ID: 954735002

View in Genome Browser
Species Human (GRCh38)
Location 3:52699950-52699972
Sequence CAGCTGTGCAGCTGCATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954735002_954735004 18 Left 954735002 3:52699950-52699972 CCACTGATGCAGCTGCACAGCTG 0: 1
1: 0
2: 2
3: 31
4: 248
Right 954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954735002 Original CRISPR CAGCTGTGCAGCTGCATCAG TGG (reversed) Intronic
900318731 1:2072145-2072167 CGGCTGACCAGCTGCATGAGGGG - Intronic
900570339 1:3355192-3355214 AGGCTCTGCAGCTGCATCTGGGG + Intronic
901813139 1:11778978-11779000 CAGCTGGGCAGCGGCAGCAGGGG + Exonic
902238630 1:15073901-15073923 CAGATGTGGAGCTGCTACAGAGG + Intronic
903667121 1:25014805-25014827 CAGCTGTTCAGTTGAATCACTGG + Intergenic
903809810 1:26029044-26029066 CGGCTGTGCATATGCATGAGTGG + Intronic
904917635 1:33981885-33981907 CCCCTGTGCAGATGCTTCAGAGG + Intronic
905693802 1:39960657-39960679 CAGCTGAGCAGCTGCTGCTGAGG - Intronic
905794718 1:40809220-40809242 CAGCGGTGCAGCAGGAACAGAGG - Intronic
906152080 1:43593303-43593325 CACCTGTGTATGTGCATCAGTGG + Intronic
906157798 1:43624143-43624165 GAGCTGTGCAGCTGCTCCACTGG + Intergenic
906736094 1:48130010-48130032 CAGCTGTTCATCTGGATCATTGG - Intergenic
907046527 1:51303238-51303260 CAGCTGTCCAGCTGCCTCCCAGG - Intronic
908050333 1:60222656-60222678 CATCTGTGCATGTGCTTCAGGGG + Intergenic
908513573 1:64870024-64870046 ATGCTGTGCACCTCCATCAGTGG - Intronic
908617556 1:65939203-65939225 CATGTGTTCAGCTGCATCTGTGG - Intronic
910108959 1:83661536-83661558 CTGCTTGGCAGCTGCATCGGTGG - Intergenic
915030934 1:152879893-152879915 CAGAGGTGCAGAGGCATCAGAGG - Intronic
915578142 1:156795005-156795027 CAGCTCTGCAGCTGGATGGGGGG + Intronic
916648157 1:166809344-166809366 CAACTGTACAGCAGCAGCAGAGG - Intergenic
920033005 1:203048572-203048594 CGGCTGTGCAGGTGCGCCAGCGG + Intronic
921965329 1:221082035-221082057 CATTTGTTCAGCTGCCTCAGGGG - Intergenic
922056049 1:222043547-222043569 CAGCTGTGCAGCTGCAGCTCTGG - Intergenic
922459595 1:225804736-225804758 CAGCTGTGCAGCAAAATTAGAGG - Intergenic
923161082 1:231315695-231315717 CATGTGTGCAGCTGGGTCAGAGG + Intergenic
1064248743 10:13690676-13690698 CAGCTGTGCAGCTGCAGAAAGGG + Intronic
1064613337 10:17126586-17126608 CAGCTCTGCATCTGCATCCTGGG + Intronic
1065919979 10:30384804-30384826 CAGCTGTGCAGCTATGTCGGCGG - Intergenic
1067348271 10:45453971-45453993 CAGATGTGCTGCTGTCTCAGAGG - Intergenic
1068321659 10:55426481-55426503 CAGCCCTGCAGCAGCATCTGTGG + Intronic
