ID: 954739420

View in Genome Browser
Species Human (GRCh38)
Location 3:52736153-52736175
Sequence TTAAGTACCTGGGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 229}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954739420_954739427 19 Left 954739420 3:52736153-52736175 CCTGTTTTTTCCCAGGTACTTAA 0: 1
1: 1
2: 2
3: 18
4: 229
Right 954739427 3:52736195-52736217 GGTTCTTATGTATTTTTGGCGGG 0: 1
1: 0
2: 0
3: 14
4: 260
954739420_954739430 22 Left 954739420 3:52736153-52736175 CCTGTTTTTTCCCAGGTACTTAA 0: 1
1: 1
2: 2
3: 18
4: 229
Right 954739430 3:52736198-52736220 TCTTATGTATTTTTGGCGGGGGG 0: 1
1: 0
2: 0
3: 30
4: 302
954739420_954739431 23 Left 954739420 3:52736153-52736175 CCTGTTTTTTCCCAGGTACTTAA 0: 1
1: 1
2: 2
3: 18
4: 229
Right 954739431 3:52736199-52736221 CTTATGTATTTTTGGCGGGGGGG 0: 1
1: 0
2: 1
3: 24
4: 364
954739420_954739425 15 Left 954739420 3:52736153-52736175 CCTGTTTTTTCCCAGGTACTTAA 0: 1
1: 1
2: 2
3: 18
4: 229
Right 954739425 3:52736191-52736213 AAGTGGTTCTTATGTATTTTTGG 0: 1
1: 2
2: 3
3: 20
4: 341
954739420_954739423 -2 Left 954739420 3:52736153-52736175 CCTGTTTTTTCCCAGGTACTTAA 0: 1
1: 1
2: 2
3: 18
4: 229
Right 954739423 3:52736174-52736196 AAAATACAAGTGCCAGTAAGTGG 0: 2
1: 1
2: 1
3: 18
4: 281
954739420_954739428 20 Left 954739420 3:52736153-52736175 CCTGTTTTTTCCCAGGTACTTAA 0: 1
1: 1
2: 2
3: 18
4: 229
Right 954739428 3:52736196-52736218 GTTCTTATGTATTTTTGGCGGGG 0: 1
1: 0
2: 2
3: 16
4: 185
954739420_954739429 21 Left 954739420 3:52736153-52736175 CCTGTTTTTTCCCAGGTACTTAA 0: 1
1: 1
2: 2
3: 18
4: 229
Right 954739429 3:52736197-52736219 TTCTTATGTATTTTTGGCGGGGG 0: 1
1: 0
2: 0
3: 43
4: 581
954739420_954739426 18 Left 954739420 3:52736153-52736175 CCTGTTTTTTCCCAGGTACTTAA 0: 1
1: 1
2: 2
3: 18
4: 229
Right 954739426 3:52736194-52736216 TGGTTCTTATGTATTTTTGGCGG 0: 1
1: 0
2: 5
3: 37
4: 678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954739420 Original CRISPR TTAAGTACCTGGGAAAAAAC AGG (reversed) Intronic
900578716 1:3396981-3397003 TTAAGTACCAGGGAAAGCAAAGG - Intronic
904788053 1:32997336-32997358 GAAAGTCCCTGGGAAACAACTGG + Intergenic
905224192 1:36468349-36468371 TTAAATCCCTGGGAAAAATGAGG - Intronic
906250888 1:44310084-44310106 TTAAGTACCTACCACAAAACAGG + Intronic
906918910 1:50042245-50042267 TAAAGTGCCTGGCATAAAACTGG - Intergenic
907951509 1:59188202-59188224 AGAACTACCTGGGAGAAAACAGG - Intergenic
908062421 1:60366362-60366384 TTAAGAACATAAGAAAAAACAGG + Intergenic
909869348 1:80719508-80719530 TAAATGATCTGGGAAAAAACTGG - Intergenic
911181772 1:94867219-94867241 TTATGCACCTGGGGAAACACTGG - Intronic
914389198 1:147203403-147203425 ATACTTACCTGGGAAAACACTGG - Intronic
915386137 1:155494202-155494224 GTAGGTATGTGGGAAAAAACAGG + Intronic
