ID: 954733043

View in Genome Browser
Species Human (GRCh38)
Location 3:52681585-52681607
Sequence ACATAAGGAGGGAATCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954733039_954733043 20 Left 954733039 3:52681542-52681564 CCTTTTAAACAATCTATGACAAA 0: 1
1: 0
2: 2
3: 31
4: 346
Right 954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 194
954733037_954733043 26 Left 954733037 3:52681536-52681558 CCAATCCCTTTTAAACAATCTAT 0: 1
1: 1
2: 2
3: 25
4: 305
Right 954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 194
954733038_954733043 21 Left 954733038 3:52681541-52681563 CCCTTTTAAACAATCTATGACAA 0: 1
1: 0
2: 2
3: 33
4: 405
Right 954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954733043 Original CRISPR ACATAAGGAGGGAATCTTTG TGG Intronic
902931175 1:19732562-19732584 AAATAAGGAGGGAAACTATCAGG + Intronic
903965483 1:27086440-27086462 ACAAAAGGCAGGAATCTTGGAGG + Intergenic
904644014 1:31952355-31952377 ACATAAAAAGGGATTCCTTGAGG - Intergenic
909968975 1:81957197-81957219 GCATAAGAAGGGAATTTTAGTGG - Intronic
911890926 1:103371139-103371161 ACATAGGGAGGGACCCTCTGTGG - Intergenic
911925583 1:103827129-103827151 CCGTAAGATGGGAATCTTTGGGG - Intergenic
915081987 1:153358844-153358866 ACATGAGAAGGGCCTCTTTGAGG + Intronic
916894062 1:169143167-169143189 ACATCAGGAGGCAACCCTTGAGG - Intronic
917776733 1:178345134-178345156 ACATGAAGAGGGAACCATTGAGG + Intronic
917994845 1:180425485-180425507 ACAGATGGAGGGAAGCTTTTTGG + Intronic
918163177 1:181919947-181919969 ACATGAGCAGTGAATCTCTGAGG - Intergenic
918264858 1:182832364-182832386 ACATAACAAGGTTATCTTTGAGG + Intergenic
920999958 1:211034319-211034341 TCATAAGTATGTAATCTTTGAGG - Intronic
922164123 1:223100786-223100808 ACTTCAGGAGGGACTCTCTGTGG - Intergenic
1062903333 10:1162288-1162310 ACATAAAGAGAGAATGTGTGTGG + Intergenic
1063375182 10:5550447-5550469 TCAGGAGGAGGGCATCTTTGGGG - Intergenic
1064895862 10:20235641-20235663 ACATAAAGATGGAACCTTTGGGG - Intronic
1070174989 10:73962632-73962654 TGATGAGGAGGGAAGCTTTGGGG - Intergenic
1072103850 10:92255168-92255190 ACAGAAGGAGGGATTAATTGTGG - Intronic
1072938196 10:99732991-99733013 ACATAAAGAAAAAATCTTTGAGG - Intronic
1075565548 10:123501403-123501425 ACAGAAGGAGACAATCTGTGGGG - Intergenic
1076569803 10:131425222-131425244 TCAAAAAGAGGGAATCTCTGGGG - Intergenic
1077810456 11:5631230-5631252 ACATAAGTTGGGAATTTCTGGGG - Intronic
1078922360 11:15842499-15842521 ACATAAGAAGCAAATCTTTCTGG + Intergenic
1081430979 11:42976459-42976481 CCTCAAGGAGGGGATCTTTGGGG - Intergenic
1081884397 11:46482667-46482689 GCATTAGGAAGGAATCTTTTTGG + Intronic