1069678611 10:70267515-70267537 CAGCTGTGCTGCAGCATCATTGG - Intronic
1069685646 10:70316735-70316757 CAGCTGTGCAGCCGCACCGAGGG - Intronic
1070817144 10:79331724-79331746 CAGCTCTGCAGCTGGTACAGTGG + Intergenic
1071359244 10:84829180-84829202 GAGCTGTGAAGTTCCATCAGCGG + Intergenic
1072741946 10:97914945-97914967 CAGCGGAGCAGCTGCAGCTGCGG + Intronic
1072796286 10:98357270-98357292 CAGCTGGGAAGCTGCTGCAGTGG + Intergenic
1073075271 10:100821375-100821397 CAGCTGTGCACCTGCTGCTGCGG - Intronic
1073514915 10:104067651-104067673 CGGCTGTGCAGCTGCAGGTGTGG + Intronic
1075397342 10:122137150-122137172 GAGCTGTGAAGCTGCTTCGGGGG + Intronic
1077043871 11:535893-535915 CAGCGGTGCCGGTGCACCAGAGG + Intronic
1077453113 11:2662692-2662714 CAGCCGTGCAGCGGGGTCAGTGG + Intronic
1077912601 11:6586620-6586642 CAGCTGTGCAACAGCACCAGGGG - Intronic
1078915707 11:15776649-15776671 CAGCTATGCTGCAGCTTCAGTGG + Intergenic
1079150529 11:17895085-17895107 CTGCTGTGCAGCTGCAGCAAAGG - Intronic
1079361699 11:19775854-19775876 CAGCTGTGTTGCAGCAACAGTGG - Intronic
1084178482 11:67435312-67435334 CAGCTGTGCCCCTGAATCATGGG + Exonic
1084608578 11:70186630-70186652 CAGCTGTGCACCGGCAGCTGAGG + Intronic
1085055095 11:73398719-73398741 CAGCTGCTCAGCTGCATCTCAGG + Intergenic
1085134553 11:74074346-74074368 CAGCTGTGGTGCTGCTGCAGGGG + Exonic
1086164710 11:83764199-83764221 CAGCTCTGCACCTGTCTCAGGGG - Intronic
1087038368 11:93775315-93775337 AAGCTGTTCTGCTGCATCAGTGG + Intronic
1088878722 11:113957270-113957292 CAGCTGGGCAGCTGAATTATAGG + Intergenic
1089148152 11:116345401-116345423 CAACTGTGCAGCTGAGTCTGGGG + Intergenic
1089359277 11:117875614-117875636 CAGCTTTGAAGATGGATCAGTGG - Intronic
1089438097 11:118488785-118488807 CAGCTGGGCCTCTGTATCAGTGG + Intronic
1089747766 11:120629039-120629061 TGGCTGTGCCGCTCCATCAGCGG - Intronic
1091082301 11:132682084-132682106 CAGCTATGCAGCAGCATCTGGGG - Intronic
1092057913 12:5522712-5522734 GAGCTGTGCAGCTGGGTGAGGGG + Intergenic
1094667473 12:32535434-32535456 CAGCTGTGCAGCTGCAGGAGTGG - Intronic
1096443017 12:51662034-51662056 CTGCAGTGCTGTTGCATCAGAGG + Intronic
1097075028 12:56386583-56386605 GAGCTGTGCAGCAGCAGTAGAGG - Intergenic
1099963302 12:89417892-89417914 TAGCTGAGAAGCTGCTTCAGGGG + Intergenic
1103702977 12:122857225-122857247 CAGTGGTGCTGCTGCATCTGGGG - Intronic
1104566277 12:129887241-129887263 CAGCTGAGCAGCTGCCTCCACGG - Intronic
1105728598 13:23188905-23188927 CAGCTGTGCAGCTGGCTTTGAGG + Intronic
1106972413 13:35158012-35158034 GAGTTGAGTAGCTGCATCAGAGG - Intronic
