ID: 954733037

View in Genome Browser
Species Human (GRCh38)
Location 3:52681536-52681558
Sequence ATAGATTGTTTAAAAGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954733037_954733041 14 Left 954733037 3:52681536-52681558 CCAATCCCTTTTAAACAATCTAT 0: 1
1: 1
2: 2
3: 25
4: 305
Right 954733041 3:52681573-52681595 TGAATTTGATGAACATAAGGAGG 0: 1
1: 0
2: 1
3: 18
4: 226
954733037_954733043 26 Left 954733037 3:52681536-52681558 CCAATCCCTTTTAAACAATCTAT 0: 1
1: 1
2: 2
3: 25
4: 305
Right 954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 194
954733037_954733040 11 Left 954733037 3:52681536-52681558 CCAATCCCTTTTAAACAATCTAT 0: 1
1: 1
2: 2
3: 25
4: 305
Right 954733040 3:52681570-52681592 AAGTGAATTTGATGAACATAAGG 0: 1
1: 0
2: 1
3: 27
4: 311
954733037_954733042 15 Left 954733037 3:52681536-52681558 CCAATCCCTTTTAAACAATCTAT 0: 1
1: 1
2: 2
3: 25
4: 305
Right 954733042 3:52681574-52681596 GAATTTGATGAACATAAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954733037 Original CRISPR ATAGATTGTTTAAAAGGGAT TGG (reversed) Intronic