ID: 954741357

View in Genome Browser
Species Human (GRCh38)
Location 3:52753361-52753383
Sequence CTGTGGCCAGAGATGCCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954741349_954741357 16 Left 954741349 3:52753322-52753344 CCAGGACAGGGCAGGGAGCAAGC 0: 1
1: 0
2: 4
3: 41
4: 316
Right 954741357 3:52753361-52753383 CTGTGGCCAGAGATGCCGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954741357 Original CRISPR CTGTGGCCAGAGATGCCGCT GGG Intronic
900185657 1:1331992-1332014 CTGTGTCAGGAGATGCCTCTTGG + Intronic
900418274 1:2544915-2544937 CTGTGGCCCCAGAAGTCGCTTGG - Intergenic
900995442 1:6121056-6121078 CTGAGGCCAGACATGGCACTGGG + Intronic
904914366 1:33959461-33959483 CTGAGGACAGAGAGGCTGCTGGG - Intronic
908247824 1:62241987-62242009 GTGTGGCCAGAGAGACCACTTGG + Intronic
912018374 1:105071739-105071761 GTGTAGCCAGAGATGCTGCCTGG + Intergenic
913243257 1:116848973-116848995 CTGTTGCCAGAGTTACCTCTAGG - Intergenic
915013024 1:152707789-152707811 CTGTGGAGAGAGATGCCCCTCGG - Intergenic
915458873 1:156057895-156057917 CTGGGGCCAGAGAAGCCTTTGGG + Intronic
915557442 1:156668476-156668498 CTGTGGGCAGAGATGATGATGGG + Intergenic
916015206 1:160743410-160743432 CTGTGGAAAGATATGCAGCTGGG - Intronic
916459569 1:165009421-165009443 CAGTGGCAAGAGAGGCCACTGGG - Intergenic
920404251 1:205697215-205697237 CTGGAGCCAGAGATGTGGCTGGG - Intergenic
921561119 1:216659540-216659562 CTGTGGCAAGAGATAAGGCTGGG - Intronic
1064562268 10:16604971-16604993 CTGTGGCGAGAGAGCCTGCTTGG + Intronic
1064904058 10:20326022-20326044 CTGTGGCCACACATGTCCCTAGG + Intergenic
1065094767 10:22269632-22269654 GAGTGACCAGAGATGCAGCTAGG - Intergenic
1065514069 10:26507065-26507087 CTGAGGACAGAGAGGCAGCTGGG + Intronic
1067038252 10:42934452-42934474 CTGAGGCCAGAGAGCCTGCTGGG - Intergenic
1067382389 10:45787052-45787074 CTGTGGGCAGCAAGGCCGCTGGG - Exonic
1067414908 10:46095634-46095656 CTGGTCCCAGAGATGCCGGTAGG - Intergenic
1067438808 10:46296782-46296804 CTGGGCCCAGAGATGCCGGCAGG + Intronic
1067569219 10:47359531-47359553 CTGTGGCCTGACCTGCAGCTAGG + Intergenic
1067890089 10:50127600-50127622 CTGTGGGCAGCAAGGCCGCTGGG - Exonic
1076687335 10:132204048-132204070 CTGGGGCAGGAGATGCTGCTGGG + Intronic
1076739632 10:132476931-132476953 CCCGGGTCAGAGATGCCGCTGGG + Intergenic
1077026426 11:441932-441954 CTGTGGCCGGAGTTCCAGCTGGG + Exonic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077506498 11:2932086-2932108 CTGTGGGCAGAGAAGCTGCCTGG - Intergenic
1077671979 11:4165782-4165804 CTTTGGGCAGAGCTGCCCCTGGG - Intergenic
1078540129 11:12206582-12206604 CTGAGGCTAGAGATGTGGCTGGG - Intronic
1079724838 11:23867966-23867988 CTGTGTTCAGAGATGACGGTAGG - Intergenic
1083736216 11:64682812-64682834 CTGTGACCAGAGGTGTCTCTTGG - Intronic
1084309445 11:68308214-68308236 CTGTGGTCAGAGGCGCCCCTGGG - Intergenic