1109207383 13:59497484-59497506 CAGCTAGGCAGCTGCTTCTGGGG - Intergenic
1111164400 13:84439364-84439386 AAAGTGTGCAGCTGTATCAGTGG - Intergenic
1112559456 13:100499668-100499690 CAGATGTGCTTCTGCAACAGAGG - Intronic
1114551580 14:23535422-23535444 CAGCTGGGCAGCTGGATCTCTGG + Intronic
1114999237 14:28401432-28401454 CAACTGTGCAGCTGCTCCTGGGG + Intergenic
1117668943 14:58086177-58086199 CAGCTTAGCCGCTGAATCAGAGG - Intronic
1119225493 14:72941926-72941948 CAACTGTGCAGGTGCTTCACGGG - Intronic
1119257283 14:73209152-73209174 CAGCTGGGAAGCTGCAGCTGTGG + Intronic
1119421220 14:74509074-74509096 CAGCTGTGCTGCCTCATGAGGGG - Intronic
1121466904 14:94121637-94121659 CAGCTGTGAAGCTTCAACACCGG + Intergenic
1121589875 14:95096041-95096063 GAGCTGTGCTGCTGCTTCTGTGG - Exonic
1122501676 14:102204315-102204337 CAGCTGTCCAGCACCAGCAGAGG + Intronic
1123818456 15:24002617-24002639 CAGCTGTGCATCTGCAACTGGGG + Intergenic
1123990197 15:25677765-25677787 CACCTGAGCTGCTGCATGAGTGG - Exonic
1124658211 15:31525423-31525445 CAGAGCTGCAGCTGCAGCAGTGG - Intronic
1126691674 15:51293594-51293616 CAGCTTTGGATCGGCATCAGAGG - Intronic
1126713206 15:51484033-51484055 CAGCCCTGCACCTGCATCACAGG + Intronic
1128621805 15:69157680-69157702 CAGCTGTGCTCCTACATCTGAGG + Intergenic
1128687103 15:69695061-69695083 GAGACGTGCAGCTGCACCAGAGG + Intergenic
1128777029 15:70328336-70328358 CAGCAGTGCAGATGCTTCTGAGG + Intergenic
1128928306 15:71679364-71679386 CAGCTGAGTAGCTGTAACAGAGG - Intronic
1129028994 15:72605112-72605134 TAGCTGTGCAACTGAGTCAGAGG - Intergenic
1129071149 15:72952670-72952692 CAGATGTGCAGCTTCTCCAGGGG - Intergenic
1129833255 15:78684187-78684209 GAGCTGTGCAGAGGCAGCAGGGG + Intronic
1132912153 16:2319642-2319664 AAGCTGAGCAGCAGCAGCAGGGG + Exonic
1133045870 16:3088039-3088061 ATGCTGTCCAGCTGCATCTGGGG + Intergenic
1133534305 16:6686099-6686121 CAACCGTGCAGCAGCAGCAGTGG + Intronic
1133619359 16:7511846-7511868 CAGTTGTGCAGCAGCAATAGTGG + Intronic
1138086499 16:54138654-54138676 CAGCTGAGCAGCTGCTTCCAAGG + Intergenic
1138428196 16:56950500-56950522 CAACTCTGCAGCTGGGTCAGTGG - Intergenic
1140302445 16:73771549-73771571 CATGTGTGCAGCAGCCTCAGAGG - Intergenic
1140470132 16:75209220-75209242 GAACCGTGCAGCTGCAGCAGTGG + Intergenic
1140672142 16:77289772-77289794 AATCTGTGCAGCTGCAGTAGTGG + Intronic
1140990673 16:80208302-80208324 CAGCTGTGCAGCCTCATTTGAGG + Intergenic
1141598441 16:85111440-85111462 CCCCTGTGCTGCTGAATCAGGGG - Intronic
1141710294 16:85695082-85695104 GACCTGTGCAGGTGCATCGGGGG - Intronic
