ID: 954741407

View in Genome Browser
Species Human (GRCh38)
Location 3:52753836-52753858
Sequence TGGTTTGGACTAATATTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954741406_954741407 -9 Left 954741406 3:52753822-52753844 CCTCTGTATTAAAGTGGTTTGGA 0: 1
1: 0
2: 8
3: 19
4: 145
Right 954741407 3:52753836-52753858 TGGTTTGGACTAATATTCATAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954741402_954741407 1 Left 954741402 3:52753812-52753834 CCATCTTATCCCTCTGTATTAAA 0: 1
1: 0
2: 1
3: 22
4: 287
Right 954741407 3:52753836-52753858 TGGTTTGGACTAATATTCATAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954741404_954741407 -8 Left 954741404 3:52753821-52753843 CCCTCTGTATTAAAGTGGTTTGG 0: 1
1: 0
2: 1
3: 8
4: 131
Right 954741407 3:52753836-52753858 TGGTTTGGACTAATATTCATAGG 0: 1
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954741407 Original CRISPR TGGTTTGGACTAATATTCAT AGG Intronic
901148342 1:7083555-7083577 TGGGTTGGACTATTTATCATGGG + Intronic
904846514 1:33422597-33422619 TGGTTTGGAATAATATAAGTAGG - Intronic
905725503 1:40247810-40247832 TGGTTTTGAGTAAGATTCATTGG + Intronic
906936099 1:50215135-50215157 TGGTTTGGGATAGTATTTATGGG - Intergenic
913281813 1:117192073-117192095 TGTCTTGGAGTAATATTCTTTGG - Intronic
920664251 1:207949338-207949360 TAGTTTGGACTAGAATTCTTAGG - Intergenic
924897230 1:248353561-248353583 TGGTATGGCCTAGTATTCCTAGG + Intergenic
1063606933 10:7530881-7530903 TTGATTGGACAAATATTGATGGG + Intergenic
1066202628 10:33156895-33156917 TGGTATAGACTAATGTTTATGGG - Intergenic
1071385512 10:85116176-85116198 TGATTATCACTAATATTCATAGG - Intergenic
1072299391 10:94044626-94044648 TGGTTTGGACTGAGCCTCATGGG + Intronic
1072309525 10:94141227-94141249 TGGTATGGAGTCATATTCTTAGG - Intronic
1089718380 11:120386777-120386799 TTGTTTGGACTAATGTGCATAGG - Intronic
1094459528 12:30679467-30679489 TGTTTTGAAATAATATTCAGAGG - Intronic
1097814598 12:64058457-64058479 TGATTTAGACTAATATCTATTGG + Intronic
1099293628 12:80803191-80803213 TGGTTTGGGCAAAGATTTATTGG - Intronic
1099451142 12:82808001-82808023 TGATTTGGACAAATTTTAATTGG + Intronic
1099491181 12:83290545-83290567 TAGTCTGGACAAATATTCAGTGG - Intergenic
1100256119 12:92884828-92884850 TGTTTTAGACAAATACTCATGGG + Intronic
1101975757 12:109357016-109357038 CAGTTTGGAATAATATTCAGTGG - Intronic
1108902785 13:55434134-55434156 TGGTATGGACAAATATTTTTAGG - Intergenic
1108925195 13:55733887-55733909 TTGTTTGGAATAATTTTAATAGG - Intergenic
1110076601 13:71253188-71253210 TGGTTAGGAAAAATAGTCATTGG - Intergenic
1111402125 13:87752361-87752383 TGGTTTGAAATAATATTGACTGG + Intergenic
1111473419 13:88717015-88717037 TAGTCTGGACTAAAATTCTTAGG + Intergenic
1111713534 13:91848313-91848335 TTGTTTGAAGTAATATTTATTGG + Intronic
1112452811 13:99527183-99527205 TGGTGGTGACTAATATTCAGAGG + Intronic
1114838288 14:26231053-26231075 TGGTTTGGACACAAATTAATTGG + Intergenic
1123691999 15:22845965-22845987 AGGTTAGGAATAATGTTCATTGG + Intronic
1130850921 15:87792912-87792934 TGGTGGAGACTAAGATTCATAGG + Intergenic
1131753838 15:95539048-95539070 TGGTTTGTATTATTACTCATAGG - Intergenic
1135924288 16:26678732-26678754 TTGTTTAGGCTAATTTTCATTGG + Intergenic
1143816657 17:9521785-9521807 TGTTCTGGACTAATACTCAATGG - Intronic
1146859111 17:36281091-36281113 TGGTTTTGAATAATATTGAGGGG + Intronic
1147089433 17:38085178-38085200 TGGTTTTGAATAATATTGAGGGG + Intergenic
1147107778 17:38235341-38235363 TGGTTTTGAATAATATTGAGGGG - Intergenic
1148421613 17:47552502-47552524 TGGTTTTGAGTAATATTGAGGGG + Intronic
1149321934 17:55490348-55490370 TGGTTTGGACTGACAGCCATGGG + Intergenic
1153258058 18:3192894-3192916 TGGTTTTAATTATTATTCATTGG - Intronic
1155427625 18:25723080-25723102 TTATTTGGGCTAATATTCAAAGG + Intergenic
1159487943 18:69090677-69090699 TGGTTTGGCTAAATAGTCATAGG - Intergenic
1162427848 19:10607669-10607691 TTGTTTTGCCTAATATACATTGG + Intronic
1165561527 19:36684666-36684688 TGGTTTGGACATAAATTAATAGG + Intergenic
926019955 2:9486078-9486100 TGGTATGGATTAATATTTAGGGG - Intronic