916531946 1:165664899-165664921 TGAATTACCTGGGGAAATACAGG - Intronic
918536801 1:185583804-185583826 TTAAATACCTGGGAGAATCCAGG + Intergenic
919055752 1:192567749-192567771 ATAAGTACCTAAGAAAAAGCAGG + Intergenic
919406180 1:197187184-197187206 TTAAATACCTTGGAAAACAGGGG - Intronic
919508959 1:198436567-198436589 GTAAGTACCTGTCAAAGAACAGG + Intergenic
919883610 1:201916957-201916979 TTGTGAACCTGGGAAAAAAAGGG + Intronic
921105282 1:211970821-211970843 TAAAGCCACTGGGAAAAAACTGG + Intronic
921633149 1:217458568-217458590 TAAAGGACCTGGAAAAATACGGG - Intronic
923872386 1:238009855-238009877 TCAAGTAGCTGGAGAAAAACAGG - Intergenic
924099221 1:240586306-240586328 TTAATTACCTGGAATAAAAATGG - Intronic
924906576 1:248459714-248459736 TTCAGTACCTAGGAAAATATAGG + Intergenic
924921308 1:248632309-248632331 TTCAGTACCTAGGAAAATATAGG - Intergenic
1065820960 10:29525259-29525281 TTAAGTACCTTTTAGAAAACTGG - Intronic
1066179549 10:32946691-32946713 TTAAGTACCTGGAGAAAAACAGG - Intronic
1069238775 10:66111736-66111758 TAAAGCACCTGAGGAAAAACTGG + Intronic
1069748623 10:70731865-70731887 TTAGGTACCAGGGGGAAAACAGG - Intronic
1071938914 10:90565124-90565146 TGAAGTAACTGGAAAAAATCAGG - Intergenic
1072779206 10:98233916-98233938 TCAAGTAACGGGGAAAAAAGGGG - Intronic
1073619059 10:105028213-105028235 ATAAGAATCTGGGAAAACACAGG - Intronic
1073888742 10:108072091-108072113 TTAAGGTCCTGGGAAAGAACAGG - Intergenic
1078353815 11:10618293-10618315 TAAAGTACCTGGGAACAAAGAGG - Intronic
1078741479 11:14070659-14070681 TGAAGTACTTGGGAGAAATCAGG - Intronic
1082230433 11:49759059-49759081 TTATGTAATTGTGAAAAAACAGG + Intergenic
1083985123 11:66209385-66209407 GGAAGTTCCTGGGAAAAAAAAGG + Intronic
1084708051 11:70827221-70827243 GTAATTACCCTGGAAAAAACAGG + Intronic
1084912109 11:72398425-72398447 TTAATTACTTGGGAAAACACAGG - Intronic
1086619618 11:88869903-88869925 TTATGTAATTGTGAAAAAACAGG - Intronic
1086724462 11:90165958-90165980 TCAAGAACCTGGCACAAAACTGG - Intronic
1088030197 11:105239470-105239492 ATAAGTTCCTGGGAGAAACCTGG - Intergenic
1088215791 11:107507432-107507454 TTAAGGAGCTGGGAAATATCGGG + Intronic
1089875234 11:121714902-121714924 GAAAGTAACAGGGAAAAAACGGG - Intergenic
1092356421 12:7799277-7799299 TTAAATACATGGAACAAAACAGG + Intergenic
1096247077 12:49997197-49997219 TTAATAACCTGGGATAAAACAGG + Exonic
1096905153 12:54928668-54928690 TTAACTACCAGAGAAAAGACTGG + Intergenic
1098006400 12:66001078-66001100 TTAGATACCTAGAAAAAAACTGG - Intergenic
1098488506 12:71048527-71048549 ATAAGAACCTGAGAAAAAGCTGG - Intronic
1099021163 12:77406365-77406387 TTATGTTCCTAGGAAAACACTGG + Intergenic
1099136722 12:78913902-78913924 TTAAGTATCTTGGGAAAAATGGG + Intronic
1102848047 12:116208985-116209007 TAAAGCACCAGGGAAAAAAAAGG + Intronic
1103519406 12:121527948-121527970 TTAAGTACCTGGGGTGAACCAGG - Intronic
