ID: 954737234

View in Genome Browser
Species Human (GRCh38)
Location 3:52716331-52716353
Sequence GTCCAGACTAAAAATTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954737230_954737234 6 Left 954737230 3:52716302-52716324 CCAAAGATCTCATAACACCAGGC 0: 1
1: 0
2: 3
3: 20
4: 121
Right 954737234 3:52716331-52716353 GTCCAGACTAAAAATTATAAAGG 0: 1
1: 0
2: 4
3: 33
4: 245
954737227_954737234 8 Left 954737227 3:52716300-52716322 CCCCAAAGATCTCATAACACCAG 0: 2
1: 5
2: 12
3: 58
4: 233
Right 954737234 3:52716331-52716353 GTCCAGACTAAAAATTATAAAGG 0: 1
1: 0
2: 4
3: 33
4: 245
954737228_954737234 7 Left 954737228 3:52716301-52716323 CCCAAAGATCTCATAACACCAGG 0: 1
1: 2
2: 9
3: 29
4: 188
Right 954737234 3:52716331-52716353 GTCCAGACTAAAAATTATAAAGG 0: 1
1: 0
2: 4
3: 33
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954737234 Original CRISPR GTCCAGACTAAAAATTATAA AGG Intronic
903253595 1:22075147-22075169 GACCAGACTAAAAATCAAAACGG - Intronic
905049048 1:35033168-35033190 AACCAGACTAAAAATCAAAATGG - Intergenic
906392365 1:45429628-45429650 GACGAGACTAAAAATGAAAACGG + Intronic
906663643 1:47601527-47601549 GTCTACACAAAAAATCATAAGGG + Intergenic
907028485 1:51146609-51146631 GTGCAGCCTAAATACTATAATGG + Intronic
909149072 1:71977714-71977736 TTCCTTTCTAAAAATTATAATGG + Intronic
909392108 1:75130779-75130801 TTCCAGACTAATATTTATAATGG + Intronic
910708956 1:90158778-90158800 GTCCTGACTGAAAATTGTGAGGG + Intergenic
911391112 1:97244979-97245001 CACCAGCTTAAAAATTATAAAGG - Intronic
912985268 1:114421698-114421720 TCCTAAACTAAAAATTATAAAGG - Intronic
914227993 1:145737662-145737684 TTTTAGAATAAAAATTATAAAGG + Intronic
915022210 1:152790842-152790864 GGTCAGAGTAAAAATTACAAAGG + Intronic
916540324 1:165747418-165747440 GGGAATACTAAAAATTATAAAGG + Intronic
916877234 1:168982407-168982429 GACCATACTAAAAATCAAAATGG + Intergenic
917586895 1:176436207-176436229 ATCCAGATTAGAAATGATAAGGG - Intergenic
919543701 1:198884531-198884553 GTCTATACTTAAAATTCTAATGG + Intergenic
920992154 1:210949745-210949767 GACCAGATGAACAATTATAATGG - Intronic
922047689 1:221962604-221962626 GACCAGACTAAAAATCAAAATGG - Intergenic
923553931 1:234985912-234985934 GACCAGACTAAAAATCAACATGG + Intergenic
923607247 1:235455276-235455298 GTCCCTACAAAAAATTAAAAAGG - Intronic
924045757 1:240028530-240028552 GTAAATATTAAAAATTATAAAGG + Intronic
1063296698 10:4813789-4813811 CTCCAGACTAAACATTCTTAGGG - Intronic
1065065260 10:21956664-21956686 ATCCAGGCAAAAAATTATAGTGG - Intronic
1065474492 10:26119260-26119282 GTTCAGAAAAAAAATTACAAGGG - Intronic
1065613329 10:27494890-27494912 GACCAAACTAAAAATCAAAATGG - Intergenic
1067282783 10:44885576-44885598 GGCCAGACTAAAAATCAAAATGG - Intergenic
1067973786 10:51001168-51001190 GGCCAGCCTAGAAATAATAAAGG + Intronic
1069171890 10:65241186-65241208 GTCAAAAATAAAAATTACAATGG + Intergenic
1070204786 10:74246731-74246753 GACCAGACTAAAAATCAAAATGG - Intronic
1071139459 10:82490826-82490848 ATCCAGACAAGAAATGATAATGG - Intronic