1084315388 11:68342687-68342709 CTGTGCCCACAGATGTCCCTGGG + Intronic
1084512619 11:69615705-69615727 CAGGGGCCAGAGAGGCCTCTGGG + Intergenic
1084539351 11:69776404-69776426 CTGTGACCAGAGATGTCCCCAGG + Intergenic
1084693496 11:70740411-70740433 CTGTGGCCTGAGATTCCCCTAGG + Intronic
1085507123 11:77066974-77066996 CTCTGGCCGGAGATCCAGCTGGG - Exonic
1085572052 11:77568418-77568440 GTGTGTCCAAAGATGCCACTGGG + Intronic
1087169313 11:95034536-95034558 CTGTGTCCAGAGAAGATGCTTGG - Intergenic
1091038185 11:132252560-132252582 CTGAGGCCAGAGATGTAGATGGG + Intronic
1092685607 12:11041770-11041792 TTGTGGCCAGAGTTGATGCTTGG - Intronic
1093139470 12:15491132-15491154 CTGAGGCCAGAGCTGCTGTTTGG - Intronic
1094298855 12:28938616-28938638 CTGTTGCCAGAGGTGCCACATGG + Intergenic
1100793237 12:98153460-98153482 CTGTGGCCCCAGATCCCGCAGGG - Intergenic
1102180423 12:110908808-110908830 CTGTGGTCAGAGATGCAGTCCGG - Intergenic
1102908520 12:116695403-116695425 CTGTGGCTAGAGATGGCACCTGG - Intergenic
1104056395 12:125234152-125234174 CTGTGGCCAGGGATAGTGCTGGG + Intronic
1106857199 13:33866255-33866277 CTGTAGGCAGAGATGCCAATGGG + Intronic
1111217500 13:85163419-85163441 CAGTGGCCAGAGATGTTTCTGGG + Intergenic
1113932891 13:113977571-113977593 CTGTCACCAGAGATGTCACTTGG + Intergenic
1114076277 14:19162882-19162904 CTGTGGCCAGAAGTGCACCTGGG + Intergenic
1114085887 14:19236687-19236709 CTGTGGCCAGAAGTGCACCTGGG - Intergenic
1114412810 14:22516655-22516677 ATATGGCCAGAGATCCTGCTGGG - Intergenic
1117543314 14:56769679-56769701 CTGTAGCCAGAGATGAGGCCAGG - Intergenic
1119620182 14:76126001-76126023 GTGAGGCCACAGATGCTGCTGGG - Intergenic
1120827644 14:88969915-88969937 CAGTGGCCAGAGCTGGGGCTTGG - Intergenic
1121757042 14:96411902-96411924 CCATGGTCAGAGATGCCACTGGG + Intronic
1122004432 14:98690328-98690350 CTTTTGCCAGAGATGCCCATTGG + Intergenic
1122781410 14:104145394-104145416 CTGAGGCCTGGGATGCTGCTGGG - Intronic
1123049293 14:105532851-105532873 GTGTGGACGGAGATGCAGCTGGG + Intergenic
1202897444 14_GL000194v1_random:18399-18421 CTGTGGCCAGAAGTGCACCTGGG - Intergenic
1125489711 15:40137378-40137400 CTCAGGCCAGAGACGCCACTTGG + Intergenic
1127910642 15:63413294-63413316 CTGGGTCCAGAGATGTCGCTAGG - Intergenic
1128531547 15:68452910-68452932 CTGTGGTCAGAGAAGATGCTTGG - Intergenic
1128697581 15:69780124-69780146 TCGAGGCCAGGGATGCCGCTAGG + Intergenic
1129110989 15:73336968-73336990 CTGTGGCCAGAGATGGCTTTGGG - Intronic
1129843691 15:78758626-78758648 CTGTGCCCAGAGATAGGGCTGGG - Intergenic
1130258112 15:82335174-82335196 CTGTGCCCAGAGATAGGGCTGGG + Intergenic
1130596819 15:85254788-85254810 CTGTGCCCAGAGATAGGGCTGGG - Intergenic
1132735396 16:1383562-1383584 CTGTGGCCTAAGTGGCCGCTGGG + Intronic
1132829327 16:1919722-1919744 CTCTGGCCAGGGCTGCTGCTGGG - Intergenic
1136140276 16:28283876-28283898 CTGAGGCCAGAGAAGACCCTGGG - Intergenic
