenic
940163409 2:150739655-150739677 GGTAAGTGGCTACCAGGAGCTGG + Intergenic
942859893 2:180596950-180596972 TGCCTGGGGCTACCAGAAGCTGG - Intergenic
946072619 2:217047586-217047608 AGTCAGGGCCTCCCAGAACCAGG + Intergenic
946637291 2:221743653-221743675 TGTCTGGAGCTACCAGAAGCTGG + Intergenic
946902402 2:224384833-224384855 GGTCAGGGTCACCAAGAAGGCGG - Intronic
947354953 2:229282500-229282522 GATAAGGGTTTACCAGAAGGTGG - Intergenic
947843683 2:233226695-233226717 GGTCAGGGACTAGCAACAGCAGG + Intronic
948151521 2:235748300-235748322 GGTCAGGGTCTCATGGAAGCTGG + Intronic
1169832076 20:9836492-9836514 TGCCTGGGGCTACCAGAAGCTGG + Intronic
1171021189 20:21585690-21585712 GGTCAGTGTTTACCAGGTGCTGG - Intergenic
1172272863 20:33664223-33664245 TGTCAGGCTTTACCGGAAGCAGG - Intronic
1172597219 20:36157740-36157762 GGCCAGGGTCCCCCAGAAGTGGG + Intronic
1173157411 20:40625960-40625982 TGTCAGGAGCCACCAGAAGCTGG - Intergenic
1173189280 20:40863741-40863763 GGCCTGGGGCCACCAGAAGCTGG + Intergenic
1173284218 20:41655692-41655714 GGTTAGGATATAACAGAAGCTGG - Intergenic
1173705789 20:45109664-45109686 GGTCAGGGTCTGCCTGAATTGGG + Exonic
1174068372 20:47882436-47882458 GATTGGTGTCTACCAGAAGCTGG + Intergenic
1175202931 20:57290421-57290443 CGCCTGGGGCTACCAGAAGCTGG - Intergenic
1176160173 20:63643678-63643700 GGACAGGGCCTGCAAGAAGCAGG - Intronic
1177777511 21:25585055-25585077 TGTCAGGTGCTACCAGATGCTGG - Intergenic
1179184301 21:39072634-39072656 TGACTGGGGCTACCAGAAGCTGG + Intergenic
1179595785 21:42442187-42442209 GGCCAGAGTCTTCCAGGAGCTGG - Intronic
1180611371 22:17100372-17100394 GGTCAGGGTCAACCACAAAGTGG - Exonic
1181752920 22:25002272-25002294 GGTTAGGCTCCCCCAGAAGCAGG + Intronic
1184978211 22:48078148-48078170 TGTCCGGGGCCACCAGAAGCTGG - Intergenic
1184993326 22:48185015-48185037 TGTCTGGGGCCACCAGAAGCTGG + Intergenic
1185337783 22:50278465-50278487 GGTGGGGGTCTCCCAGCAGCCGG - Exonic
953822937 3:46223942-46223964 GATCAGGGTGTGCCAGGAGCTGG + Intronic
954731142 3:52663275-52663297 GGTCAGGGTCTACCAGAAGCTGG + Intronic
956704427 3:71987188-71987210 TGCCAGGCTCCACCAGAAGCTGG + Intergenic
962908523 3:139826544-139826566 GGTCATGGTCTACAAGAACAGGG - Intergenic
963303018 3:143620065-143620087 AGGCAGGGGCTACCAGAAGAAGG - Intronic
963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG + Intronic
967965392 3:194956526-194956548 GGTCTTGGTCAACCAGATGCAGG - Intergenic
967997196 3:195175566-195175588 GGTCTGGGTGTTTCAGAAGCAGG + Intronic
968123576 3:196142879-196142901 AGACAGGGTCTTTCAGAAGCGGG - Intergenic
969664048 4:8546912-8546934 CGTCTGGGACTACCAGGAGCAGG + Intergenic
970656512 4:18236375-18236397 TGTCTGGGACTACCAGAAGCTGG + Intergenic
971176433 4:24286808-24286830 GCTCAGGGTCTCCCACAAGAAGG + Intergenic
975094915 4:70446430-70446452 TGTCTGGGGCTACCAGAAACTGG - Intronic
975395502 4:73869536-73869558 GGCCAGCGGCTACCAGGAGCAGG - Exonic
975716941 4:77214213-77214235 GCTGAGGCTCTACCAGAAGGTGG - Intronic
976196572 4:82537805-82537827 GGCCAGGAGCCACCAGAAGCTGG + Intronic
977740445 4:100474812-100474834 GGTTAGTGGTTACCAGAAGCTGG + Intronic
977792750 4:101127514-101127536 GGCCTGGAGCTACCAGAAGCTGG + Intronic
978348563 4:107797626-107797648 TGTGTGGGGCTACCAGAAGCTGG + Intergenic
980138731 4:128889431-128889453 TGTCTGAGGCTACCAGAAGCTGG + Intronic
