ID: 954735001

View in Genome Browser
Species Human (GRCh38)
Location 3:52699949-52699971
Sequence AGCTGTGCAGCTGCATCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954735001_954735004 19 Left 954735001 3:52699949-52699971 CCCACTGATGCAGCTGCACAGCT 0: 1
1: 0
2: 1
3: 14
4: 172
Right 954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954735001 Original CRISPR AGCTGTGCAGCTGCATCAGT GGG (reversed) Intronic
901454468 1:9355178-9355200 AGCTGTCCAGCTGCACCAGAAGG + Intronic
903445347 1:23419103-23419125 AGCTGTGCAGCTTCTTCAGAAGG + Exonic
903667122 1:25014806-25014828 AGCTGTTCAGTTGAATCACTGGG + Intergenic
903809811 1:26029045-26029067 GGCTGTGCATATGCATGAGTGGG + Intronic
904604716 1:31692117-31692139 AGCTGGGCAGCTCCATCTGGTGG + Intronic
906448135 1:45921554-45921576 AGCTGCCCTGCTGCAGCAGTTGG - Intronic
907094135 1:51760285-51760307 AGTGGTGCAGGTACATCAGTTGG + Intronic
908133791 1:61105842-61105864 ATCTGTGCACCTACAACAGTGGG + Intronic
908513572 1:64870023-64870045 TGCTGTGCACCTCCATCAGTGGG - Intronic
909609319 1:77536149-77536171 CTCTGTGCAGCTGCAGCACTGGG + Intronic
910283103 1:85523253-85523275 ATCTGCTCTGCTGCATCAGTAGG - Intronic
910665046 1:89715838-89715860 TGATATGCAGCTGCATCAGATGG + Exonic
914206912 1:145539736-145539758 ATCTGCTCTGCTGCATCAGTAGG + Intergenic
915273453 1:154772144-154772166 TGCTGTGCAGCAGCATGACTCGG + Exonic
917967935 1:180190263-180190285 AGGTCTGCTGCTGCTTCAGTGGG + Intronic
920560101 1:206932687-206932709 AGCTAGGGAGCTGCATCAGCAGG - Intronic
922056048 1:222043546-222043568 AGCTGTGCAGCTGCAGCTCTGGG - Intergenic
923030896 1:230248404-230248426 AGCTGTCCTGGTGCATCAGGAGG - Intronic
923730635 1:236546550-236546572 AGCTGTTCGGCAGCATCAGATGG + Intronic
924922782 1:248648304-248648326 AGAAGTGCTGCTGTATCAGTTGG + Intergenic
1062811393 10:469061-469083 ATCTGTGCAGGTGCATAACTAGG + Intronic
1062811402 10:469124-469146 ATCTGTGCAGGTGCATAAGCTGG + Intronic
1065345358 10:24742972-24742994 AGCTATGCAGCTGCATGAGCCGG + Intergenic
1066493232 10:35915392-35915414 ACCTGTGCAGAGGCATCTGTGGG + Intergenic
1068321660 10:55426482-55426504 AGCCCTGCAGCAGCATCTGTGGG + Intronic
1070288644 10:75100695-75100717 AGCAGAGCAGCTGCCTCTGTAGG + Intronic
1070805987 10:79270980-79271002 AGCTGTGCCTCTGCTTCAGCTGG - Intronic
1070890601 10:79940177-79940199 GGATGTGCAGCAGCATCACTGGG + Intronic
1070897258 10:79995474-79995496 AGCTGTGCTGCTGCAGCTGCTGG - Intergenic
1071470268 10:85979257-85979279 ATCTGTGCATCTCCACCAGTGGG + Intronic
1071814193 10:89215276-89215298 AGCTGTGGAGCTGCTGCCGTAGG + Intronic
1072024170 10:91437443-91437465 AGAAGTGAAGCTGCATGAGTAGG - Intronic
1072859678 10:98990105-98990127 AGTTGTACAGCTGCATCTGGTGG - Intronic