1138271891 16:55701631-55701653 CTGTGGTCAGACATGGGGCTAGG - Intronic
1142237334 16:88928387-88928409 GTGTGGCCACAGAGGCAGCTTGG - Intronic
1142489200 17:266964-266986 GTGAGGCCAGAGATGAAGCTTGG - Intronic
1143096446 17:4480883-4480905 CCGTGGCCAAAGATGCCTTTTGG + Intronic
1143525142 17:7467438-7467460 CTGTGGCCAGAGAGGACACCTGG + Intronic
1144495882 17:15744501-15744523 CAGTGGCCAGAGCTGCAGCCTGG - Intronic
1145209001 17:20999463-20999485 CAGTGGCCAGAGCTGCAGCCTGG - Intergenic
1145816591 17:27799192-27799214 CTGTGGCCAGTGATGAAGCCTGG - Intronic
1145867886 17:28252449-28252471 CTGAGGGAGGAGATGCCGCTGGG - Intergenic
1148070470 17:44905816-44905838 CTGTGCCCAGAGATGGGACTGGG - Intronic
1150078723 17:62217161-62217183 CTGTGTCCAGAGATACCCCTTGG + Intergenic
1151954349 17:77373165-77373187 CTGGGGCCCGAGTGGCCGCTGGG - Intronic
1152786148 17:82249087-82249109 CTGTGGCCAGAGAGGACCCTGGG + Intronic
1153740134 18:8116526-8116548 CACTGGCCAGAGGTGCTGCTGGG - Intronic
1153767642 18:8389391-8389413 CTGTGGTCACAGCTGCCTCTGGG - Intronic
1155563343 18:27104493-27104515 CTCAGGCAAGAGATGCTGCTGGG + Intronic
1157822602 18:50784644-50784666 CTGTGGCCAGAGATACAGGAGGG + Intergenic
1158292928 18:55962172-55962194 ATGTGGCCAGAAATTCCACTGGG + Intergenic
1158418983 18:57275823-57275845 CTGTAGCCCCAGATGCCTCTTGG - Intergenic
1160695773 19:483626-483648 GTGGGGGCAGGGATGCCGCTAGG + Intergenic
1160811623 19:1015337-1015359 GTGAGGCCAGGGATGCTGCTCGG + Intronic
1161202701 19:3024846-3024868 CTGAGGCCAGGCATCCCGCTGGG - Intronic
1161592438 19:5134912-5134934 GTGAGGCCAGAGAGGCTGCTGGG + Intronic
1162798716 19:13099516-13099538 CTGCGGCCAGAGCTGCGGCTTGG + Exonic
1163007964 19:14408142-14408164 CTGTGGCCACAGGAGCTGCTGGG - Exonic
1163729196 19:18940079-18940101 CTTTGACCACAGAGGCCGCTGGG - Intronic
1163777601 19:19227337-19227359 CTGTGGCCTGAGATGCTGGGTGG - Exonic
1163953323 19:20611710-20611732 CTGTGGCCCCAGGTGCCACTGGG + Intronic
1166042573 19:40212782-40212804 CTGGGTCCAGAGAAGCCACTTGG - Intronic
1166691085 19:44821424-44821446 CTGTGGCCAGAGCTTCCTCTGGG + Intergenic
1167264489 19:48476981-48477003 CTTTGGTCAGAGATGTCCCTGGG - Intronic
1168650415 19:58088825-58088847 CTGTTGACAGGGATGCTGCTGGG - Exonic
925274087 2:2636723-2636745 ATGTGACCAGAGGTGCCCCTGGG - Intergenic
925999046 2:9315465-9315487 CTGGGGTCAGAGATGACTCTTGG + Intronic
928114239 2:28535479-28535501 GTGTGGCCAGAGGTACCACTAGG - Intronic
928536946 2:32250271-32250293 CTGTCTCCAGAGAGGCCTCTTGG + Exonic
933126546 2:78615305-78615327 CTGTGTCCAGAGATGCTCTTTGG + Intergenic
933239916 2:79908851-79908873 ATGTGGGCAGAGATGCCCCGAGG - Intronic
935034634 2:99357758-99357780 ATGTTGCCAGAGATGCCTTTGGG + Intronic
936965741 2:118126085-118126107 CTTTGGACAGAGAGGCAGCTTGG - Intergenic
938319541 2:130354014-130354036 CTGTGGCCAGAGAGACACCTGGG + Intergenic
