ID: 954735644 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:52705145-52705167 |
| Sequence | CTCCGTTACCGTCAGCCAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 51 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 50} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954735644_954735649 | 19 | Left | 954735644 | 3:52705145-52705167 | CCACCTGGCTGACGGTAACGGAG | 0: 1 1: 0 2: 0 3: 0 4: 50 |
||
| Right | 954735649 | 3:52705187-52705209 | ATACACCAGCCTTGAAAGAGAGG | 0: 1 1: 0 2: 2 3: 14 4: 145 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954735644 | Original CRISPR | CTCCGTTACCGTCAGCCAGG TGG (reversed) | Intronic | ||