1142431900 16:90033374-90033396 CATCTGTGCACCTGGTTCAGTGG + Intronic
1142519129 17:492847-492869 CAGCTGTGTCCCTGCATCAGAGG - Intergenic
1142789523 17:2253065-2253087 GAGCTGAGTAGCTGCAGCAGAGG + Intronic
1143600618 17:7943431-7943453 TGGCTGTGCAGCTGGAGCAGCGG + Exonic
1143996822 17:11013659-11013681 CAGCTGTGGAGATGCAGCTGGGG - Intergenic
1144754463 17:17670744-17670766 CCTCTGTGCAGCTGCCTCAGAGG - Intergenic
1145234301 17:21197902-21197924 CAGATGTGCAGCAGCAGCTGCGG + Exonic
1146262065 17:31428251-31428273 CAGCGTGGCAGCTGCAGCAGGGG - Intronic
1148537808 17:48455404-48455426 CAGCCCTGCAGCAGCATCTGTGG - Intergenic
1148856282 17:50580807-50580829 CAGCTGTCCAGCGGGCTCAGGGG + Intronic
1149309792 17:55382817-55382839 CAGCTATGCACCTTCATCAGAGG - Intergenic
1149980279 17:61305246-61305268 CAACTAAGCAGCTGAATCAGAGG - Intronic
1150142771 17:62744071-62744093 CAGCTGTACAGCTGCTCCAGAGG - Intronic
1150978636 17:70117981-70118003 AAGTTGAGTAGCTGCATCAGAGG - Intronic
1152651372 17:81495020-81495042 CAGCTGTGCAGCAGGATCTCAGG - Intergenic
1152895463 17:82908294-82908316 CAGCCGTGCATCTGCAGCTGGGG + Intronic
1153756773 18:8291948-8291970 CAGATGTGCAGCTGCAGAGGTGG - Intronic
1155625034 18:27825020-27825042 CAGCCGTTAAGATGCATCAGAGG + Intergenic
1157659888 18:49431819-49431841 CAGCTGTCCATGTGCATCATCGG - Intronic
1159138946 18:64369476-64369498 CAACTGTGCAGCTGCTCCTGGGG + Intergenic
1160766620 19:811394-811416 CAGCTCCGCAGCTGGAGCAGCGG - Exonic
1163320183 19:16570214-16570236 GAGGTGTGTAGCTGCATCACCGG - Intronic
1164448395 19:28337298-28337320 CAGCTGTGTGGCTGCATCTGTGG + Intergenic
1164635173 19:29786353-29786375 CAGCTGTGCACATCCAGCAGAGG + Intergenic
1164672560 19:30081052-30081074 CAGCCATGCAGCTGCAGCAGGGG - Intergenic
1165169337 19:33880091-33880113 CAGCTGTTCAGCTCCAACAGGGG + Intergenic
1167266383 19:48485034-48485056 CAGCAGTGCTGCTGCTGCAGCGG + Intergenic
925445395 2:3922837-3922859 AAGCTGTGGAAATGCATCAGTGG + Intergenic
925887065 2:8402169-8402191 CAGCTGTGCTGCAGCTTCAGAGG - Intergenic
927053994 2:19353641-19353663 ACGCTGTGCACCTGCATCAGTGG - Exonic
927967656 2:27281609-27281631 CAACTGTGGAGCTGGGTCAGAGG + Intergenic
931639912 2:64372806-64372828 CAGGTGTGTAGCTGCCTCTGGGG + Intergenic
935089409 2:99880369-99880391 CAGCTCTGCCGCTGAATCAGAGG - Intronic
935515969 2:104039394-104039416 CAGCTCTGCAGCTGCATTGAGGG - Intergenic
937300134 2:120834013-120834035 GAGCTGTGCAGCAGCATCACAGG - Intronic
937895777 2:126976099-126976121 CAGCAGGGCAGCAGCTTCAGTGG + Intergenic