1071226219 10:83531457-83531479 GTCCCTACTAAAAAATAAAAGGG + Intergenic
1073888898 10:108074092-108074114 GTCCAGACTAAATTGAATAAAGG + Intergenic
1074172728 10:110959540-110959562 GTCCATGCTAAACATGATAAAGG - Intronic
1078768214 11:14320428-14320450 ATCAAGACAAAAAATTTTAATGG + Intronic
1081938904 11:46923968-46923990 GTGCAGAGAACAAATTATAAAGG - Intergenic
1085329249 11:75634049-75634071 GTCCAGATAAAAGATTATGACGG + Intronic
1086106563 11:83154040-83154062 GCCCAGTCTATAAATTTTAAAGG + Intergenic
1086834703 11:91606066-91606088 GACCAGAATAAAAATGATAAAGG - Intergenic
1087189158 11:95233935-95233957 GGCCAGCCTGAATATTATAAAGG + Intergenic
1087470351 11:98566591-98566613 GTCCAGAATAAAAATTGTCCAGG - Intergenic
1088766620 11:112987437-112987459 GTCCAGACAGAAAATCATTATGG - Intronic
1092058811 12:5531202-5531224 ATCAAGACCAAAGATTATAAAGG - Intergenic
1092721498 12:11445749-11445771 GTCCAGACTAAAAATCAAAATGG - Intronic
1094355192 12:29570294-29570316 GAACACACAAAAAATTATAAAGG + Intronic
1095141233 12:38665299-38665321 TTCTAAACTAAATATTATAAGGG - Intronic
1096377303 12:51123872-51123894 GGGCAGACTAAAAATAAAAATGG + Intronic
1096864303 12:54552483-54552505 GTCCTGATTAGAAATTAAAAGGG - Intronic
1099604612 12:84786756-84786778 ATTCAGACCACAAATTATAATGG + Intergenic
1099721547 12:86367498-86367520 GTCCAGACTAAGAGTTTTTAAGG - Intronic
1100250955 12:92823084-92823106 GTTCAGATGAAAAATAATAATGG - Intronic
1101316085 12:103630194-103630216 GTCCAGGCAAAACATGATAAAGG + Intronic
1104235483 12:126931553-126931575 GTAGAGACTGAAAATTATAAAGG - Intergenic
1105618448 13:22043050-22043072 GGCCAGAAGAAAAATTAGAAGGG - Intergenic
1106905279 13:34401659-34401681 GTACATACTCAAAATTATAGTGG + Intergenic
1107741509 13:43455224-43455246 GTACAGCCTAAACATTATGAGGG - Intronic
1109422871 13:62136303-62136325 CTCCTTAATAAAAATTATAAAGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1115147380 14:30241013-30241035 TTCCAGAAGAAAAATTATACTGG + Intergenic
1115701063 14:35953480-35953502 GTCAAACTTAAAAATTATAAAGG + Intergenic
1116503348 14:45647916-45647938 GTCCAGACTAAAATGTTTGAAGG + Intergenic
1117673867 14:58136252-58136274 GTACAGCCTAAAAAGTAAAATGG - Intronic
1118142797 14:63103066-63103088 GTCCAGATAAAATATTATAGTGG + Intergenic
1118201994 14:63683296-63683318 GTCCAGATTAAACATTTTACTGG + Intergenic
1119753992 14:77100880-77100902 GTACACACTAAAACTCATAATGG - Intronic
1119873143 14:78033919-78033941 ATCCATGCTTAAAATTATAAGGG - Intergenic
1120075822 14:80157195-80157217 GTCCAGAGTAAGAATTATGATGG - Intergenic
1121023442 14:90597005-90597027 ATCCAGACTAAAAATGACAGTGG + Intronic
1121760944 14:96444485-96444507 GACCAGACTGAAAATCAAAATGG + Intronic
1121922093 14:97891603-97891625 CTCTAGGCAAAAAATTATAATGG + Intergenic
1124602449 15:31146423-31146445 GACCAGACTAGAAATCAAAATGG + Intronic
1126486682 15:49188720-49188742 GTTCAGGAAAAAAATTATAAGGG - Intronic
1126504036 15:49382022-49382044 GTATAGAATAAAAATTATGAAGG + Intronic
