ID: 954733039

View in Genome Browser
Species Human (GRCh38)
Location 3:52681542-52681564
Sequence TTTGTCATAGATTGTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 346}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954733039_954733044 25 Left 954733039 3:52681542-52681564 CCTTTTAAACAATCTATGACAAA 0: 1
1: 0
2: 2
3: 31
4: 346
Right 954733044 3:52681590-52681612 AGGAGGGAATCTTTGTGGAAAGG 0: 1
1: 0
2: 1
3: 31
4: 275
954733039_954733040 5 Left 954733039 3:52681542-52681564 CCTTTTAAACAATCTATGACAAA 0: 1
1: 0
2: 2
3: 31
4: 346
Right 954733040 3:52681570-52681592 AAGTGAATTTGATGAACATAAGG 0: 1
1: 0
2: 1
3: 27
4: 311
954733039_954733042 9 Left 954733039 3:52681542-52681564 CCTTTTAAACAATCTATGACAAA 0: 1
1: 0
2: 2
3: 31
4: 346
Right 954733042 3:52681574-52681596 GAATTTGATGAACATAAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 259
954733039_954733041 8 Left 954733039 3:52681542-52681564 CCTTTTAAACAATCTATGACAAA 0: 1
1: 0
2: 2
3: 31
4: 346
Right 954733041 3:52681573-52681595 TGAATTTGATGAACATAAGGAGG 0: 1
1: 0
2: 1
3: 18
4: 226
954733039_954733043 20 Left 954733039 3:52681542-52681564 CCTTTTAAACAATCTATGACAAA 0: 1
1: 0
2: 2
3: 31
4: 346
Right 954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954733039 Original CRISPR TTTGTCATAGATTGTTTAAA AGG (reversed) Intronic