938065965 2:128282305-128282327 CGGCTGTCCAGCAGCACCAGAGG + Intronic
941116706 2:161480302-161480324 CAGCTGTGTACCTGCATCTTGGG + Intronic
941668978 2:168270605-168270627 CAGCTGTGCAGCTACATGTGGGG - Intergenic
943719869 2:191192674-191192696 CAGCTATGCATTTGAATCAGAGG - Intergenic
944944702 2:204670249-204670271 GAGTTGAGCAGCTGCAACAGAGG - Intronic
945196945 2:207245598-207245620 CTGCGATGCAGCTGCAGCAGAGG - Intergenic
947527270 2:230886326-230886348 CAGCTGTACAGATGCACCAGGGG - Intergenic
1172502092 20:35434603-35434625 AAGCTGTCCAGCTGCCCCAGCGG - Exonic
1172608477 20:36231687-36231709 CAGCGGGGCAGCAGAATCAGTGG + Exonic
1173591520 20:44228714-44228736 CAGCTCCGCAGCAGCACCAGGGG - Intergenic
1174042014 20:47706728-47706750 GAGGTGTGGACCTGCATCAGTGG + Intronic
1175052901 20:56171354-56171376 CAGCTGCACAGTGGCATCAGTGG + Intergenic
1175150545 20:56930555-56930577 CATCTGTGCATCTGGATCACAGG + Intergenic
1175216855 20:57395749-57395771 CAGCTCTCCAGCTCCGTCAGCGG - Intronic
1175476770 20:59281238-59281260 AAGCTGTGCAGATTCAACAGAGG - Intergenic
1175642759 20:60644721-60644743 CAGGTGTCTAGCTGCAGCAGGGG - Intergenic
1176299915 21:5094744-5094766 AGGCAGTGAAGCTGCATCAGGGG - Intergenic
1177371712 21:20213100-20213122 CAGCTGTGAAGCTGAGTCTGGGG + Intergenic
1178438828 21:32582257-32582279 GAGCTCTGCAGCTGCAGCGGTGG - Exonic
1179634186 21:42696822-42696844 CAGCTGAGCACAGGCATCAGGGG + Intronic
1179857107 21:44167167-44167189 AGGCAGTGAAGCTGCATCAGGGG + Intergenic
1180920701 22:19520125-19520147 CACCTGTGCCCCTGCCTCAGTGG - Intronic
1181568180 22:23752150-23752172 AAGCTGGGCAGCTGCACCTGAGG - Intergenic
1183802356 22:40177361-40177383 CAGCTGAACAGCTGCAGAAGAGG - Intronic
1184792432 22:46708328-46708350 CACCTGTGCTGCTGCATTTGTGG + Intronic
1184924738 22:47629336-47629358 CAGCCGTGCAGCAGCCTCACAGG - Intergenic
1184932695 22:47692940-47692962 CAGATGTGCCGCTGCCTCGGGGG - Intergenic
950325380 3:12104240-12104262 CAGCTAGGCAGCTGAGTCAGGGG - Intronic
950412878 3:12850480-12850502 CAGCTGTGGCTCGGCATCAGAGG + Intronic
950521761 3:13501697-13501719 GAGCTGTGCAGCTCCAGCTGTGG - Intronic
950879582 3:16312288-16312310 CTCCTGGGAAGCTGCATCAGTGG + Intronic
951506221 3:23447946-23447968 CAGCCTTGCAGCTGCATGTGAGG + Intronic
953980889 3:47412503-47412525 CACCTGTGCAGCTGCACCTCAGG + Exonic
954715977 3:52527195-52527217 GAGCTGTGCTGCTTCTTCAGAGG + Intronic
954735002 3:52699950-52699972 CAGCTGTGCAGCTGCATCAGTGG - Intronic
954954804 3:54509732-54509754 CAGCTGTGGAGTTACTTCAGTGG - Intronic
