ID: 954733043

View in Genome Browser
Species Human (GRCh38)
Location 3:52681585-52681607
Sequence ACATAAGGAGGGAATCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954733037_954733043 26 Left 954733037 3:52681536-52681558 CCAATCCCTTTTAAACAATCTAT 0: 1
1: 1
2: 2
3: 25
4: 305
Right 954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 194
954733038_954733043 21 Left 954733038 3:52681541-52681563 CCCTTTTAAACAATCTATGACAA 0: 1
1: 0
2: 2
3: 33
4: 405
Right 954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 194
954733039_954733043 20 Left 954733039 3:52681542-52681564 CCTTTTAAACAATCTATGACAAA 0: 1
1: 0
2: 2
3: 31
4: 346
Right 954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954733043 Original CRISPR ACATAAGGAGGGAATCTTTG TGG Intronic