1104459384 12:128942503-128942525 TTAAGTACCTGGGGAAAAAATGG + Intronic
1105666421 13:22562416-22562438 TTAAGTAACAGGAAAAAAAAAGG + Intergenic
1106368962 13:29112845-29112867 TTAATTACCTGGGACAAATGAGG - Intronic
1107072246 13:36283695-36283717 TTCACTACCTGAGTAAAAACAGG + Exonic
1107246808 13:38306621-38306643 TCAAGGACATGGAAAAAAACAGG - Intergenic
1107716355 13:43203328-43203350 TTAAGACCCTGGAAAGAAACAGG - Intergenic
1108158664 13:47615247-47615269 TGTAGTAGATGGGAAAAAACAGG + Intergenic
1110666818 13:78126863-78126885 ATAAGAACAAGGGAAAAAACAGG - Intergenic
1111834109 13:93365861-93365883 TTCAGTTCCAGGGAAAAAAGAGG + Intronic
1111985057 13:95057604-95057626 GCAAGGACCTGGGAAAGAACTGG - Intronic
1112469796 13:99677025-99677047 CTAAGGACCTGGGAAAAAAAGGG - Intronic
1112986136 13:105452278-105452300 TTGAGTAACTGGAAAAAAAAAGG + Intergenic
1113272756 13:108692772-108692794 CTAGGAACCTGGGAAATAACTGG + Intronic
1114783464 14:25566985-25567007 TTAAGTACCTAGGTCAAAAAAGG - Intergenic
1117035431 14:51723149-51723171 TAAAGTACATGGGCAAAAAGGGG - Intronic
1119246854 14:73117525-73117547 ATAAATACCTGGGAAGAGACTGG - Intronic
1119531611 14:75365379-75365401 GTAAGTACCTGGGAGATAATGGG - Intergenic
1120413641 14:84192617-84192639 TTAAGTACTTAGGAAAATACGGG + Intergenic
1121862332 14:97329977-97329999 GTAAGAGCCTGGCAAAAAACAGG + Intergenic
1122451010 14:101807477-101807499 CTAAGTACCTGGAAAAATAGAGG + Intronic
1124645401 15:31434686-31434708 GTCAGTAGCTGGGAAAATACTGG + Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127741870 15:61915909-61915931 TGAAATACCAGGGCAAAAACTGG - Exonic
1131581853 15:93651078-93651100 TTAAATACCTGGGAATAAAATGG - Intergenic
1132944083 16:2522821-2522843 TTAAGTACTAAGGAATAAACAGG - Intronic
1133018881 16:2957421-2957443 TTAATTACCAGAGAAAAGACTGG + Intergenic
1133317581 16:4893992-4894014 TTAAGTACCTGGTACAAAGTAGG - Intronic
1135846000 16:25919149-25919171 TTAAGTAGCTGGGACACTACAGG + Intronic
1138375415 16:56560331-56560353 AAAAGTACCTGGAAAAAAGCAGG - Intergenic
1138614648 16:58155659-58155681 GTAAGTGCATAGGAAAAAACCGG + Intergenic
1141285599 16:82668779-82668801 CTGAGTACCTGGGACAGAACAGG + Intronic
1144102682 17:11956861-11956883 TTAAGAAACTAGGAAAAAAATGG + Intronic
1144215207 17:13049345-13049367 TTAAGTACCCTGGATACAACAGG - Intergenic
1148964671 17:51424831-51424853 TTAAGTCCCTGGCAATGAACGGG + Intergenic
1149331645 17:55588766-55588788 TTAAGTACTTAGGAAGTAACAGG - Intergenic
1149641214 17:58204140-58204162 TAAAGTACCTGGCACACAACAGG + Intronic
1149975200 17:61258563-61258585 TAAAGTGCCTGGCACAAAACAGG + Intronic
1150310302 17:64123028-64123050 TTATCTACCTGGAAAAAAAAAGG - Intronic
1150425945 17:65077175-65077197 TTGAGAACCTGGGAAAAAAGAGG + Intergenic
1151133469 17:71922615-71922637 TTCAGAGCCTGGGAGAAAACAGG - Intergenic
