ID: 954735004

View in Genome Browser
Species Human (GRCh38)
Location 3:52699991-52700013
Sequence GACACTCTAGTGACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954735001_954735004 19 Left 954735001 3:52699949-52699971 CCCACTGATGCAGCTGCACAGCT 0: 1
1: 0
2: 1
3: 14
4: 172
Right 954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 77
954735002_954735004 18 Left 954735002 3:52699950-52699972 CCACTGATGCAGCTGCACAGCTG 0: 1
1: 0
2: 2
3: 31
4: 248
Right 954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954735004 Original CRISPR GACACTCTAGTGACTAGAGC AGG Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
902697724 1:18151518-18151540 CACATTCTAGTGGCCAGAGCAGG + Intronic
913177618 1:116289270-116289292 GTAACTCCAGTGCCTAGAGCAGG + Intergenic
919773320 1:201176878-201176900 GACACTCTGGTGAGGAGAGGAGG - Intergenic
921932425 1:220765550-220765572 GACTCTCTAGTGACTGGGCCTGG - Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1075410284 10:122222688-122222710 GACACTTTAGTGAGGCGAGCTGG + Intronic
1076060858 10:127412944-127412966 GACACTGTAGTGACCAGTCCTGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1080280325 11:30549720-30549742 GAACCTCCAGAGACTAGAGCTGG - Intronic
1085696513 11:78709427-78709449 GACAGTCTAGTGAATGGAGCAGG - Intronic
1090339011 11:125998829-125998851 GACAATCAAGTTTCTAGAGCTGG + Intronic
1093678410 12:21971235-21971257 GACACTGAAGTGGTTAGAGCAGG - Intergenic
1099072979 12:78070490-78070512 CACAAGCTAGTGACTAGAACAGG + Intronic
1101286321 12:103317006-103317028 GCCACTGTGGTGACTAGAGCTGG - Intronic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1116756510 14:48955357-48955379 GTCCCTCTATTGACTGGAGCTGG - Intergenic
1118686153 14:68293114-68293136 GAAACTGTAGAGGCTAGAGCTGG - Intronic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1132006840 15:98235045-98235067 GACACTCTGGTGGCTGGACCTGG + Intergenic
1132639635 16:971684-971706 TACACTCTGATGACTGGAGCGGG + Intronic
1134533099 16:15000419-15000441 GACACTGTAGAGATCAGAGCAGG - Intronic
1142477396 17:197335-197357 CACACTCAACTGACTAGAGTTGG - Intergenic
1145823647 17:27859942-27859964 GACAGCCGAGTGACTAGAGATGG - Intronic
1146407399 17:32550943-32550965 GACACTCTGTTGCCTAGGGCTGG - Intronic
1149797780 17:59536736-59536758 GTCACTGTAGAGAATAGAGCAGG - Intergenic
1150199041 17:63334356-63334378 GAAATCCTAGTGACTAAAGCTGG + Intronic
1159024442 18:63169632-63169654 GCTACTCGGGTGACTAGAGCAGG - Intronic
1165293973 19:34911212-34911234 GACACTCGAGAGGCTAGAGCAGG + Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1168155131 19:54469783-54469805 GGAACTCCAGTGTCTAGAGCTGG + Intronic
932143848 2:69302036-69302058 GACACTGTAGTACCTAGGGCAGG + Intergenic
937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG + Intronic
946808906 2:223501367-223501389 GACACCTCAGTGACCAGAGCTGG - Intergenic
947392759 2:229655986-229656008 GACACTCTAGGGTCTAGAGGAGG - Intronic
947960746 2:234235057-234235079 GACACCCTGGTGACAAGAACTGG + Intergenic
1172628512 20:36362704-36362726 GACACTTTAGTGAGAGGAGCAGG + Intronic