956391628 3:68779576-68779598 CAGCTGGGCTGTTGCTTCAGAGG + Intronic
956678645 3:71757630-71757652 CAGCAGCTCAGCTGCACCAGAGG + Intergenic
957486608 3:80870547-80870569 CAGCTGTGCAGCTGCTGCTGTGG + Intergenic
957506362 3:81125858-81125880 CAGCAGTGCTGCTGCACCACAGG - Intergenic
957549713 3:81688080-81688102 CAGATCTGCAGATGCATGAGTGG + Intronic
960082389 3:113554916-113554938 CAGCTGTTCAGCAGCAACTGAGG + Intronic
960388489 3:117050083-117050105 CAGCTTTGGCTCTGCATCAGAGG - Intronic
961362398 3:126376141-126376163 CAGCAGTGGAGCTGCATCAAGGG + Intergenic
961522183 3:127473257-127473279 CAGCTCTGCAGCTGATGCAGTGG - Intergenic
961538604 3:127585553-127585575 CAGCAGTGCAGGTGGAACAGAGG + Intronic
962281901 3:134058448-134058470 CAGCTGTGCAGCTGCACAGCTGG + Intergenic
963166660 3:142211232-142211254 CAGCTGTTCAGCAGCATCCCTGG - Intronic
963981507 3:151543406-151543428 CAGCTGTGCAGCTGCAGGTGTGG - Intergenic
968180891 3:196594390-196594412 AAGCTGAGCAGCTGCACCTGTGG + Intergenic
968630199 4:1646558-1646580 CAGCTCAGCAGGTGCAGCAGAGG + Intronic
968728472 4:2259046-2259068 CACCTGTGCAGCGGCATCCTGGG - Intronic
969070790 4:4537057-4537079 CTGCTGTGCAGAGGCAGCAGGGG - Intronic
971255143 4:25007777-25007799 CAGCTGTCCATGTGCACCAGGGG - Intronic
971450076 4:26791858-26791880 CAGGTATGCAGTTGGATCAGGGG + Intergenic
972551594 4:40140264-40140286 CAGGTGGGCAGAGGCATCAGTGG - Intronic
973068488 4:45827137-45827159 CAGCAATGCAGTTGCATCTGAGG + Intergenic
976287968 4:83388344-83388366 CAACTGTGGAGCTACATCACTGG - Intergenic
976647247 4:87399485-87399507 CAGCTATCCAGCTGCAGCTGGGG + Intergenic
977953779 4:103003565-103003587 CAGCTGGGGAGGGGCATCAGTGG - Intronic
981889310 4:149716480-149716502 CAGCTGCCTAGCTGCAACAGCGG - Intergenic
984886973 4:184457743-184457765 CAGCTGTGCACCTGCAGCGTTGG - Intronic
985572640 5:657783-657805 GACCTGGGCAGCTGCATCACAGG + Intronic
985812710 5:2101871-2101893 CAGCTGTTCAGCGGCAGCTGCGG + Intergenic
987103155 5:14610495-14610517 TATCAGTGCAGCTGCTTCAGAGG - Exonic
987606593 5:20143843-20143865 CAGTTGTCCAGCTGCATCCTTGG - Intronic
992556892 5:77912758-77912780 CAGCTCTGCCCCTGCAACAGAGG - Intergenic
996686071 5:126282292-126282314 CAGCTGTACAGCTCCTTTAGTGG - Intergenic
996981149 5:129496638-129496660 CAGCTGTGCAGCTTTCTCAGTGG + Intronic
997602744 5:135151481-135151503 CAGCTGTGCAAATGCCTCATAGG + Intronic
998059357 5:139107181-139107203 CAGGTGTGCAGGTGCTTAAGAGG + Intronic
998189305 5:140009216-140009238 CAGCTCTGCAGCAGCAGCAGAGG - Intronic