1151141585 17:71997979-71998001 TTAAGTGCCTGAAACAAAACTGG + Intergenic
1154333382 18:13447899-13447921 TTAAGTAACTGGGGAAAGTCAGG + Intronic
1157852122 18:51064651-51064673 TTAAATCACTGGGAAAAAAGAGG - Intronic
1158238325 18:55346012-55346034 TCAAGCACCTGGGATAAAAGGGG + Intronic
1159718221 18:71851406-71851428 TCAAGCACCTAGGAATAAACAGG - Intergenic
1164270166 19:23665617-23665639 TTGAGTAGCTGGGATAACACAGG + Intronic
929832801 2:45361577-45361599 TTAATTACCTAGGAGAAGACTGG - Intergenic
930620209 2:53635648-53635670 GTAAGTACATGTGGAAAAACAGG - Intronic
931765519 2:65452710-65452732 TTAGGTACCTGGGCGGAAACAGG - Intergenic
932113725 2:69025425-69025447 TTAAGCATCAGGGGAAAAACAGG - Intronic
933200685 2:79444663-79444685 TTGAGTACCTGGGAAACAAAAGG - Intronic
934519199 2:95009111-95009133 TTAAATGCCTGAGTAAAAACTGG + Intergenic
935599663 2:104910123-104910145 TTAAGTATCTGAGAAAAATATGG + Intergenic
935787243 2:106560341-106560363 ATAATCACCTGGGAAAAAAGAGG - Intergenic
936701560 2:115017335-115017357 TTAAAAACGTGGGAAACAACAGG + Intronic
936782136 2:116047114-116047136 TAAAGTACTAGAGAAAAAACTGG + Intergenic
936824608 2:116566074-116566096 ATAAGTAGCTGTGAAAAATCTGG + Intergenic
938884729 2:135632864-135632886 ATAAGAACCTGGGAGAAATCTGG - Intronic
940243169 2:151585235-151585257 TTAAATTCCTGGGAAAATTCAGG - Intronic
940244125 2:151595788-151595810 TTAAATTCCTGGGAAAATTCAGG - Intronic
940245083 2:151606335-151606357 TTAAATTCCTGGGAAAATTCAGG - Intronic
942399576 2:175587381-175587403 ATAAGTACTTGGGAAAAAATTGG + Intergenic
943265313 2:185723360-185723382 TTAAGTACCTGCAAAAATAATGG + Intergenic
944558884 2:200915267-200915289 TTAAAGACATGGGAAAAATCAGG - Intronic
944890572 2:204113186-204113208 TTAATTACCTGGTAAATATCTGG + Intergenic
945004256 2:205386775-205386797 CTAAGTAGCTGGGATCAAACAGG - Intronic
945144496 2:206723155-206723177 TTAAGTACCTAAGAATGAACCGG + Intergenic
945187911 2:207158221-207158243 AAAAGTAACTGGGGAAAAACTGG + Intronic
946111841 2:217426703-217426725 TGAAATACCTGGAAAGAAACTGG - Intronic
946673677 2:222133932-222133954 TTAACTACCTGTGAAAATAGTGG + Intergenic
948106675 2:235420053-235420075 TTAATTAAGTGGGAAAACACAGG + Intergenic
1169385814 20:5148530-5148552 TTAAGCCCATGGAAAAAAACTGG - Intronic
1171527392 20:25825569-25825591 TTAAGTGCCATGGAAAAAATAGG + Intronic
1171549434 20:26030315-26030337 TTAAGTGCCATGGAAAAAATAGG - Intergenic
1172550060 20:35792140-35792162 TCAAGTATCTGGGAAGAAAGTGG + Intronic
1173954200 20:47018144-47018166 TTAAAGAGCTGGAAAAAAACTGG - Intronic
1174149742 20:48477733-48477755 TTAAGTCCCAGAAAAAAAACCGG - Intergenic
1177095857 21:16831802-16831824 TTAAGTACAAAGAAAAAAACTGG + Intergenic
1177932901 21:27306912-27306934 TAATGTACTTGGCAAAAAACTGG - Intergenic
1178108237 21:29345708-29345730 TTAACAACTTGGGAAAAAAATGG + Exonic