1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG + Intronic
1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG + Intronic
1182900493 22:33894396-33894418 GCCACCCTAGTGAGTAGAGTAGG - Intronic
1184846259 22:47089604-47089626 GTCACTCTAGTCACCAGAGTGGG + Intronic
951033583 3:17908627-17908649 GACACTCTTGAGACGATAGCAGG - Intronic
953520705 3:43639937-43639959 GACACTCCAGTGAGTTCAGCTGG - Intronic
954302364 3:49706686-49706708 GGCCCTCTAGTGCCTGGAGCAGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
962086170 3:132194169-132194191 CAGACTCTAGTGACTAGATAAGG + Intronic
970072677 4:12179308-12179330 GAAACTCAAGTGACTTAAGCTGG + Intergenic
971300124 4:25435045-25435067 GAGAATCTTGTGACTATAGCTGG - Intergenic
972620822 4:40746795-40746817 GAAACTCTGGGGACTAGGGCAGG - Intergenic
972696554 4:41452071-41452093 GAGGCTCTACAGACTAGAGCTGG - Intronic
973095903 4:46199469-46199491 GAAACTATAATGACTAGAGCAGG - Intergenic
973343184 4:49027030-49027052 GCCACTCTAGTGCCTCAAGCAGG + Intronic
978150668 4:105430608-105430630 GACACTCTGTTGCCTAGATCAGG - Intronic
986888228 5:12266640-12266662 GACACTTTAGTCACAAAAGCTGG - Intergenic
990484740 5:56247047-56247069 GACATTGTGGTGACTAGAACAGG + Intergenic
992149152 5:73884819-73884841 GATAATCTAGAGACAAGAGCAGG + Intronic
992211985 5:74489288-74489310 CCAACTCTGGTGACTAGAGCAGG - Intergenic
995084063 5:108087081-108087103 AACACTCTGGTGAATGGAGCTGG + Intronic
997921670 5:137985730-137985752 GACACTGTAGTGTCTAGTACTGG - Intronic
998252123 5:140560514-140560536 GGCCCTCTAGTGACTAGGCCTGG - Intronic
1002319854 5:178368609-178368631 CACACCATAGTGACTTGAGCAGG + Intronic
1006269386 6:32952145-32952167 GCCACTGTATTGACTAGAGAAGG + Intronic
1007290089 6:40779080-40779102 GAAACTCTTGTGGCCAGAGCAGG - Intergenic
1010516612 6:76780697-76780719 GACACTCTAGTGACTTTAAATGG - Intergenic
1013746698 6:113354528-113354550 AACACGCTAGTGATGAGAGCAGG - Intergenic
1014901659 6:126973006-126973028 CTCACTCTATTAACTAGAGCAGG + Intergenic
1017098966 6:150830907-150830929 GACAATCCTGTGACCAGAGCTGG - Exonic
1020388013 7:7628865-7628887 GGCTCTCCACTGACTAGAGCAGG - Intergenic
1030206895 7:106959941-106959963 GCCACTCTAGAGGCTGGAGCTGG - Intergenic
1030695334 7:112579055-112579077 CACACTCTAATTCCTAGAGCAGG - Intergenic
1030912639 7:115270927-115270949 GACACCCCACTGACCAGAGCTGG - Intergenic
1033348667 7:140544544-140544566 GACCCTCTAGTCTGTAGAGCAGG - Intronic
1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG + Intergenic
1051356433 9:16243626-16243648 GCCACTCTAATGACCAGATCAGG + Intronic
1055448276 9:76405338-76405360 TACATTCTAGTGCCTAGTGCAGG - Intergenic
1060126879 9:121055827-121055849 GACACTCTACTGGCCACAGCTGG - Intergenic
1061012191 9:127962266-127962288 GACACTCCAGTGGCCAGAGGTGG - Intronic
1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG + Intergenic
1187282540 X:17868924-17868946 GACACTTTAGTGAATTGGGCTGG - Intergenic
1188957128 X:36446826-36446848 GACATTCTACTGACCAGAGGTGG - Intergenic
1194053562 X:89102334-89102356 GAAACTATAGAGACTAAAGCAGG - Intergenic
1196206912 X:112950507-112950529 GACACTCTAGTGCTTAAGGCAGG + Intergenic