1128036064 15:64527869-64527891 GTCCAGGTTAAAAATGATGAGGG - Intronic
1128482492 15:68052072-68052094 GATCAGACTAAAAATCAAAATGG + Intergenic
1131162411 15:90116025-90116047 GACCAGACTGAAAATCAAAATGG - Intergenic
1131933334 15:97471824-97471846 GCCCAGATTAAATATTATTAAGG + Intergenic
1134114352 16:11536807-11536829 TTCTATATTAAAAATTATAAGGG - Intergenic
1135249216 16:20886483-20886505 GACCAGACTAAAAATCAAAATGG + Intronic
1136082753 16:27863219-27863241 TTTAAGACCAAAAATTATAAGGG - Intronic
1137445191 16:48527276-48527298 GACCAGACTAAAGAATATATGGG + Intergenic
1139814184 16:69654069-69654091 GTTGAGACTAAAAGTTAAAAGGG + Intronic
1140925545 16:79579807-79579829 TTCCACACTAATAATAATAAAGG - Intergenic
1141412141 16:83842729-83842751 GTCCCGGCTAAGAATTATGAAGG + Intergenic
1143751129 17:9028588-9028610 GTCCAGAGTAAATATTGGAAAGG + Intronic
1146103055 17:30004509-30004531 GACCAGACTAAAAATCAAAATGG - Intronic
1146959420 17:36960308-36960330 GGCTAGACTAAAATTTTTAATGG + Intronic
1146985934 17:37217779-37217801 GTACAGACCAAAAATTATTGGGG - Intronic
1147019477 17:37520124-37520146 CTCCACACTCAAAATTAAAATGG + Intronic
1148426463 17:47601669-47601691 GGCCAAACTAAAAATTCTAATGG + Exonic
1148817533 17:50340740-50340762 GACCAGACTAAAAATCAAAATGG + Intergenic
1148817583 17:50341287-50341309 TACCAGACTAAAAATCAAAATGG - Intergenic
1149199852 17:54171613-54171635 GTTCAGCCTCAACATTATAACGG - Intergenic
1149206178 17:54251237-54251259 ATCCATACTAAAAAGTAAAAGGG + Intergenic
1150923739 17:69511017-69511039 GTAAAGAATAAAAATTGTAAGGG - Intronic
1153182983 18:2456672-2456694 GACCAGACGAAAAATCAAAATGG + Intergenic
1153240591 18:3028131-3028153 GACCAGACTAAAAATTAAAATGG - Intergenic
1153264136 18:3251970-3251992 GTCCAGACTAAATACAATTATGG - Intronic
1153982094 18:10319029-10319051 GCAAAGATTAAAAATTATAATGG - Intergenic
1155097563 18:22573019-22573041 TTCCAGTCTAAAAATTCTTAAGG - Intergenic
1156921959 18:42532974-42532996 GTACAGAATAAAAAGTTTAATGG + Intergenic
1158202587 18:54957271-54957293 GTCAAGTCTAAAAATGATAGAGG - Intronic
1158763310 18:60416136-60416158 TTTCAGACCAAAAATTTTAAAGG - Intergenic
1158904326 18:61997440-61997462 GACCAGACTAAAAATCAAGATGG - Intergenic
1159339070 18:67110959-67110981 TTCAAAAATAAAAATTATAAGGG - Intergenic
1164899041 19:31902677-31902699 GTCCAGTATAAAAAATATACTGG + Intergenic
1164922590 19:32100300-32100322 GACCAGACTAAAAATCAAAATGG - Intergenic
1166635846 19:44451530-44451552 GTCCAAACTAAATATTGTACAGG + Intergenic
1167256754 19:48435007-48435029 ATCCACAATAAAAATTATTATGG - Intronic
925241508 2:2334762-2334784 TTCCACACAAAAAATTATATGGG - Intergenic
925700645 2:6633972-6633994 GTCCATAATAAAAATTAGGAGGG + Intergenic
926643898 2:15267672-15267694 GTATATACCAAAAATTATAAAGG + Intronic
928482880 2:31700999-31701021 ATTCAGACAAAAAATTAAAAAGG + Intergenic
929912024 2:46098102-46098124 GTTCAGAGCAAAAATTATGAGGG + Intronic
931890865 2:66670620-66670642 CTCAAAACTAAAAATAATAAAGG - Intergenic