1073323051 10:102627366-102627388 ATCTGTGTGGCTGCATCTGTGGG + Intronic
1073514916 10:104067652-104067674 GGCTGTGCAGCTGCAGGTGTGGG + Intronic
1074943944 10:118262783-118262805 ACAAGTTCAGCTGCATCAGTGGG + Intergenic
1077453114 11:2662693-2662715 AGCCGTGCAGCGGGGTCAGTGGG + Intronic
1078964550 11:16322745-16322767 ACCTGTGCATCGGAATCAGTTGG - Intronic
1080415309 11:32064706-32064728 AGATGTGCAGCAGCAACTGTAGG + Intronic
1080582681 11:33656921-33656943 TGCTGTGCAGCCCCAGCAGTTGG + Intronic
1080613441 11:33925314-33925336 AGGTGTGCTGATGCATCAGCAGG + Intergenic
1081349766 11:42036416-42036438 TTCTTTGCAGCTGCAACAGTTGG - Intergenic
1082029163 11:47592440-47592462 AGGTGTGCAGATGCTTCTGTCGG + Intronic
1083694576 11:64434140-64434162 AGCTGTGCACCTGGATTTGTTGG + Intergenic
1085384692 11:76150295-76150317 AGCTGTCCATCTGCATGGGTGGG + Intergenic
1089359276 11:117875613-117875635 AGCTTTGAAGATGGATCAGTGGG - Intronic
1089438098 11:118488786-118488808 AGCTGGGCCTCTGTATCAGTGGG + Intronic
1090750209 11:129739995-129740017 AAGTGTGCAGCTGGATGAGTAGG + Intergenic
1091082300 11:132682083-132682105 AGCTATGCAGCAGCATCTGGGGG - Intronic
1092770903 12:11895603-11895625 AGCTGAGCAGCTGCCACAGGTGG + Intergenic
1098044046 12:66381720-66381742 AGATGTGCACCACCATCAGTAGG + Intronic
1098957646 12:76704160-76704182 AGTTGTTCAGCTGCATAACTGGG - Intergenic
1100552478 12:95658474-95658496 GGCAGTGCTGCTGCTTCAGTAGG + Exonic
1101395210 12:104341201-104341223 GGCTGTGCATCTCCATCTGTTGG + Intronic
1104734975 12:131131092-131131114 ACCTGGGCAGCTCCCTCAGTAGG - Intronic
1108601250 13:51997031-51997053 GGCTGTGCAGCTGCCTCTATGGG + Intronic
1111611677 13:90614826-90614848 AGCAGTGCAGATCCAACAGTTGG + Intergenic
1115199778 14:30840579-30840601 ACCTGTGCAGCTGCAGGCGTTGG + Intergenic
1116954863 14:50913076-50913098 AGCTGTGGAGCTTCGTCAGCTGG + Exonic
1118680157 14:68232775-68232797 AGCTGTGGGACTGCAGCAGTTGG - Intronic
1119257284 14:73209153-73209175 AGCTGGGAAGCTGCAGCTGTGGG + Intronic
1120802486 14:88707153-88707175 AGATGTTAAGCTGCATCATTTGG + Intronic
1122535909 14:102462673-102462695 AGGTGTGCAGCTCCATTAGCTGG - Intronic
1122984213 14:105204871-105204893 AGCTCTGTGGCTGCATGAGTGGG + Intergenic
1125375059 15:39020058-39020080 AGCTGTGCCTCTGCTACAGTTGG - Intergenic
1126312062 15:47328655-47328677 AGTTGGCCAGCTGCATCAGGTGG - Intronic
1127103486 15:55589422-55589444 CACTGTGCAGCTGAATGAGTTGG - Intergenic
1128227589 15:66012944-66012966 AACTCTGCTGCTGTATCAGTGGG + Intronic
1130893107 15:88150071-88150093 AGCTGAGCAGCTGCATCCAATGG + Intronic
1132362076 15:101224800-101224822 AGAGGTGCAGCTGCATCTGGTGG - Intronic
1133036111 16:3035325-3035347 AGCCTTGCAGCTGCAGCAGAAGG - Exonic