1082636508 11:55600871-55600893 ATAAAAGGAGGGAGTCTTTATGG - Intergenic
1082734586 11:56842118-56842140 ACATGAGAAGGGAATATTAGTGG - Intergenic
1085361955 11:75897080-75897102 TCAAAAGGAGCAAATCTTTGTGG + Intronic
1087176163 11:95097869-95097891 ACAAAAGGAGGGGCTGTTTGGGG + Intronic
1087538137 11:99478543-99478565 TCAGGAGGAGGGGATCTTTGAGG + Intronic
1088895459 11:114074880-114074902 ATGTAAAGAGGGAATCATTGTGG + Intronic
1095491555 12:42739820-42739842 ACATGAGCAGAGAATCTGTGTGG + Intergenic
1095566535 12:43630887-43630909 TCATGAGGAGGGATTCTGTGGGG + Intergenic
1096229938 12:49891165-49891187 GCATAAGCAGGGGATCTTGGGGG - Intronic
1096676221 12:53227515-53227537 CAATAAGGAGCGACTCTTTGCGG - Exonic
1099092422 12:78330040-78330062 AAATAAAGAGGGAATATTTCTGG - Intergenic
1100692822 12:97057101-97057123 CCAGAAGGCGGGAATCATTGAGG - Intergenic
1102335726 12:112077715-112077737 AAATAAAGAAGGAATGTTTGCGG + Intronic
1106068210 13:26379705-26379727 AGATACGGAGAGAATCTTTTAGG + Intronic
1107242034 13:38247788-38247810 AAAGAGGGAGTGAATCTTTGTGG + Intergenic
1109061465 13:57626649-57626671 ACAGAAGGAGAGAATAATTGTGG + Intergenic
1109142549 13:58733367-58733389 ACATAAGGCGGGAAATTTTTAGG + Intergenic
1109427682 13:62187857-62187879 ACATAAGGAGGAAATATCTGGGG + Intergenic
1110076574 13:71252774-71252796 ACAGAAGGTGGGAATATTTACGG - Intergenic
1110115169 13:71805243-71805265 AAACAAGGAGGGAATCTTGATGG + Intronic
1111759060 13:92438731-92438753 ACATATTGAGGGAATTTTGGAGG + Intronic
1112624388 13:101087227-101087249 AGAAAATGAGGGAATCTTTAGGG - Intronic
1112676506 13:101708259-101708281 ACATGAGGTGAGAATCTTTCAGG - Intronic
1113450124 13:110403072-110403094 ACCTCCGGAGGCAATCTTTGGGG - Intronic
1116316251 14:43397568-43397590 ATATAAGTAGGGAAATTTTGAGG + Intergenic
1118838457 14:69493663-69493685 AGTTAAGAAGGTAATCTTTGAGG - Intronic
1118838791 14:69495760-69495782 AGTTAAGAAGGTAATCTTTGAGG - Intronic
1119232854 14:72994442-72994464 ACATGAGGAGGGCTTCTATGAGG + Intronic
1121829481 14:97037374-97037396 ACAGAAAGAGGGAACCTCTGTGG + Intergenic
1123510008 15:20988834-20988856 ACATAAGTACAGAATCCTTGGGG - Intergenic
1125052100 15:35311510-35311532 TCATAAGGAGGGCATCTATTTGG - Intronic
1125419485 15:39490011-39490033 ACAGAAGGCAGGAATCCTTGGGG - Intergenic
1126292469 15:47098080-47098102 GTATTAGGAGGTAATCTTTGGGG + Intergenic
1128870819 15:71154106-71154128 ACAGAAGGTGAGAATGTTTGAGG + Intronic
1129040283 15:72680067-72680089 GCAAAAGCAGGGAATCTATGAGG - Exonic
1131379930 15:91955108-91955130 ACTGAAGGTGGGAATGTTTGTGG - Intronic
1132966929 16:2661544-2661566 ACTTAAAGAGCAAATCTTTGAGG - Intergenic