933119250 2:78515788-78515810 GTCCAGAATAAAAAATAGACTGG + Intergenic
933212098 2:79582038-79582060 GTCTAGACTATAATTTAAAAGGG + Intronic
933322262 2:80791940-80791962 GTAAAGACTAGAAATTCTAAAGG + Intergenic
934156828 2:89209325-89209347 GTAAAGGATAAAAATTATAAAGG + Intergenic
934210491 2:89973427-89973449 GTAAAGGGTAAAAATTATAAAGG - Intergenic
936690204 2:114878017-114878039 GTCCAGATGATAAATTAAAATGG + Intronic
936764226 2:115826203-115826225 GACCAGACTAAAAATCAAAATGG - Intronic
937007642 2:118531882-118531904 GTTCATCCTAAAAAATATAAGGG - Intergenic
938189862 2:129267301-129267323 GACTAGACTAAAAATTTCAATGG + Intergenic
938748023 2:134299330-134299352 GTATAGACTAAAAATTTTATAGG + Intronic
938887937 2:135672477-135672499 GTCCTGACTGATATTTATAAAGG - Intronic
941393667 2:164947860-164947882 CTCCAGACAAGAAATTATGAAGG - Intronic
944093003 2:195933963-195933985 GTCAAGAATAAAAATCATGATGG - Intronic
944113101 2:196156361-196156383 GTCAAGAATAAGAATGATAAAGG - Intronic
945611263 2:212006513-212006535 ACCCAAACTAAAAATTATTAGGG + Intronic
947527990 2:230891067-230891089 GTACAGACAAAAAATTTAAATGG - Intergenic
948176715 2:235949328-235949350 TTCCAGAAAAAAAATTATCATGG - Intronic
948843389 2:240671124-240671146 GTGCAGACTTAAAGCTATAACGG + Intergenic
1170558247 20:17532617-17532639 TTCCATAATAAAAATTAAAATGG - Intronic
1170793955 20:19530595-19530617 GTCCAGCCTAAAGATTCTCAAGG + Intronic
1170930454 20:20765258-20765280 TTCCTGACTACAAATTAAAATGG - Intergenic
1170943492 20:20868705-20868727 TGCCAGACTAAAAATAAAAAAGG + Intergenic
1171933273 20:31247912-31247934 GACCAGACTAAAAATCAAAATGG - Intergenic
1173886113 20:46460343-46460365 GATCAGAAAAAAAATTATAAAGG - Intergenic
1174436197 20:50509072-50509094 GACTAGACTAAAAATCAAAATGG - Intergenic
1174971347 20:55279339-55279361 GTACAGACTCATAATTATATTGG - Intergenic
1175020162 20:55837895-55837917 ATCCAGACCAAAAATTAACAAGG - Intergenic
1178168684 21:30012869-30012891 GTTCACATTAAAAATTAGAATGG + Intergenic
1179394349 21:41024504-41024526 GTCCAGCATAAAAATTGTCAAGG + Intergenic
949126883 3:456049-456071 GTGCAAAGTAAAAATTAGAAAGG - Intergenic
951047777 3:18060359-18060381 GTTCAGGCTAAAAAAAATAAGGG + Intronic
952715456 3:36475707-36475729 GTCCACAAGCAAAATTATAAAGG + Intronic
953989288 3:47471848-47471870 GTACATAATAAAAATTATTATGG + Intronic
954066820 3:48113355-48113377 GACCAGACTAAAAACTAAAATGG + Intergenic
954737234 3:52716331-52716353 GTCCAGACTAAAAATTATAAAGG + Intronic
955910120 3:63851442-63851464 GACCAGACTAAAAATCAAAATGG + Intronic
956380271 3:68657549-68657571 GACCAGAAAAAAAAATATAAGGG - Intergenic
956429818 3:69175171-69175193 ATACAGACTACAACTTATAAAGG - Intronic
959979906 3:112504408-112504430 GGCCAAACTCAAAACTATAAAGG - Intergenic
960423128 3:117473959-117473981 GTCCAGAACAAAAATTATATTGG + Intergenic
962858642 3:139374935-139374957 ATCCAGAATAAAAATATTAAAGG - Intronic
963644436 3:147895985-147896007 GTCCCAACTGAAAACTATAAAGG - Intergenic