940398817 2:153222899-153222921 CTGGGTCCAGAGAGGCGGCTGGG + Intergenic
942600587 2:177636965-177636987 CTGCTACCAGAGATGCTGCTGGG - Intronic
1169113774 20:3049478-3049500 CTCTGGCCAGAGTTGATGCTGGG - Intergenic
1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG + Intergenic
1173250750 20:41363074-41363096 GTGAGGCCAGTGATGCCCCTGGG - Intronic
1173619274 20:44424230-44424252 CTGTTGCAGGAGATGCTGCTGGG + Exonic
1173877094 20:46380066-46380088 CTGTGAGCAGAGTTGCCTCTAGG - Intronic
1174190707 20:48738495-48738517 CTCAGGCCTGAGATGCAGCTGGG - Intronic
1175252530 20:57618120-57618142 CTCTGCCCAGAGATGAGGCTGGG + Intronic
1175625421 20:60484974-60484996 AGGTGGCCAGAAATGCCCCTTGG - Intergenic
1176085642 20:63294324-63294346 CAGTGCCCAGAGGTGCCACTCGG - Intronic
1176617129 21:9034388-9034410 CTGTGGCCAGAAGTGCACCTGGG - Intergenic
1176681091 21:9819707-9819729 CTGTGACCCGAGAAACCGCTGGG + Intergenic
1176684735 21:9838004-9838026 CTGTGACCAGAGAAACCGCTCGG + Intergenic
1177212909 21:18091986-18092008 ATGTGTCCAGAGATGCTGCCTGG - Intronic
1178921735 21:36743318-36743340 CTGGGGCCAGGGAAGCTGCTCGG + Intronic
1179433096 21:41338569-41338591 CTGTGGGCAGAACTGCTGCTTGG - Intronic
1180292084 22:10856506-10856528 CTGTGGCCAGAAGTGCACCTGGG + Intergenic
1180494888 22:15885928-15885950 CTGTGGCCAGAAGTGCACCTGGG + Intergenic
1181032184 22:20153943-20153965 CTGCAGCCCGAGATGCCGCCTGG - Intergenic
1181812068 22:25409442-25409464 CTGTGGTCAGAGGTGCCCCTGGG + Intergenic
1183256177 22:36763871-36763893 CAAAGGACAGAGATGCCGCTGGG + Intronic
952222031 3:31332634-31332656 CTGTGTCCAGAGATGCCATCTGG - Intergenic
953179492 3:40582821-40582843 ATTTGGCCAGAGGTGCCGATGGG - Intergenic
953704379 3:45220123-45220145 CTCTGGCCGGAGAAGCCACTAGG - Intergenic
954146112 3:48635125-48635147 CTGTGGCCCGGGATGGCCCTCGG + Intronic
954741357 3:52753361-52753383 CTGTGGCCAGAGATGCCGCTGGG + Intronic
954860048 3:53680388-53680410 ATGTGGCCAGAGGTGCCTCCTGG - Intronic
955835422 3:63049097-63049119 CTGTGGCCAGAGAAAGCCCTCGG - Intergenic
960152375 3:114263262-114263284 CTGTGGTCAGAGAAGGTGCTTGG + Intergenic
960684115 3:120280090-120280112 CTGTGACCAGAGAGGCAACTTGG - Intronic
961312427 3:126012027-126012049 CTGAGGCCAGAGAGGCCGGAAGG - Intronic
961647114 3:128398524-128398546 CTGTTGCCAGAGATTCTTCTAGG - Intronic
964018387 3:151976381-151976403 ATGAGGCCAAAGATGCCACTAGG + Intergenic
964179472 3:153865857-153865879 CTGGGTCCAGAGATGCTGTTGGG - Intergenic
965494561 3:169382143-169382165 CTGAAGCCAGTGATGCCTCTGGG + Intronic
965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG + Intronic
966175968 3:177138232-177138254 CTGTGAACAGAGATGCTGATTGG + Intronic
966850319 3:184160866-184160888 CTGTGGCCAGAGTGGCTGGTGGG + Intronic
968132444 3:196199391-196199413 TGGTGGGCAGAGATGCTGCTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