998543887 5:143009247-143009269 CAGCTGGGCAGGTGAATCACCGG - Intronic
998951395 5:147396103-147396125 CAGCAGTACAGCTGGAGCAGAGG + Intronic
999282947 5:150376711-150376733 CAGGTGTGCAGAAGCCTCAGAGG + Intronic
1000492274 5:161928760-161928782 GAGCTGTGCAGGTGCATAGGTGG - Intergenic
1001004697 5:168039861-168039883 CTGCAGTGCACCTGCAGCAGCGG + Intronic
1001682919 5:173571783-173571805 CAGTTGGGCATCTGCATCTGGGG - Intergenic
1001844586 5:174910499-174910521 CAGCTGGGCAGCGGCACGAGCGG + Intergenic
1002081816 5:176741849-176741871 CAGCACAGCACCTGCATCAGAGG + Intergenic
1002765130 6:232802-232824 CAGCTGTGTAGCTGGAACTGAGG - Intergenic
1003715688 6:8643559-8643581 CAGCAGGGAAGCCGCATCAGTGG - Intergenic
1006647083 6:35522295-35522317 CAAATATGCAGCTGCAGCAGAGG - Intergenic
1007082223 6:39115626-39115648 AGGCTGTGCAGCTCCATCATTGG + Intergenic
1007096511 6:39216538-39216560 GAGCTCTGCAGCTGCAGTAGAGG - Intronic
1010051097 6:71505253-71505275 CACTGGAGCAGCTGCATCAGTGG + Intergenic
1012046863 6:94287028-94287050 CTGCTGAGCAGATGCATCTGTGG - Intergenic
1018399215 6:163405483-163405505 CTGCTCTGCAGCTGCCTCGGAGG + Intergenic
1019068360 6:169321624-169321646 CAGCTGTGCAGCAGAGGCAGGGG + Intergenic
1023640431 7:42251450-42251472 CTGCTGTGCAGCTGGAGTAGGGG + Intergenic
1023924452 7:44655737-44655759 CAGCTGTGGAGATGCAGCTGTGG + Intronic
1023993729 7:45146148-45146170 CAGCTGTGCCTCTGCACCCGGGG + Intergenic
1024547692 7:50536156-50536178 CAGATGTGCAGCTATCTCAGTGG - Intronic
1024881571 7:54091479-54091501 CAGCTCTGCGGTGGCATCAGAGG + Intergenic
1025933688 7:66016653-66016675 AACCTGTACAGCAGCATCAGAGG + Intergenic
1028136658 7:87230174-87230196 CAGCTGCCCAGCTGCAGCTGTGG + Intergenic
1029280082 7:99429856-99429878 CAGGTGAGCAGCTGCCCCAGAGG + Intronic
1029379014 7:100200480-100200502 CAGCTGAGAAGCTGGAGCAGGGG - Exonic
1029572476 7:101379351-101379373 CAGGTGAGCCTCTGCATCAGGGG + Intronic
1031512782 7:122670096-122670118 CAGCCTTGCAACTGCTTCAGAGG + Intronic
1033132161 7:138753937-138753959 CAGCTGAGCAGCTTCTGCAGGGG - Intronic
1033814958 7:145060282-145060304 CAACTCAGCAGCTGCAGCAGTGG - Intergenic
1035335394 7:158124746-158124768 CAGCTCTGCAGGTGCATCTTGGG - Intronic
1035568230 8:655997-656019 CAGCCCTGCAGCAGCATCTGCGG - Intronic
1038534536 8:28344419-28344441 TACCTTCGCAGCTGCATCAGTGG - Intergenic
1038698108 8:29824374-29824396 CTGCTGTGCACCTGAAACAGAGG - Intergenic
1040941726 8:52841117-52841139 CAGCTGTGCTGGGGCTTCAGAGG + Intergenic
1042296506 8:67223810-67223832 CAGCTGTCCACCTGCCTCAGTGG - Intronic
