ID: 954735644

View in Genome Browser
Species Human (GRCh38)
Location 3:52705145-52705167
Sequence CTCCGTTACCGTCAGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954735644_954735649 19 Left 954735644 3:52705145-52705167 CCACCTGGCTGACGGTAACGGAG 0: 1
1: 0
2: 0
3: 0
4: 50
Right 954735649 3:52705187-52705209 ATACACCAGCCTTGAAAGAGAGG 0: 1
1: 0
2: 2
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954735644 Original CRISPR CTCCGTTACCGTCAGCCAGG TGG (reversed) Intronic