971060000 4:22957154-22957176 AAGTGGCCAGAGATGTGGCTTGG + Intergenic
972532959 4:39977283-39977305 CGGGGGCCAGAGAAGCAGCTGGG - Intronic
983869562 4:172809458-172809480 CTCTGGCCATAGATGCCCCCAGG - Exonic
987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG + Intergenic
987912783 5:24170231-24170253 CTGCGGCCGGAGATGCTGTTGGG + Intronic
989488962 5:42027879-42027901 TTGTGGCCAGAGAAGATGCTTGG + Intergenic
989772496 5:45161433-45161455 CTGTGGTCAGAGATGACAGTGGG + Intergenic
997742829 5:136272535-136272557 CTGTGGCATGAGATGACTCTTGG - Intronic
998467391 5:142356891-142356913 CTGTGGCCGGAGCCGCCGCCAGG - Intergenic
998504817 5:142664026-142664048 CAATGGCCAGAGCTGCTGCTAGG + Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999406029 5:151307774-151307796 TTGTGGTCAGAGAGGCTGCTTGG + Intergenic
999772565 5:154786572-154786594 CTGTGGACAGATAAGCTGCTGGG + Intronic
1001143946 5:169167853-169167875 CAGTGGCCAGAGACCCTGCTGGG - Intronic
1001144072 5:169168885-169168907 CAGTGGCCAGAGACCCTGCTGGG + Intronic
1001648090 5:173297095-173297117 CTCTGGCCAGAGTTCCCCCTGGG - Intergenic
1001681612 5:173561964-173561986 CTGTGGCCACAGGTACTGCTGGG + Intergenic
1002103573 5:176869128-176869150 CTTTGCCCAGACATGCCCCTGGG - Intronic
1002543116 5:179919490-179919512 CTGTGCCCAGAGACACTGCTGGG + Intronic
1002959492 6:1900697-1900719 CAGTAGCCAGAGAAGCTGCTGGG + Intronic
1003979527 6:11376958-11376980 CTGTGGCCAGAGCTGTACCTGGG - Intronic
1007108914 6:39301750-39301772 CTGTGGCCAGAGCCGCCCCCAGG - Intronic
1010489242 6:76453537-76453559 CTGTGTCCAGAGCTGTGGCTGGG + Intergenic
1011349022 6:86402077-86402099 CTGTGGCCAGAGCTGTACCTTGG + Intergenic
1014384683 6:120785995-120786017 CTGTGGCATGAGATGCCGACAGG - Intergenic
1014840729 6:126217859-126217881 GTGAGTCCAGAGATGCCACTTGG + Intergenic
1016295024 6:142564780-142564802 CTGTGGCCAGGGATGGCTCAAGG - Intergenic
1016581102 6:145629984-145630006 CTCTGGCCAGAGGTTCCCCTAGG + Intronic
1017236202 6:152119761-152119783 CTGTTGCCAGAGCAACCGCTGGG + Intronic
1018811479 6:167301229-167301251 CTGTGGCCAGAGAGCACACTGGG - Intronic
1018949057 6:168366702-168366724 GTGTGGCCAGATATGGCGCAGGG - Intergenic
1019352708 7:562413-562435 CTGTGGACAGAGATGCCTAATGG - Intronic
1019417800 7:935292-935314 CTGGAGCCAGAGATGCCGGGCGG - Intronic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1023659694 7:42459366-42459388 CTGGGGCCAGAGCTGCTGCATGG - Intergenic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1024191811 7:47019778-47019800 CTGTGGCCAGGGCTGGGGCTGGG - Intergenic
1024629848 7:51238100-51238122 CAGTGACCAGAGAGGACGCTGGG + Intronic
1029305976 7:99620315-99620337 CTTTGGACAGAGATGCCTCTGGG + Intronic
1030621445 7:111795323-111795345 CTGGGGCCAGGGATGAAGCTGGG - Intronic
1031475226 7:122212983-122213005 GTGTGGTCAGAGATGATGCTGGG - Intergenic