1047490437 8:125369946-125369968 CAGCTGGGCTGCTACTTCAGAGG - Intergenic
1048357598 8:133666378-133666400 CTGCTTTCCAGCTGCAACAGTGG + Intergenic
1048443186 8:134475170-134475192 CATCTGTGAAGATGCATCTGTGG + Intergenic
1049004083 8:139843906-139843928 CAGCTCATCAGCTGCAGCAGTGG - Intronic
1049978732 9:884493-884515 CATCTCTGCAGATGCATCTGAGG + Intronic
1050833293 9:10042199-10042221 CACCTGTTCAGCTGCCACAGGGG + Intronic
1051347762 9:16168073-16168095 CACCTGTGAAGCTGCCACAGTGG - Intergenic
1052161731 9:25270052-25270074 CAACTGTGCTTCTGCATCATAGG - Intergenic
1052490530 9:29161137-29161159 CAGCTGTGCAGCTGCAGGTGTGG + Intergenic
1052796984 9:32931682-32931704 CACGTGTGCAGCTGCCTGAGTGG - Intergenic
1052801141 9:32969484-32969506 CAGTTGAGCAGCTGAATCACAGG - Intergenic
1053706428 9:40757314-40757336 CAGATTTTCAGCTGCATGAGGGG + Intergenic
1054568464 9:66784359-66784381 CAGCTGTGCAACTCAATCACAGG - Intergenic
1056721567 9:89076379-89076401 CATCTGGGCAGCTGCATGTGTGG - Intronic
1058607938 9:106743590-106743612 CAGATGTGCAGCTGGATCAGTGG + Intergenic
1059337357 9:113577623-113577645 CAGCTGTGTGGCTGCATCCCAGG - Intronic
1059772487 9:117440772-117440794 CAGCTGTGCTCATGCATTAGGGG - Intergenic
1060157389 9:121329149-121329171 CAGCTGTGCCACTCCCTCAGGGG + Intronic
1060187853 9:121574827-121574849 CAGCTGGGCAGCTGGATGAGTGG + Intronic
1060897782 9:127229375-127229397 AAGCTCTGCAGGTGCTTCAGAGG + Intronic
1061070851 9:128309664-128309686 CAGCTCTGCAGCTACCTGAGGGG + Exonic
1061105089 9:128523802-128523824 CAGCTGTGCAGCCTCATCTCAGG + Exonic
1061764998 9:132876024-132876046 CAGCTGTGCTGCTGCAATAAGGG + Intronic
1062186815 9:135222601-135222623 CAGCTGAGAAGCTGCATCTCTGG + Intergenic
1062611153 9:137374129-137374151 CTGCTGTGCAGCAGCCTCAGCGG + Intronic
1186486932 X:9940774-9940796 CTGCTCTGTAGCTGCTTCAGGGG + Intronic
1186682538 X:11891017-11891039 CAGCTGGGCAGCTGCCTCTTGGG + Intergenic
1191166748 X:57400120-57400142 CAGGTGTGCAGTTGCAGCACTGG + Intronic
1191818508 X:65275152-65275174 CAGCTGTGCAACTGTGTCATGGG + Intergenic
1196983923 X:121246848-121246870 CAGCTGTTCGGTTGCATGAGTGG - Intergenic
1197653188 X:129087186-129087208 CAGCTGTGCACCTGCATGCCAGG + Intergenic
1199746940 X:150777787-150777809 CAGTGGTGCAGCTGCACTAGCGG + Intronic
1200707586 Y:6456122-6456144 CCTCTGTGGAGGTGCATCAGTGG - Intergenic
1201026526 Y:9708586-9708608 CCTCTGTGGAGGTGCATCAGTGG + Intergenic
1202177856 Y:22114119-22114141 CCTCTGTGAAGGTGCATCAGTGG - Intergenic
1202213505 Y:22472276-22472298 CCTCTGTGAAGGTGCATCAGTGG + Intergenic