1133284556 16:4684502-4684524 GGATGTGCTGCTGCATCAGGTGG - Intronic
1133515225 16:6502211-6502233 AGCTATGCAGATCCATCTGTAGG + Intronic
1133534306 16:6686100-6686122 AACCGTGCAGCAGCAGCAGTGGG + Intronic
1133619360 16:7511847-7511869 AGTTGTGCAGCAGCAATAGTGGG + Intronic
1136673395 16:31877630-31877652 AGCTGTTCAGCTGAGTCAGAAGG + Intronic
1138425645 16:56930567-56930589 AGTTGTACAGCTGCATCTGGTGG - Intergenic
1140672223 16:77290634-77290656 AGCTGTGCAGCAACATCTGCTGG + Intronic
1141710293 16:85695081-85695103 ACCTGTGCAGGTGCATCGGGGGG - Intronic
1142789524 17:2253066-2253088 AGCTGAGTAGCTGCAGCAGAGGG + Intronic
1143264128 17:5622957-5622979 AGGTGTGTAGATGCATCAGTAGG - Intergenic
1143600619 17:7943432-7943454 GGCTGTGCAGCTGGAGCAGCGGG + Exonic
1144414526 17:15033740-15033762 AGCTCAGCAGCTGCAGCAATAGG + Intergenic
1144754462 17:17670743-17670765 CTCTGTGCAGCTGCCTCAGAGGG - Intergenic
1145308448 17:21688374-21688396 AGCTGTGCAGCTCCAGCGGTCGG + Intergenic
1147963949 17:44183312-44183334 AGTTGGGCAGCTGCAGCAGGAGG - Intergenic
1148537807 17:48455403-48455425 AGCCCTGCAGCAGCATCTGTGGG - Intergenic
1148847202 17:50536433-50536455 AGCAGAGCAGCTGCATCCTTGGG - Exonic
1150142770 17:62744070-62744092 AGCTGTACAGCTGCTCCAGAGGG - Intronic
1151917606 17:77129953-77129975 TGCCAAGCAGCTGCATCAGTCGG + Intronic
1153663912 18:7351363-7351385 AGCTCAGCAGCTGCCCCAGTTGG + Intergenic
1153992864 18:10415363-10415385 AGCTGTGCAGCCGCATCGCCCGG + Intergenic
1156147852 18:34207906-34207928 AGCAGTGCAGCTCCATGAGCAGG + Intronic
1158333915 18:56394099-56394121 AGAGGTGCAGGTGCCTCAGTAGG - Intergenic
1158997705 18:62940090-62940112 AACTGTGCAGCTGCAGCAGGTGG - Intronic
1164840668 19:31390108-31390130 AGCTGTGCAGCCCCATGCGTGGG + Intergenic
1167219532 19:48189152-48189174 AGCTGTGCAACTACATCTGCAGG - Intronic
925294228 2:2767156-2767178 AGCTGTGAAGCTGAAACACTGGG - Intergenic
926375506 2:12223698-12223720 CTCTGTGCAGCTGCAGGAGTTGG + Intergenic
928352745 2:30575564-30575586 TGCTGTGCATCTGCCTCAGGTGG - Intronic
930060394 2:47283724-47283746 GGCTGTTCAGCTGCCTCTGTTGG + Intergenic
930627661 2:53716578-53716600 ATTTGTGCAGCTGCATGAATAGG + Exonic
933503019 2:83140400-83140422 AGTTGGGCAGTTGCATTAGTTGG - Intergenic
935042298 2:99444318-99444340 AGATGTGCAGCTGGCACAGTGGG - Intronic
939569458 2:143823460-143823482 AGCTGGACAGCTGCACTAGTAGG + Intergenic
939668200 2:144976802-144976824 AGCAGAGCAGCAGCAGCAGTGGG - Intergenic
941668977 2:168270604-168270626 AGCTGTGCAGCTACATGTGGGGG - Intergenic
942398533 2:175577083-175577105 AACTCTGCTGCTGAATCAGTGGG - Intergenic
944854148 2:203750177-203750199 AGTTGTCCAGCTGCATCATAAGG - Intergenic
1169758276 20:9066370-9066392 ATGTCTGCAGCTGCATGAGTAGG + Intergenic