964272467 3:154972373-154972395 GATCAGACTAAAAATCAAAACGG - Intergenic
964518220 3:157535478-157535500 GTCCAGATTACAAATTAAGAGGG + Intergenic
964943434 3:162189402-162189424 GTACACAATAAAAATGATAAAGG - Intergenic
965556393 3:170022719-170022741 GACCAGACTAAAAATCAGAATGG - Intergenic
966518102 3:180842608-180842630 ATCCAGACTGAAAATTAATAGGG - Intronic
966721855 3:183071430-183071452 GCCCAGTCTATAAATTACAATGG + Intronic
967350129 3:188505632-188505654 GGCAAGACTAGAAAATATAATGG - Intronic
969328356 4:6457298-6457320 GTCTTGACAAAAAATTTTAAAGG - Intronic
970513461 4:16803449-16803471 GTCCAGAGTTCAATTTATAAAGG + Intronic
972601640 4:40578050-40578072 GACCAGACTGAAAATCAAAATGG + Intronic
972692466 4:41412820-41412842 GTCAAGAGAAAAAATTAAAAGGG + Intronic
973571135 4:52240992-52241014 GACAAGACTAAAAATAAAAATGG - Intergenic
974783939 4:66592744-66592766 ATTCATGCTAAAAATTATAAAGG + Intergenic
975392148 4:73833011-73833033 TTCCAGAATCAAAATTGTAAAGG + Intergenic
975601294 4:76102393-76102415 GACCAGACTAAAAATCGAAATGG - Intronic
976371720 4:84297009-84297031 GTCCAGACAGAAAATTATCAAGG + Intergenic
976766639 4:88604724-88604746 GTCCACACAAAAACTTATAAAGG - Intronic
976911261 4:90309053-90309075 GTCAAGGCTAAAAATTCTGAAGG - Exonic
977786967 4:101047312-101047334 TACATGACTAAAAATTATAAAGG - Intronic
978105492 4:104897295-104897317 GTCAAGAGTAAAAATAAGAAAGG - Intergenic
979655025 4:123182230-123182252 CTCCATAATAAAATTTATAAGGG - Intronic
979847156 4:125529941-125529963 TTATAGACTAAAAAATATAATGG + Intergenic
980236646 4:130115925-130115947 TTCCAGATTTAAAGTTATAATGG - Intergenic
980497029 4:133599146-133599168 GACTCAACTAAAAATTATAATGG - Intergenic
980954191 4:139411430-139411452 GTCCAGATGAAAAATGATGATGG + Intronic
981041368 4:140225513-140225535 GGCCAGATTAAATATAATAAAGG - Intergenic
981157321 4:141454504-141454526 GTCCAGACATAAAATTGTATTGG + Intergenic
982144468 4:152368677-152368699 GTCAGAACTTAAAATTATAATGG + Intronic
983258870 4:165433365-165433387 GACCAGGCTAAAAATCAAAATGG - Intronic
983741621 4:171141253-171141275 GGCCAGACTAAAAACCAAAATGG - Intergenic
984185400 4:176537370-176537392 GGCCAGACTCACAAATATAATGG + Intergenic
984314375 4:178107807-178107829 ATAGAGACTAAAAATTACAAAGG - Intergenic
984314898 4:178116221-178116243 GACCAAACTAAAAATTAAAATGG + Intergenic
984564758 4:181315436-181315458 GTCCCTACTAAAGATGATAAAGG - Intergenic
984787422 4:183581548-183581570 GTCCAAAATAAAAAATATATCGG - Intergenic
984895048 4:184531043-184531065 GTCCAGGCTAAATATGAGAATGG + Intergenic
987206880 5:15636758-15636780 ATCCAAACTAAAAATCACAAAGG - Intronic
989236101 5:39150129-39150151 GACCAGATTAAAAATCAAAATGG + Intronic
989291243 5:39768810-39768832 TTCTAGAATAAAAATTAAAACGG - Intergenic
990122108 5:52467410-52467432 GTCAGGACTAAAAAATTTAAAGG - Intergenic
990231996 5:53722873-53722895 CTTCAGAATAAAAATTATAGAGG + Intergenic
990736091 5:58864255-58864277 GGCCAGACTCATAAATATAATGG + Intergenic
991439562 5:66632725-66632747 TTCAAGACTAAAAATTATTTTGG + Intronic