1136630318 16:31486067-31486089 AAAAATGGAGGGAAGCTTTGAGG + Intronic
1136642056 16:31575059-31575081 ACATAAGGAAGAAATGCTTGGGG + Intergenic
1140779571 16:78282334-78282356 ACATCAGGAGGGGATCTTTTCGG + Intronic
1143359199 17:6354053-6354075 ACATAAGTTGGTATTCTTTGAGG + Intergenic
1144306348 17:13972384-13972406 AGAAAAGGAACGAATCTTTGAGG + Intergenic
1147730595 17:42598510-42598532 ACAAAGGGAGGGAATCAGTGTGG - Intronic
1150022399 17:61630779-61630801 AAAGAAGGAGTGAATGTTTGCGG - Intergenic
1150731289 17:67697492-67697514 ACAGAAGGATGGCATCTGTGAGG - Intergenic
1203166008 17_GL000205v2_random:96147-96169 AGATAAGGATGAAATGTTTGGGG + Intergenic
1153542705 18:6173239-6173261 ACATATGCAGGGAATATTTTCGG + Intronic
1153681734 18:7507512-7507534 AGTTAAGGAGGGAAAGTTTGAGG + Intergenic
1155024147 18:21926128-21926150 ACAGCAGCAGGAAATCTTTGGGG - Intergenic
1155409793 18:25531361-25531383 ACTCAGGGAGTGAATCTTTGTGG - Intergenic
1156326809 18:36081019-36081041 ACATATTGAGGGAATAATTGAGG + Intergenic
1156740174 18:40316605-40316627 ACAGCATGAGGAAATCTTTGGGG - Intergenic
1157116032 18:44863677-44863699 ACAAAAGGATGGTACCTTTGAGG + Intronic
1158035716 18:53027322-53027344 TCATAAGGATGGATTCTCTGAGG - Intronic
1158330687 18:56358906-56358928 ATATCAGGAGGGATTCTGTGAGG - Intergenic
1159364078 18:67443573-67443595 AAACGAGGAGGGAATATTTGTGG + Intergenic
1159374816 18:67579828-67579850 ACATAATGAGGAATTCTATGAGG + Intergenic
1159893975 18:73979269-73979291 ACAGAAGCAGAAAATCTTTGAGG - Intergenic
1160611283 18:80088312-80088334 ACAAAAGGAGGCAATATTGGAGG - Intronic
1164083605 19:21881529-21881551 ACTTAAAGAGCAAATCTTTGAGG - Intergenic
1164502043 19:28828344-28828366 ACATGAGAAGGGGATCTTGGTGG + Intergenic
1164637581 19:29802639-29802661 ACTTAAGAAGGGACTCCTTGTGG + Intergenic
1166864829 19:45829473-45829495 ACAAATGAGGGGAATCTTTGAGG - Intronic
925070064 2:959735-959757 GCAGATGGAGGGAACCTTTGGGG + Intronic
927830704 2:26347199-26347221 ACGTAGGGAGGGCTTCTTTGAGG - Intronic
928587966 2:32781246-32781268 ACATAATGAGAGAATGTTTGGGG - Intronic
929084731 2:38157331-38157353 GCATAAGGAGGCAAACTTTGGGG + Intergenic
929321140 2:40544706-40544728 AGATAAGAAGGGAGTCTTTTTGG + Intronic
931296443 2:60931072-60931094 AGATAAGGTTGGAATATTTGAGG + Exonic
932489079 2:72107131-72107153 AGGTAGGGAGGGACTCTTTGAGG + Intergenic
934724432 2:96606356-96606378 TAAAGAGGAGGGAATCTTTGAGG - Intronic
936145222 2:109976173-109976195 ACAGAAGCAGGGAATCTTCCAGG + Intergenic
936199463 2:110395305-110395327 ACAGAAGCAGGGAATCTTCCAGG - Intergenic
936438935 2:112533458-112533480 AGATATGGAGGGATGCTTTGGGG - Exonic
939680275 2:145122405-145122427 ACTTAATCAGGGAATGTTTGGGG - Intergenic