1172444399 20:34985510-34985532 AGCTGTGCAGCTGGGGCAGGAGG - Intronic
1172593157 20:36131739-36131761 AGCTCTGCCCCTGCATCACTAGG - Intronic
1174042015 20:47706729-47706751 AGGTGTGGACCTGCATCAGTGGG + Intronic
1178309082 21:31514794-31514816 GGCAGCGCAGCTGCATCAGCAGG - Intronic
1179188081 21:39100216-39100238 AGTTGTACAGCTGCATCAAGTGG + Intergenic
1179312196 21:40206402-40206424 ACCTGTGGAGCTGACTCAGTGGG + Intronic
1179769269 21:43602361-43602383 AGCTGTGTGGCTGCATCTGCAGG - Intronic
1180979974 22:19873825-19873847 GGCTGTGCAGCTGCCTGGGTGGG + Intergenic
1181568179 22:23752149-23752171 AGCTGGGCAGCTGCACCTGAGGG - Intergenic
1184792433 22:46708329-46708351 ACCTGTGCTGCTGCATTTGTGGG + Intronic
1185085821 22:48740506-48740528 AGCTGTGCCCCGGCCTCAGTTGG + Intronic
950521760 3:13501696-13501718 AGCTGTGCAGCTCCAGCTGTGGG - Intronic
951034372 3:17916861-17916883 AGCTGTGCAGCAGCAAAGGTGGG - Intronic
951193162 3:19794029-19794051 AGCTGTGCATCAGCACCAATAGG - Intergenic
952979295 3:38722174-38722196 GGCCCTGGAGCTGCATCAGTGGG - Intronic
954735001 3:52699949-52699971 AGCTGTGCAGCTGCATCAGTGGG - Intronic
959162822 3:102740760-102740782 AGTTGTGCAGATCCAACAGTTGG - Intergenic
961580852 3:127880899-127880921 AGTTGTACAGCTGCATCTGGTGG - Intergenic
963277020 3:143342047-143342069 AGCTCTGCTGCCGCCTCAGTAGG + Intronic
963981506 3:151543405-151543427 AGCTGTGCAGCTGCAGGTGTGGG - Intergenic
967293326 3:187942843-187942865 AGCTGTGCAGCTGCATGAGGAGG - Intergenic
968067168 3:195765076-195765098 AGCTGTGCAGCTTCACCTCTTGG - Exonic
968598516 4:1497804-1497826 AGCTGAGCAGCTGCAGGAGCTGG + Intergenic
968646907 4:1745767-1745789 AGCTGAGCAGCTGCACCTGCAGG - Intergenic
968696077 4:2028405-2028427 AGCTTTTGAGCTGAATCAGTGGG + Intronic
969256841 4:6008107-6008129 AGCTGCGCTGCTGCATCTATGGG - Intergenic
969511724 4:7621885-7621907 AGCTGGGCAGCAGCACCAGCAGG - Intronic
974074633 4:57157370-57157392 TGCTGTGCAGCTGCAGGAGGTGG - Intergenic
975387181 4:73770941-73770963 GGCTTTGCAGCAGCATCAATGGG - Intergenic
975417257 4:74119212-74119234 AACTGTACAGCTGCATCTGGTGG + Intronic
975689762 4:76951024-76951046 AGCTGTGCAGCTGCAGGTGGTGG + Intronic
976711727 4:88079201-88079223 AGCTATGCAGCTGAAGCAGAAGG + Intergenic
978419544 4:108515768-108515790 AGCTGTGCATCAGCATCACTTGG - Intergenic
981302274 4:143201212-143201234 AGGTGTGCAGCTTCGTCTGTGGG - Intronic
981898620 4:149835336-149835358 ACCTGTGCTTCTGCCTCAGTCGG + Intergenic
985930952 5:3057608-3057630 AGCTGGGCACCTCCATCAGCTGG + Intergenic
987697839 5:21355144-21355166 AGCTGAGCAGCTGGAACACTGGG + Intergenic
990246585 5:53869329-53869351 AGCTGTGCAGAGACCTCAGTAGG + Intergenic
990626311 5:57615571-57615593 ATCTCTGCAGTTGAATCAGTTGG - Intergenic