1033392296 7:140939657-140939679 CTGTGGCCAGTGATTTGGCTGGG + Intergenic
1034240888 7:149609877-149609899 CTGTGGACAGAGATGCTGGTGGG - Intergenic
1035337019 7:158136244-158136266 ATGTGGCCAGAGGTGCCACACGG + Intronic
1035393222 7:158519111-158519133 GTGTGGCCTGAGATGCTGCACGG - Intronic
1035731915 8:1859700-1859722 CTGTGCCCAGAGGTGATGCTGGG + Intronic
1037466054 8:19161781-19161803 CTGTGGCCAGAGAGGCAGAAGGG + Intergenic
1037753663 8:21698123-21698145 CTGGAGCCACAGATGCCTCTAGG - Intronic
1037902082 8:22694359-22694381 CTGTGGCCACAGAGGCTGCTTGG - Intergenic
1039152041 8:34517165-34517187 CTGTGCCCAGAGAGGACCCTTGG + Intergenic
1042082266 8:65067978-65068000 CTGTGGTCAGAGAAGAAGCTTGG + Intergenic
1042872776 8:73413162-73413184 CTGTGGCCCCAAATGCCTCTTGG - Intergenic
1044477607 8:92646608-92646630 CAGAGGCCAGAGATGCTGCCAGG + Intergenic
1048252174 8:132875881-132875903 CTGTGCCCAGAGAAGTCACTGGG - Intronic
1049176644 8:141196949-141196971 TTGTGGCCAGATGTGCAGCTAGG - Intergenic
1050248249 9:3714229-3714251 GTGTGTCCAGAGATGCAGCCTGG - Intergenic
1051507100 9:17839329-17839351 CTGTGGTCAAATATGCAGCTTGG - Intergenic
1052534718 9:29732254-29732276 CAATGGCCAGAGAAGCCCCTGGG - Intergenic
1053644966 9:40114774-40114796 CTGTGGCCAGAAGTGCTCCTGGG + Intergenic
1053760754 9:41348754-41348776 CTGTGGCCAGAAGTGCTCCTGGG - Intergenic
1054325986 9:63712672-63712694 CTGTGGCCAGAAGTGCTCCTGGG + Intergenic
1054539609 9:66261195-66261217 CTGTGGCCAGAAGTGCTCCTGGG - Intergenic
1056790142 9:89619994-89620016 CTGTGGCCAGGGATGAGGCCAGG + Intergenic
1061825978 9:133258445-133258467 CTGTGGGCAGAGAGGAGGCTGGG + Intronic
1062609407 9:137367257-137367279 CTGGGGCCAGAGAGGGCTCTTGG - Intronic
1062720165 9:138037281-138037303 CAGAGGCCAGGGATGCTGCTAGG - Intronic
1203665968 Un_KI270754v1:20838-20860 CTGTGACCGGAGAACCCGCTGGG + Intergenic
1203666547 Un_KI270754v1:23654-23676 CTGTGACCCGAGAAACCGCTGGG + Intergenic
1203667114 Un_KI270754v1:26477-26499 CTGTGACCCGAGAAACCGCTGGG + Intergenic
1203667696 Un_KI270754v1:29293-29315 CTGTGACCCGAGAAACCGCTGGG + Intergenic
1203668262 Un_KI270754v1:32116-32138 CTGTGACCCGAGAAACCGCTGGG + Intergenic
1203668840 Un_KI270754v1:34932-34954 CTGTGACCGGAGAAACCGCTGGG + Intergenic
1203669116 Un_KI270754v1:36342-36364 CTGTGACCGGAGAAACCGCTGGG + Intergenic
1203669688 Un_KI270754v1:39158-39180 CTGTGACCGGAGAAACCGCTGGG + Intergenic
1189281334 X:39821694-39821716 TTGTGGTCAGAGATGCCTCGGGG + Intergenic
1191122601 X:56921742-56921764 CTGTGGCCTGAGATGTATCTCGG - Intergenic
1192680422 X:73248104-73248126 CCATGGCCTGAGATGTCGCTTGG - Intergenic
1194443103 X:93956821-93956843 CTGTGGTCAGAGAAAACGCTTGG + Intergenic
1194867467 X:99086345-99086367 GGGTGGCCAGAGATGCTGGTTGG - Intergenic
1195306138 X:103585743-103585765 GTGTGGACAGAGATGGCGGTGGG + Intronic
1201150521 Y:11093221-11093243 CTGTGGCCAGAAGTGCACCTGGG - Intergenic