941490648 2:166138707-166138729 ACACTAGTAGGGAATCTGTGTGG - Intergenic
941628808 2:167861507-167861529 ATATTAGGAGAGCATCTTTGTGG - Intergenic
942911638 2:181251568-181251590 CCATGAGGGTGGAATCTTTGTGG - Intergenic
943025251 2:182619973-182619995 CCATAAGGGTAGAATCTTTGTGG + Intergenic
944080460 2:195782290-195782312 AGTTAAAGAGGGATTCTTTGCGG - Intronic
945333004 2:208561117-208561139 ACAGTAGGTGGGAATCTTGGGGG + Intronic
946540592 2:220680289-220680311 AGATAGAGAAGGAATCTTTGAGG - Intergenic
1169252741 20:4072758-4072780 CAAGAAGGAGGGAATCGTTGGGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173424181 20:42928450-42928472 AGAGGAGGAGGGAATCTCTGGGG + Intronic
1175102704 20:56591020-56591042 ATCTAAGGAAGGACTCTTTGGGG - Intergenic
1175469647 20:59218379-59218401 GTATTAGGAGGGACTCTTTGAGG + Intronic
1175651235 20:60725523-60725545 AAATTAGTAGGGAATCTTTTTGG - Intergenic
1176335526 21:5594409-5594431 AGATAAGGATGAAATGTTTGGGG - Intergenic
1176392231 21:6226539-6226561 AGATAAGGATGAAATGTTTGGGG + Intergenic
1176405746 21:6362949-6362971 AGATAAGGATGAAATGTTTGGGG - Intergenic
1176469188 21:7089635-7089657 AGATAAGGATGAAATGTTTGGGG - Intergenic
1176492749 21:7471413-7471435 AGATAAGGATGAAATGTTTGGGG - Intergenic
1176507893 21:7666970-7666992 AGATAAGGATGAAATGTTTGGGG + Intergenic
1177802538 21:25842022-25842044 ACATAAGAACAGAATCTCTGAGG + Intergenic
1180600492 22:17012286-17012308 ACATCAGGAGGGCTTCTTGGAGG + Intergenic
1182877311 22:33703422-33703444 TTATCAGGAGGTAATCTTTGGGG - Intronic
951979625 3:28550996-28551018 AGATAAGGAGGGAACATCTGGGG - Intergenic
954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG + Intronic
955567574 3:60264785-60264807 ACTTAAGGAAGGAATTTTTAAGG + Intronic
957557039 3:81775815-81775837 ACGTAAGAACAGAATCTTTGGGG - Intergenic
959431775 3:106262889-106262911 ACAAAAGGAGGAAATCTTATGGG + Intergenic
960416910 3:117396493-117396515 AAATAAGGAGGAAATCTTTGAGG - Intergenic
960544644 3:118899686-118899708 AGGTAAGGAGGGGATTTTTGAGG + Intergenic
962703553 3:138022003-138022025 ACCTAAGGAAGGAATGTATGTGG + Intronic
966526700 3:180927274-180927296 ACCTAGGGAGTGAAACTTTGGGG + Intronic
966620174 3:181954922-181954944 TCATAAGGAGGCACTCTTTCAGG - Intergenic
966699560 3:182832353-182832375 AGTTAAGGAGAAAATCTTTGTGG - Intronic
966986775 3:185187693-185187715 ACATAAGAAGAGAAACTTTGGGG + Intergenic
968009457 3:195264205-195264227 AAATAAGGATGGCATCTATGGGG + Intronic
970113353 4:12663751-12663773 ACATAAAGAGGGAAGCTTTATGG - Intergenic
970812879 4:20116302-20116324 AAATAAGGTGAGAATCTTGGGGG + Intergenic