1178505592 21:33160197-33160219 TTTAGAACGTGGGAAACAACAGG - Intergenic
1178838508 21:36118887-36118909 TCAAGTAGGTGGGAACAAACAGG + Intergenic
1181726594 22:24815429-24815451 TTAAGTGCATGGAAGAAAACTGG + Intronic
1184821559 22:46913013-46913035 TTAATTACTTGTGAAATAACTGG + Intronic
1185166158 22:49263545-49263567 TCAAGGACCTGGGAAAAATGGGG + Intergenic
952353606 3:32564186-32564208 TCAAGTAACTGGGAATATACAGG - Intronic
953471888 3:43174651-43174673 GTAAGTACCTATGAAAATACAGG - Intergenic
954170397 3:48797431-48797453 CTAAGAAACTGGGAAATAACTGG - Intronic
954739420 3:52736153-52736175 TTAAGTACCTGGGAAAAAACAGG - Intronic
955264733 3:57431217-57431239 TTGAGTGGCAGGGAAAAAACAGG - Intronic
955493342 3:59505314-59505336 TTAAGTGCCTAGGAAAACAGGGG - Intergenic
961148459 3:124615477-124615499 TAAAGTATCTGGGAATAAAGGGG + Intronic
961161617 3:124731250-124731272 TTCAGTAGCTGGGAAATTACTGG + Intronic
961602352 3:128071666-128071688 TCAAGTACCTTGTAAAAAACTGG - Exonic
962242063 3:133757947-133757969 GTGAGTACCTGGGAAGAACCAGG + Intronic
964637605 3:158874478-158874500 CTCAGTGCCTGGGAAGAAACTGG - Intergenic
967314717 3:188140913-188140935 TTAAGTACCTACTATAAAACAGG - Intergenic
967804496 3:193703358-193703380 TAAAGTACCTGGGATACAGCAGG - Intergenic
969330947 4:6473084-6473106 TTAAGTACATGTGAAGAAGCTGG + Intronic
969919190 4:10521803-10521825 TTAAATGTCTGGGAAAAAATAGG + Intronic
970942738 4:21654578-21654600 CCAAGTACCTGGGGAAACACTGG + Intronic
971625546 4:28915674-28915696 TTAAGTGCCTGTGTAACAACTGG + Intergenic
972418364 4:38864416-38864438 TTTAGTATCTAGGAAAAAAATGG - Intergenic
973610635 4:52633258-52633280 TTAAGGACCTAGGAAACAAGTGG - Intronic
975486411 4:74938064-74938086 TTAATAACTTAGGAAAAAACAGG + Intronic
975970524 4:80029236-80029258 ATCAGTGCCTGGGATAAAACAGG + Intronic
976250175 4:83042365-83042387 TTAAGTTCCTGGTTTAAAACAGG + Intronic
977328223 4:95604048-95604070 TTAAGTGCCTGGGAATTCACAGG + Intergenic
977820786 4:101470831-101470853 ATCAGGACCTTGGAAAAAACAGG + Intronic
978731984 4:112038743-112038765 CCAAGTCCCTGGGACAAAACTGG - Intergenic
978962072 4:114692356-114692378 TTAAGTAACTGGAAAAATATTGG - Intergenic
982122926 4:152159711-152159733 TTAGGTACCTTCAAAAAAACAGG + Intergenic
982529945 4:156527431-156527453 TTAATTACCATGGAAATAACAGG - Intergenic
982734572 4:158992193-158992215 TGAAGTATTTGGGAAAACACTGG - Intronic
983543110 4:168934091-168934113 TTAAGAATCTAGGAAAAAACTGG + Intronic
984305655 4:177986176-177986198 ATTACTACCTGGGAAAATACAGG - Intronic
984691322 4:182729373-182729395 TTCAGTACCTGAGACATAACAGG + Intronic
985349934 4:189048951-189048973 ATATGTACGTGGGAAAAGACTGG - Intergenic
989028200 5:37090130-37090152 TTAAATATCTGGGAGAATACCGG - Intergenic
990173063 5:53076680-53076702 TTAAATATCTGGGAAAATATTGG - Intronic