992007770 5:72495250-72495272 GTTCAGATTAATAATTAAAAGGG + Intronic
993131735 5:83907058-83907080 GACCAGACTACAATTTTTAATGG - Intergenic
994024327 5:95064249-95064271 AACCAAACTAAAAATTAAAATGG + Intronic
995358444 5:111266282-111266304 GTTCAGAATAAATATAATAAGGG - Intronic
996535500 5:124572967-124572989 GTCTAGAATAAAAATAATAAAGG - Intergenic
998977086 5:147660341-147660363 ATCCAATTTAAAAATTATAATGG + Intronic
1000388165 5:160695272-160695294 GACTAGACTAAAAATTAGAGTGG - Intronic
1000922100 5:167150348-167150370 GTCCAGGAAAAAAATTATTATGG + Intergenic
1000960239 5:167592384-167592406 GTCTAGACTCAAAGTAATAAAGG - Intronic
1001059373 5:168475416-168475438 GACCAGACTAAAAATCAGAATGG + Intergenic
1001616094 5:173044849-173044871 GACCAGGCTAAAAATCAAAATGG - Intergenic
1003623124 6:7719805-7719827 GCTCAGACAAAAAATGATAACGG - Intergenic
1004797227 6:19100418-19100440 GTCCAAACAAAAAAATAAAAAGG + Intergenic
1005808591 6:29498869-29498891 GTCCAGACACAAAATCAAAAAGG - Intergenic
1009719147 6:67442565-67442587 CTGCTGTCTAAAAATTATAATGG - Intergenic
1010283094 6:74042586-74042608 GCCTAGATTAAAAATTTTAAAGG + Intergenic
1011997474 6:93610739-93610761 GTAAAGACATAAAATTATAAGGG - Intergenic
1012430385 6:99158053-99158075 GTGCAGACTCAATATTAGAATGG - Intergenic
1012528320 6:100203941-100203963 GTCCACACTGATACTTATAAAGG + Intergenic
1012717581 6:102696624-102696646 CTCGAGCCTAAAAAATATAATGG - Intergenic
1013088873 6:106881153-106881175 GACCAGAGTAAAAATCAAAATGG + Intergenic
1013245322 6:108281705-108281727 GTCCAGACTAAAAATTATTCAGG + Intergenic
1014209733 6:118695807-118695829 GTTCAGATGACAAATTATAAAGG - Intronic
1014267874 6:119302261-119302283 CACCAAACTAAAAATTATCACGG + Intronic
1015538525 6:134291335-134291357 GACCGGACTAAAAATCAAAATGG + Intronic
1016399636 6:143665683-143665705 ATCCAGACTAGAAATGATAGTGG - Intronic
1017753233 6:157508292-157508314 GAACAGACAAAAAATAATAATGG - Intronic
1017873869 6:158507659-158507681 TTCCAGATTAAAAAGTAAAAGGG - Exonic
1020158795 7:5751401-5751423 GACCAGACTAAAACTCAAAACGG + Intronic
1020343614 7:7139432-7139454 GACCAGACCAAAAATCAAAAGGG + Intergenic
1021466353 7:20948421-20948443 TGCCAGACTTCAAATTATAAAGG + Intergenic
1023352102 7:39330885-39330907 GTACAGACTTAAAATTAGATAGG - Intronic
1023537226 7:41226090-41226112 GACCAGACTAAAAACTAAAATGG + Intergenic
1023605009 7:41922128-41922150 GTCCAAAATAAAAATTTCAAAGG + Intergenic
1024719253 7:52116657-52116679 GACCAGATTAAAAATAAAAACGG + Intergenic
1025770412 7:64500047-64500069 TTACAGACTAAAAATTTTTAAGG - Intergenic
1030274430 7:107704908-107704930 GACAAGACTAAAAATCAAAATGG - Intronic
1031036873 7:116796917-116796939 GTCTATACAAAAATTTATAAGGG - Intronic
1031112535 7:117629692-117629714 GACCAGACTAAAAGTAAAAATGG - Intronic
1031498018 7:122475501-122475523 GTACAATCTTAAAATTATAAAGG + Intronic
1031940207 7:127780605-127780627 GTCAAGAAGAAAAATTACAAAGG - Intronic
1032244987 7:130203844-130203866 GTCCTGAAAAAAAATTAGAAAGG + Exonic