980911032 4:138994797-138994819 AGTCAGTCTCTAACAGAAGCTGG - Intergenic
992502768 5:77358111-77358133 GATCATGGTTTGCCAGAAGCTGG - Intronic
997925234 5:138024379-138024401 TGCCAGGAACTACCAGAAGCTGG + Intronic
998607135 5:143647033-143647055 GGTCAGGGAATTTCAGAAGCAGG + Intergenic
999850452 5:155532221-155532243 GGTCAGGGTCTATCGTAAGAAGG + Intergenic
1000374205 5:160564423-160564445 GGCCAGTGTCTTCCAGAGGCTGG + Exonic
1004067426 6:12262402-12262424 AGTCAAGGTCGACCAGATGCAGG + Intergenic
1005461082 6:26070989-26071011 AGTCTGGGGATACCAGAAGCTGG - Intergenic
1006585869 6:35111546-35111568 TGTCAGCAGCTACCAGAAGCTGG + Intergenic
1007071620 6:39042259-39042281 TGTCTGAGGCTACCAGAAGCTGG + Intergenic
1012063919 6:94522704-94522726 AGGCCTGGTCTACCAGAAGCTGG + Intergenic
1014251288 6:119117885-119117907 GGTGGGGGTATCCCAGAAGCAGG + Intronic
1019491553 7:1316158-1316180 GGTCTGGGGGTACCTGAAGCTGG + Intergenic
1020096835 7:5374247-5374269 GGCCAAGGTCATCCAGAAGCTGG - Exonic
1020401909 7:7788565-7788587 GATTAGGATCTACCAGTAGCAGG + Intronic
1021704442 7:23352733-23352755 GGGCAGTGACTACCGGAAGCAGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025220642 7:57104696-57104718 AGTCAGGGCCTACCAAGAGCTGG + Intergenic
1025631458 7:63276508-63276530 AGTCAGGGCCTACCAAGAGCTGG + Intergenic
1028398947 7:90403975-90403997 GGTCTGGGTCTACCACACACAGG + Intronic
1029112793 7:98222288-98222310 GGCCAGGGTCCCCCAGAAGCTGG - Intronic
1029174858 7:98657562-98657584 GGCCTGGGGCCACCAGAAGCTGG + Intergenic
1030977772 7:116148164-116148186 GGTCAGAGTATTCCAGAAACAGG + Intronic
1032004418 7:128288797-128288819 AGTCTGGGGCTACCAGAAGCTGG + Intergenic
1035422336 7:158740142-158740164 GGTCAGGGTCTGCCATCAGGAGG - Intronic
1035713368 8:1735609-1735631 GTTCAGGGTCTCCCACAAGAGGG + Intergenic
1038123251 8:24642088-24642110 GGTCTGGGTCCATCGGAAGCTGG + Intergenic
1038182325 8:25240919-25240941 GGCCAGTATCCACCAGAAGCTGG - Intronic
1039380813 8:37083304-37083326 CATCTGGGGCTACCAGAAGCTGG - Intergenic
1039816074 8:41095582-41095604 TGCCAGGGGCTATCAGAAGCTGG - Intergenic
1040457193 8:47610550-47610572 GCTCTGGGTCTAGCAGCAGCTGG - Intronic
1043373244 8:79617523-79617545 TTTCAGGGTCTCTCAGAAGCTGG + Intronic
1044543332 8:93431772-93431794 TGCCAGTGGCTACCAGAAGCTGG - Intergenic
1045307911 8:100974701-100974723 GGTTAGGTTCTCCCAGAAGCAGG + Intergenic
1049317157 8:141975432-141975454 GGACAGGGTCACCCAGGAGCAGG + Intergenic
1049426915 8:142541817-142541839 GGCCAGGGTCTCCCAGGAGGTGG + Intronic
1058116410 9:101090043-101090065 TGTCTGGGGCTCCCAGAAGCTGG - Intronic
1062250165 9:135589887-135589909 GACCAGGGTGTTCCAGAAGCAGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062554409 9:137107463-137107485 GGTCAGGGTCCATCAGGAGGAGG + Intronic
1062658335 9:137615394-137615416 GGTCAGGCCCTGCCAGAGGCTGG - Exonic
1189122068 X:38405404-38405426 TGCCTGGGGCTACCAGAAGCAGG - Intronic
1194616612 X:96111361-96111383 TGCCAGGAACTACCAGAAGCTGG - Intergenic
1195942305 X:110176288-110176310 GGGCAGGGAGGACCAGAAGCAGG - Exonic
1196988898 X:121305936-121305958 GGGCAGGGTATACCAGCAGTTGG - Intergenic
1197419265 X:126217777-126217799 AGTCTGGGGCTACCAGAAGCTGG + Intergenic
1199574118 X:149296987-149297009 GATCAGGGTCTGCCAGATGTAGG - Intergenic