972274249 4:37542103-37542125 AGATAAGGAAGGAATCTCTGAGG + Intronic
975167218 4:71190134-71190156 ACATAATGTAGGAATCTTAGAGG + Intronic
976350083 4:84051208-84051230 ACATCAGCAGGGCTTCTTTGAGG + Intergenic
979814189 4:125078930-125078952 AGATAAATAGGGATTCTTTGGGG + Intergenic
980532847 4:134076612-134076634 ACTGATGGAGGTAATCTTTGCGG + Intergenic
980868254 4:138579487-138579509 ACATAAAGAGTGAATGTTTGGGG - Intergenic
990203314 5:53402235-53402257 AGAAAAGGAGGGAATCTCAGAGG - Intergenic
991052113 5:62284392-62284414 ACAGGAGGTGAGAATCTTTGGGG - Intergenic
992506527 5:77392573-77392595 AGATAATTTGGGAATCTTTGAGG + Intronic
993931240 5:93944097-93944119 ACAAAAGGAGGTCATCTTTGAGG + Intronic
996337355 5:122399183-122399205 AGATGAGGAGGGAAGCTCTGAGG + Intronic
999564415 5:152841408-152841430 ACACAAGGAGGCTCTCTTTGGGG + Intergenic
1001376363 5:171262944-171262966 ACAGAAAGAGGGAAGTTTTGGGG - Intronic
1001578181 5:172778740-172778762 ACAGAAGGAGGCTCTCTTTGGGG - Intergenic
1001769052 5:174278842-174278864 ACACAAGGAGGGGAGCTTTGGGG + Intergenic
1002004806 5:176223339-176223361 ACAAAAGCAGGGGATTTTTGGGG + Intergenic
1002221570 5:177687281-177687303 ACAAAAGCAGGGGATTTTTGGGG - Intergenic
1002438327 5:179248293-179248315 ACAAAAGAAGGAAATATTTGAGG + Intronic
1002787724 6:417214-417236 AGAGAAGGAAGGAGTCTTTGAGG - Intergenic
1003297343 6:4843391-4843413 ACATATTGAGGGAATAATTGAGG - Intronic
1003419320 6:5941491-5941513 ACATAAGGACGCACTGTTTGAGG + Intergenic
1004775412 6:18838835-18838857 ACCTATGGAGGGGATTTTTGTGG - Intergenic
1006707371 6:36032456-36032478 ACAGAAGGGGAGAATCTTTGTGG + Intronic
1008021357 6:46581628-46581650 ACACAAAGAGGGAATTGTTGTGG + Intronic
1008601844 6:53104089-53104111 ACACAAGGAGAGAAACTGTGAGG - Intergenic
1010767355 6:79791295-79791317 GGATGAGGAGGGCATCTTTGTGG - Intergenic
1013908191 6:115240886-115240908 ACTTCAGGAGTGAAGCTTTGTGG + Intergenic
1014288220 6:119527655-119527677 AAAAAAGGAGGGAGACTTTGTGG + Intergenic
1016736859 6:147488823-147488845 ACACAGGGCTGGAATCTTTGGGG - Intergenic
1017867640 6:158457777-158457799 AAATGAGGAGGGAATTTTTGAGG + Intronic
1017909313 6:158779475-158779497 ACATAAGGTGTTAATGTTTGAGG + Intronic
1019576861 7:1741750-1741772 ACATGAGGAGGAAATCTGGGGGG + Intronic
1020052930 7:5094565-5094587 CCATAAGGAGGGAACCTGGGAGG - Intergenic
1021694198 7:23260520-23260542 ACATAATGGGGAGATCTTTGAGG - Exonic
1023253048 7:38285548-38285570 ACCTAAAGAGGGATTCTGTGCGG + Intergenic
1024037606 7:45522147-45522169 ACATGAGGATGGAATATTTATGG - Intergenic
1024949586 7:54845769-54845791 ACATAAGGAAACACTCTTTGGGG - Intergenic
1027940507 7:84672963-84672985 ACATAAGGATGGATTTTTTCTGG + Intergenic
