ID: 954733918

View in Genome Browser
Species Human (GRCh38)
Location 3:52689082-52689104
Sequence AGCCTCCGATGTTGTCCTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954733915_954733918 23 Left 954733915 3:52689036-52689058 CCTTGATAATGTAGTTCTGGTCA 0: 1
1: 0
2: 0
3: 12
4: 130
Right 954733918 3:52689082-52689104 AGCCTCCGATGTTGTCCTAGAGG 0: 1
1: 0
2: 0
3: 1
4: 38
954733917_954733918 -6 Left 954733917 3:52689065-52689087 CCTTGATAGGTGATTGAAGCCTC 0: 1
1: 0
2: 0
3: 15
4: 201
Right 954733918 3:52689082-52689104 AGCCTCCGATGTTGTCCTAGAGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954733918 Original CRISPR AGCCTCCGATGTTGTCCTAG AGG Exonic
911344958 1:96685148-96685170 AGCCTCTGATGTGATCCTACTGG - Intergenic
1069776159 10:70928506-70928528 AGCCTCCTATGAAGTCCCAGGGG + Intergenic
1075204216 10:120432797-120432819 AGCATCCGATGTTAACCTAGTGG + Intergenic
1075419868 10:122292662-122292684 AGCCTAAGAAGTTGTCCTTGAGG - Intronic
1080772792 11:35357765-35357787 AGCCTTGGTTGTTGTCCTAATGG - Intronic
1081311880 11:41584219-41584241 AGCCTCTCATGTTGCCATAGTGG + Intergenic
1082062098 11:47869703-47869725 AGCCTAAGATGGTGTCCCAGAGG + Intergenic
1091590449 12:1839643-1839665 TGCCTCCCATGTGGTCCTTGGGG - Intronic
1102441514 12:112967365-112967387 CGGCTCCCATGTTGTCCCAGTGG - Intronic
1105393840 13:20009287-20009309 AGGCTCTGATGTTTTCATAGGGG + Intronic
1113957040 13:114104563-114104585 AGCATCCGATGCCCTCCTAGTGG + Intronic
1125775589 15:42209582-42209604 GACCTACGATGTTTTCCTAGGGG - Intergenic
1130152236 15:81319955-81319977 AGCCTCCTATGTTGTGCCTGGGG + Intronic
1131535074 15:93230420-93230442 ACCTTCTGATGTTGTCCTATTGG + Intergenic
1133346128 16:5071765-5071787 AGCCTCCGAAGTGGGCCGAGAGG - Intronic
1139834055 16:69824148-69824170 AGCCTCCCAGGTTCTCCCAGGGG + Intronic
1146587918 17:34098650-34098672 AGCCTCCTATGTTTTCTTTGAGG - Intronic
1156511107 18:37637599-37637621 TGCCTCCAATGTTGTCTTACTGG - Intergenic
927979659 2:27366758-27366780 AGCCTCCTATGTGCTCCCAGAGG - Exonic
928228525 2:29476081-29476103 AGCATCCTAAGTTGTTCTAGAGG - Intronic
931132561 2:59353530-59353552 ACATTCCGATGTTGTCCCAGTGG - Intergenic
932131537 2:69192017-69192039 AGCACCAGATGTTGTCCTAAGGG + Intronic
934134960 2:88986733-88986755 ACTCTCCCATTTTGTCCTAGGGG + Intergenic
934235346 2:90227017-90227039 ACTCTCCCATTTTGTCCTAGGGG - Intergenic
1171787133 20:29478275-29478297 AACCTCCGTTGTTCTCCCAGTGG + Intergenic
951520939 3:23610179-23610201 AGCCTCCCTGGTTGTCCTGGGGG + Intergenic
952541954 3:34376198-34376220 AGACTCTGAGGTTGTCATAGTGG + Intergenic
954733918 3:52689082-52689104 AGCCTCCGATGTTGTCCTAGAGG + Exonic
957881307 3:86216627-86216649 AGCCTGCGATATTGTTCTTGAGG + Intergenic
972337535 4:38120897-38120919 AGCCTCTGATGTTTTTCTATAGG + Intronic
983483582 4:168306276-168306298 AGCCTCTGATAATTTCCTAGAGG + Intronic
990074515 5:51826920-51826942 AGGCTCTTCTGTTGTCCTAGAGG + Intergenic
1002296604 5:178234810-178234832 AGCATCCCATGTATTCCTAGTGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006312316 6:33269489-33269511 AGCCTGTGATGCTGTCCTGGAGG - Exonic
1019837562 7:3404730-3404752 AGCCTCCCATATTGTACTACTGG - Intronic
1022861268 7:34369495-34369517 GACCTCCCACGTTGTCCTAGCGG + Intergenic
1024882196 7:54100134-54100156 AACCTGCTATGTTTTCCTAGTGG + Intergenic
1055990012 9:82095243-82095265 AGCCTCCCAGGTGTTCCTAGAGG - Intergenic
1193082877 X:77423033-77423055 ACCCCCCAATGTGGTCCTAGAGG + Intergenic