990744626 5:58947049-58947071 TTTAGTACCTGCTAAATAACAGG + Intergenic
990785823 5:59418553-59418575 TTAAGTACCATGGAGAAAGCAGG - Intronic
990917272 5:60922649-60922671 TATAGTACCTGGCAAAAAATAGG + Intronic
990931020 5:61092433-61092455 TTAAGTACCTAGGAATACAGTGG - Intronic
990972355 5:61522719-61522741 CTGAGCACCTGGAAAAAAACTGG - Intronic
991967192 5:72104934-72104956 CTTAGTAACTGGGAGAAAACAGG + Intergenic
993194325 5:84721529-84721551 TTATGTACATGGAAAATAACCGG + Intergenic
994826895 5:104724324-104724346 TTATGTACCTGTGGAGAAACAGG + Intergenic
995259989 5:110092496-110092518 TAGAGAACCTGGGAGAAAACTGG - Intergenic
996186047 5:120476622-120476644 TTGAGTAAATGGGAAATAACAGG - Intronic
996907193 5:128614563-128614585 TTCAGTTCCTGGAAAAAAAGAGG - Intronic
998785666 5:145706093-145706115 TTAATTAAATGGGAAAAAAAAGG + Intronic
999128144 5:149262075-149262097 CTAAGTACCTGGGGAAAAGTGGG + Intergenic
1005208887 6:23437453-23437475 TTGAGTACCTATGATAAAACAGG + Intergenic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1008762810 6:54874480-54874502 ATAATTACCTGGGAAAAGTCTGG - Intronic
1009491831 6:64301308-64301330 TTAAATACCTGGGAGAATCCAGG - Intronic
1009920059 6:70046353-70046375 TTAATTACCTGGGGAAACACTGG - Intronic
1010986305 6:82428607-82428629 TTAAGGACATGGGCAAAGACTGG + Intergenic
1011140130 6:84145100-84145122 TAAAGTCCCTTGGAAAAAACTGG + Intronic
1011558013 6:88588966-88588988 TAAAGTACCTGGAAATCAACAGG - Intergenic
1011884364 6:92075865-92075887 TTAAGTCCCAGGGAGAAAAGAGG + Intergenic
1012107657 6:95184861-95184883 TAAAGGAACTGGGAAAAGACAGG - Intergenic
1013227483 6:108130605-108130627 TTCACTAGCTGGGAGAAAACTGG - Intronic
1014099744 6:117498735-117498757 TAAAATACCTGGCAAAAAAGAGG - Intronic
1015504255 6:133965410-133965432 TTAGGTACCTGCAAAAAAGCAGG - Intronic
1016125449 6:140396740-140396762 TTAAATAACTGGAAAAATACTGG - Intergenic
1016350245 6:143159027-143159049 TTTAGAACCTGGCAGAAAACAGG - Intronic
1016644522 6:146390715-146390737 AAAAGTACCTGGCACAAAACAGG - Intronic
1016997645 6:149971322-149971344 TTAAGTGGCTGAGAAAAACCTGG - Intronic
1017001165 6:149998909-149998931 TTAAGTGGCTGAGAAAAACCTGG + Intergenic
1017010874 6:150063376-150063398 TTAAGTGGCTGAGAAAAACCTGG + Intronic
1017136392 6:151151131-151151153 CAAAGTACCTGGAAAAAAATAGG + Intergenic
1017227299 6:152036931-152036953 TTAAGTCCTTGGGAATACACTGG + Intronic
1017458173 6:154622125-154622147 TAAAGTACCTCTGTAAAAACAGG + Intergenic
1018751334 6:166808908-166808930 CTAATTAACTGTGAAAAAACAGG + Intronic
1019049797 6:169174127-169174149 TTCAGTACCTGGGGAGAAAGTGG + Intergenic
1019544393 7:1566524-1566546 TTAGGTACCTGTAAACAAACGGG - Intergenic
1019841335 7:3448972-3448994 TTAAGACCCTGGGGAAAAAAGGG + Intronic
1023768235 7:43531798-43531820 TAAAGTACATGAGAAAGAACAGG - Intronic