991742606 5:69697243-69697265 AGCTGAGCAGCTGGAACACTGGG - Intergenic
991755088 5:69857961-69857983 AGCTGAGCAGCTGGAACACTGGG + Intergenic
991794179 5:70276981-70277003 AGCTGAGCAGCTGGAACACTGGG - Intergenic
991821996 5:70572556-70572578 AGCTGAGCAGCTGGAACACTGGG - Intergenic
991834415 5:70733109-70733131 AGCTGAGCAGCTGGAACACTGGG + Intergenic
991886557 5:71276523-71276545 AGCTGAGCAGCTGGAACACTGGG - Intergenic
994763395 5:103885006-103885028 AGTTGCACATCTGCATCAGTAGG + Intergenic
995835380 5:116395327-116395349 AGCTGTGCTGCTGCTCCACTTGG - Intronic
1002059260 5:176616798-176616820 AGCTGTGGAGCTGCATTGCTGGG + Intergenic
1004643606 6:17539039-17539061 AGCTGTGTGGCCCCATCAGTAGG - Intronic
1005553012 6:26943260-26943282 AGCTGAGCAGCTGGAACACTGGG - Intergenic
1009897412 6:69770227-69770249 AGCTGTACTGCTGTATCAGAAGG - Intronic
1010752863 6:79634207-79634229 AGCTCTCCAGCTTCAGCAGTTGG + Intronic
1011755738 6:90496778-90496800 AGCTGTGCAGCTGCGGCTGCTGG + Intergenic
1019171056 6:170133414-170133436 AGATGGGCAGGTGCCTCAGTGGG + Intergenic
1019171084 6:170133529-170133551 AGATGGGCAGGTGCCTCAGTGGG + Intergenic
1019171098 6:170133586-170133608 AGATGGGCAGGTGCCTCAGTGGG + Intergenic
1019894857 7:3975878-3975900 AGCTTTGCAGCTGCAGCACCAGG - Intronic
1023075101 7:36474111-36474133 GGCAGTGCAGATGCAACAGTTGG + Intergenic
1024547691 7:50536155-50536177 AGATGTGCAGCTATCTCAGTGGG - Intronic
1025100243 7:56128694-56128716 ATTTGTGCAGCTGGATGAGTTGG + Intergenic
1028582101 7:92419289-92419311 ATCTGTGTCGCTGCATCAGTAGG - Intergenic
1030298517 7:107952722-107952744 GGCTGTGCAGCTGCAGCAAGAGG + Intronic
1033312688 7:140273386-140273408 AGCTGGGCAGCAGCAAGAGTTGG - Intergenic
1039593277 8:38768494-38768516 TGCTGTGCAGCTTCACCAGCCGG - Intronic
1039782067 8:40795576-40795598 GGCTGTACTGATGCATCAGTTGG + Intronic
1045694202 8:104789311-104789333 ACCTGTCCAGCTGGAGCAGTAGG + Intronic
1047957016 8:129984029-129984051 AGCTGTGCAGCACCATCACCTGG - Intronic
1048443187 8:134475171-134475193 ATCTGTGAAGATGCATCTGTGGG + Intergenic
1049496668 8:142938877-142938899 TGCTTTGCAGCTGCAGGAGTCGG + Intergenic
1052490531 9:29161138-29161160 AGCTGTGCAGCTGCAGGTGTGGG + Intergenic
1052796983 9:32931681-32931703 ACGTGTGCAGCTGCCTGAGTGGG - Intergenic
1056726654 9:89125111-89125133 AGCTGTGGGTCTGCAGCAGTGGG + Intronic
1061645950 9:132002015-132002037 AGCTGTGGCCCTGCATCAGCTGG + Intronic
1185765591 X:2723510-2723532 ACCTCTGCAGCTACATCACTTGG - Intronic
1188859747 X:35243284-35243306 CTCTGTGCAGCTGCTGCAGTAGG + Intergenic
1196061366 X:111411264-111411286 AGAGGTGTTGCTGCATCAGTGGG - Intronic
1199503976 X:148540844-148540866 AGCTGTGAAGCAGCCACAGTTGG + Intronic
1199517861 X:148698755-148698777 AAATGTGCAGCTGAAGCAGTGGG + Intronic