1033531655 7:142270224-142270246 TTCCAGAATAAAAATTGAAAAGG - Intergenic
1033997726 7:147372614-147372636 GTGCAGAATAAATGTTATAATGG - Intronic
1036014075 8:4761459-4761481 ATTCACACTAGAAATTATAAAGG - Intronic
1037392273 8:18405857-18405879 GACCAGACTAAAAATCACAATGG - Intergenic
1038210674 8:25516715-25516737 GTCTAGATTAAGCATTATAAGGG - Intergenic
1041643563 8:60228736-60228758 ATCCAGATTAAGAATAATAATGG - Intronic
1041994165 8:64032656-64032678 GACCAGACTAAATCTTCTAATGG + Intergenic
1042721534 8:71831988-71832010 CTCCAGAGTAAAAATTATAGTGG - Intronic
1042864064 8:73341646-73341668 GTCCAGTTTAAAATATATAAGGG + Intergenic
1043170233 8:76956804-76956826 ATCCAGATTAAAAATAATACTGG - Intergenic
1043261527 8:78205687-78205709 ACCCAAACTAAAAATTAAAAAGG + Intergenic
1043292826 8:78624780-78624802 CTCCAGAAAAAAAATTATAGTGG + Intergenic
1043808720 8:84706701-84706723 GTCCAGAACAAAGATTATTATGG + Intronic
1043946083 8:86254212-86254234 GACCAGACTAAAAATCAAAATGG + Intronic
1044161418 8:88921021-88921043 GTCTAGACTACAAATTAGAAAGG - Intergenic
1045621808 8:103986982-103987004 TTCCAGACTAAAAAGTACTATGG + Intronic
1046355298 8:113076361-113076383 ATTCAGAATATAAATTATAAGGG - Intronic
1047816301 8:128467260-128467282 GTTCAGACTTCAAATGATAAAGG - Intergenic
1051207783 9:14707254-14707276 ATCCAGACTAAAAATCAATAAGG + Intergenic
1052434969 9:28414918-28414940 GTCCAGAGTTAAAAAAATAAGGG + Intronic
1055559331 9:77507005-77507027 GTACAGGATAAAAATTCTAAAGG + Intronic
1057465360 9:95309208-95309230 GTAATGACTAAAAATTCTAATGG + Intronic
1058266794 9:102909920-102909942 GTCCAGAAAAAAAATTACATTGG - Intergenic
1059479751 9:114579914-114579936 GACCAGACTAAAAATCAAAATGG + Intergenic
1062117254 9:134816152-134816174 GTCCAGAATCAATATCATAAGGG - Intronic
1062229485 9:135473752-135473774 GTGCAGAGTAAAAATGAGAAAGG - Intergenic
1062695165 9:137871317-137871339 GTCGATCCTAAAAATTATAAGGG + Intergenic
1186390825 X:9157248-9157270 GGAAAGACTAAAACTTATAAAGG - Intronic
1186564647 X:10649682-10649704 GTTCATATTAAAAATTATAATGG - Intronic
1187385170 X:18842048-18842070 GACCAGACTAAAAATCAAAGTGG + Intergenic
1187576119 X:20557917-20557939 GTACAGAATAATATTTATAATGG - Intergenic
1188750727 X:33902792-33902814 GACTAGACTAAAAATCAAAATGG + Intergenic
1189120526 X:38389450-38389472 GTCCAGACTAAAAATGTTAAAGG + Intronic
1189810314 X:44775365-44775387 GACCAGACTAAAAGTCAAAATGG - Intergenic
1191153889 X:57250826-57250848 GAACAGACTAACAATTATTAAGG + Intergenic
1191753047 X:64564355-64564377 GTCCAGATGAAAGATTATAGTGG + Intergenic
1192816593 X:74599992-74600014 GTCTAGACTAAAATTTATTTAGG - Intronic
1193213684 X:78838010-78838032 GTACAGACTAATAAATCTAAGGG - Intergenic
1194486058 X:94488017-94488039 CTCCATAATACAAATTATAAAGG + Intergenic
1196971780 X:121117496-121117518 GAGCAGTTTAAAAATTATAAAGG - Intergenic
1199039217 X:143091020-143091042 GACCAGAATAAAAATTAAACAGG + Intergenic
1200416050 Y:2911160-2911182 GACCAGACTAAAAATTAAACTGG + Intronic