1023958203 7:44904893-44904915 TTAATTACCTGGGATGAAGCTGG + Intergenic
1026376340 7:69754702-69754724 TAAAGTTCCTGGCACAAAACAGG - Intronic
1027602262 7:80254036-80254058 TTAAGTACCTGGGAGAATGAAGG + Intergenic
1027909884 7:84236921-84236943 TTAATTACCTGGAAAAAAAATGG + Intronic
1028258203 7:88627131-88627153 TTTAGGATGTGGGAAAAAACTGG + Intergenic
1029796285 7:102897979-102898001 TTAATTACATGGGTAAAAATAGG + Intronic
1031249881 7:119366133-119366155 TGAAGAACATGGGAATAAACTGG - Intergenic
1031690222 7:124778860-124778882 CTAAGTTCCCGGGAAAAAAGGGG - Intronic
1033017713 7:137688918-137688940 TGAAGTGCCTGGCAAAAGACTGG - Intronic
1033613671 7:142990149-142990171 TTAATAACCTGGAAAATAACTGG - Intergenic
1035287217 7:157814232-157814254 TTAAGGACCTGGGAGGAAATGGG - Intronic
1037308128 8:17527368-17527390 TTCAGTCACTGGGAAAACACTGG + Intronic
1037420788 8:18700005-18700027 TAAAATTCCTGGGAAAAAATTGG + Intronic
1038272261 8:26084817-26084839 ATAAGTACATGGGAAAGAAGGGG + Intergenic
1040944728 8:52872728-52872750 TTAAGGAGCTGGAAATAAACAGG - Intergenic
1042610699 8:70597262-70597284 TTAAGAAGCTTGGAAAACACTGG + Intronic
1045058578 8:98391934-98391956 TTCAGTAACTGGGATAAAAAGGG - Intergenic
1045162504 8:99564391-99564413 TCAAGAACCTGGGAAACATCCGG + Intronic
1046408555 8:113808087-113808109 TTAAATACCTTGGAAGAAACTGG - Intergenic
1047867822 8:129047732-129047754 ATAAATACATTGGAAAAAACTGG + Intergenic
1050347956 9:4711560-4711582 TTAAGTACCTGGGAAAAAAACGG + Exonic
1051051424 9:12936847-12936869 TTAAGTACTTTGGGAAAAACTGG - Intergenic
1053858032 9:42357566-42357588 TTAAGGAGCTGGGATAGAACTGG + Intergenic
1055390330 9:75814984-75815006 GTAATTATCTGGAAAAAAACTGG - Intergenic
1056747047 9:89311615-89311637 TTTAGTACCTGGGTAGGAACCGG + Intronic
1058654730 9:107209739-107209761 TAAAACACCTGGGAAAACACAGG - Intergenic
1059038647 9:110788247-110788269 TTATGAATCTGGGAATAAACTGG - Intronic
1059134223 9:111788613-111788635 GTAAGTACTTGACAAAAAACGGG + Intronic
1186384431 X:9094494-9094516 TTAAGTTACTGGGAGAACACTGG + Intronic
1187617907 X:21018209-21018231 TTGAGTAGATGGGAAACAACTGG - Intergenic
1188522502 X:31054412-31054434 TATAGTACCAGGGAAAAAGCAGG + Intergenic
1190949560 X:55129978-55130000 ATGAGTACCTGGGAATACACGGG + Intronic
1192213358 X:69141655-69141677 TTTAGTACTTGGGAAAAAGCAGG + Intergenic
1194104940 X:89757268-89757290 TCATGTAGCCGGGAAAAAACTGG + Intergenic
1196189715 X:112781685-112781707 TAAAGTACCAGTGAAAAAAAAGG + Intronic
1196575285 X:117310269-117310291 TAAAGTACCTGGAACATAACAGG + Intergenic
1197317733 X:124988882-124988904 TCAGCTACCTGGGAAAAAAAGGG + Intergenic
1200456904 Y:3405057-3405079 TCATGTAGCCGGGAAAAAACTGG + Intergenic
1200972450 Y:9167789-9167811 CTTAGTACCTGGTAAAGAACTGG - Intergenic
1201339493 Y:12917975-12917997 TAAAGTACTTGAGAAAAAAAAGG + Intronic