1027952270 7:84832099-84832121 AGATAGGGAGTGAATATTTGTGG + Intergenic
1028059699 7:86296826-86296848 ACGCAAGGAAGGAATTTTTGGGG - Intergenic
1028464574 7:91135781-91135803 ACAAAAGAAGGGAATTTGTGTGG + Intronic
1028768220 7:94584544-94584566 ACATTAACAGGGAATCTTTCTGG + Intergenic
1032001464 7:128268104-128268126 ACATGTGGAGGTGATCTTTGGGG + Intergenic
1034261093 7:149756109-149756131 AGATCAGGAGGGCATCTCTGAGG - Intergenic
1037145828 8:15571646-15571668 AAATAAAGAGGGAATCAATGTGG - Intronic
1038263841 8:26021220-26021242 ACATGAGGAGGGAGTCTGTGAGG + Intronic
1038680929 8:29666139-29666161 ATATAAGTAGGGAAACATTGAGG - Intergenic
1041152493 8:54950509-54950531 ACAAAAGGAAGGAGTCTTTGTGG + Intergenic
1042023608 8:64399321-64399343 ACATCAGGAAGGAATCTGTTTGG + Intergenic
1042551736 8:70000172-70000194 CCATGAAGAGGGAATCTGTGAGG - Intergenic
1043059933 8:75487742-75487764 ATACAAGGAGTCAATCTTTGTGG - Intronic
1043096776 8:75985190-75985212 AAATAACAAGGGAATCTTTCAGG - Intergenic
1045014192 8:97984933-97984955 AGAGAAGGAGGAAACCTTTGAGG + Intronic
1046185944 8:110718315-110718337 ACATAAAAAGGGAGTATTTGGGG - Intergenic
1047773743 8:128051407-128051429 ACATAAGGAGGTCTTCATTGAGG - Intergenic
1048439928 8:134452444-134452466 ACATAAGAAGGGAAGCCTGGAGG - Intergenic
1051570079 9:18546140-18546162 ACTTAAAGAGGTTATCTTTGAGG + Intronic
1051874461 9:21776738-21776760 AGACAAGGAGGGAATGTTGGAGG + Intergenic
1053426847 9:38015837-38015859 ACATAAGCAGGTAAACTGTGGGG + Intronic
1055017689 9:71636333-71636355 AAATAAGGAGGCTTTCTTTGAGG - Intergenic
1057939551 9:99269394-99269416 CCATAGGGAAGGAATATTTGGGG - Intergenic
1058068139 9:100572180-100572202 AAAAAAGGAGTAAATCTTTGTGG + Intronic
1058254341 9:102742696-102742718 AGATCAGGAGGGAATCTATGTGG + Intergenic
1058354878 9:104072846-104072868 ATATAATGAATGAATCTTTGTGG - Intergenic
1203440129 Un_GL000195v1:182554-182576 AGATAAGGATGAAATGTTTGGGG - Intergenic
1186384968 X:9100721-9100743 ACACAAGGAGGGTATTTTAGGGG + Intronic
1187759802 X:22568986-22569008 ACATAATGAGGTAATATTTTTGG - Intergenic
1189993518 X:46616865-46616887 AGAAAAAGAGGGAATCTTTGAGG - Intronic
1192197101 X:69035767-69035789 ACATCAGGAGCTAATATTTGAGG + Intergenic
1194474557 X:94342868-94342890 ACATTAGGAGAGAAGATTTGGGG - Intergenic
1195498136 X:105561818-105561840 AAAAAAGCAGGGAAGCTTTGTGG + Intronic
1196224017 X:113144156-113144178 ATCTTAGGATGGAATCTTTGAGG - Intergenic
1196383176 X:115116837-115116859 ACATAGGAAAGAAATCTTTGTGG + Intronic
1197218414 X:123888875-123888897 ACATAAGCAGTGAATGTTTTTGG - Intronic
1197325086 X:125082903-125082925 ACATAAAGAGGAGATGTTTGAGG - Intergenic