926852092 2:17210201-17210223 TGGTTTGGACAAAGATTTTTTGG - Intergenic
930676723 2:54209507-54209529 TTGTTTGGACTCATTTTCTTTGG + Intronic
932287409 2:70548346-70548368 TGGTTTGGATTAATGTTGATTGG - Intronic
936283509 2:111162821-111162843 TAGTGTAGACTAATATTAATAGG - Intronic
940209676 2:151243568-151243590 TGGTTTGAAATAAAATTTATAGG + Intergenic
942726999 2:179020658-179020680 TGGTATGGACTCATTTTCACAGG - Intronic
943938730 2:193962074-193962096 TTGTTTGTGCTGATATTCATAGG - Intergenic
945261605 2:207848871-207848893 GGGCTTGGACTAAGTTTCATGGG + Intronic
946610391 2:221451555-221451577 TGGTTTGAAATAAAATTTATAGG + Intronic
947203140 2:227634522-227634544 GGGTTTGGACTAAAAATCTTAGG - Intergenic
1177330325 21:19651679-19651701 TTGTTTGGTGAAATATTCATTGG - Intergenic
1177862082 21:26465916-26465938 TATTTTGGGCTAATATTTATTGG + Intergenic
1182778823 22:32851187-32851209 TGCTTTGGTCTAATATGCTTTGG - Intronic
951475865 3:23105409-23105431 TGGCTTTGACTAAGGTTCATTGG + Intergenic
954741407 3:52753836-52753858 TGGTTTGGACTAATATTCATAGG + Intronic
957508441 3:81155851-81155873 TGCTTTGGACGTTTATTCATGGG - Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
962511828 3:136108843-136108865 TGGCTTGGTCTAAAATTCTTGGG - Intronic
963598966 3:147360879-147360901 TGTTATGGACTAAAATTCCTAGG + Intergenic
964103104 3:153010141-153010163 TGTTTTGGGCCAATATTCTTTGG - Intergenic
965048211 3:163607291-163607313 TGGTGTGAACTATTGTTCATAGG + Intergenic
971980244 4:33742090-33742112 GGGTTTTAACTAATTTTCATTGG - Intergenic
972448610 4:39172684-39172706 TGGTTTAGACAATTATTTATTGG - Intergenic
973337731 4:48973277-48973299 TGGATTGTACTAACATGCATGGG + Intergenic
980464799 4:133159503-133159525 AGGTTTGGAATAATAGACATTGG + Intronic
980970453 4:139562396-139562418 TGGTTTTGACTAGAATTCAGTGG - Intronic
983631270 4:169852203-169852225 TGGTTTGGTCTGATCATCATGGG - Intergenic
987694902 5:21315665-21315687 TGGTGTGGACAAATACTCATTGG - Intergenic
988376622 5:30443624-30443646 TGGTTTGGGCAAAAATTTATTGG + Intergenic
989851069 5:46211234-46211256 TGTTTTGGTATAATATGCATAGG + Intergenic
991745326 5:69733776-69733798 TGGTATGGACAAATACTCATCGG + Intergenic
991752381 5:69821450-69821472 TGGTATGGACAAATACTCATCGG - Intergenic
991796894 5:70313505-70313527 TGGTATGGACAAATACTCATCGG + Intergenic
991824703 5:70609090-70609112 TGGTATGGACAAATACTCATCGG + Intergenic
991831699 5:70696574-70696596 TGGTATGGACAAATACTCATCGG - Intergenic
991889272 5:71313061-71313083 TGGTATGGACAAATACTCATCGG + Intergenic
993850215 5:92999275-92999297 TGGGCTGGACTAAAATTAATTGG - Intergenic
994991917 5:107007718-107007740 TGGTTTGGAGTAATATAGTTTGG - Intergenic
998754148 5:145357920-145357942 TTTTTTGGATTAATATTCTTTGG + Intergenic
998987823 5:147781694-147781716 TGGTTTATATTATTATTCATTGG - Intronic
999505489 5:152190737-152190759 TGGTTTAGCCTATTATTCCTAGG - Intergenic
1005555996 6:26984265-26984287 TGGTATGGACAAATACTCACTGG + Intergenic
1007869321 6:45015256-45015278 TGGTGCGGCCTACTATTCATGGG + Intronic
1010005154 6:70987306-70987328 TGGTTTTAACTAATATTAGTAGG + Intergenic
1010103061 6:72132458-72132480 ATTTTTGGACTAATATTTATTGG + Intronic
1011613099 6:89172467-89172489 TGTTTTGGAATGACATTCATCGG + Intergenic
1011945774 6:92900927-92900949 TGGTTTGGGCCCAGATTCATAGG + Intergenic
1012107934 6:95189689-95189711 TGCTTGTGACTAATATTCAATGG - Intergenic
1014107151 6:117579494-117579516 TGATTTGGGCTAGTATTCGTTGG - Intronic
1014197135 6:118573822-118573844 TCATTTGAATTAATATTCATGGG - Intronic
1023751679 7:43379021-43379043 TGTGTTGGACTAATAGGCATAGG + Intronic
1024613470 7:51086916-51086938 TGGTTTTGACTCATCTTTATGGG - Intronic
1024902564 7:54337293-54337315 TGGTTGGGTCTCATATTAATTGG + Intergenic
1026389667 7:69887839-69887861 TGTTTAGAACTAACATTCATTGG + Intronic
1026524664 7:71143625-71143647 TGGTTTGGACTTAATTGCATAGG + Intronic
1027521227 7:79211066-79211088 TGATGTGGAAGAATATTCATTGG + Intronic
1030391677 7:108936009-108936031 TGGTTTGGACAAAGATTTTTGGG + Intergenic
1034826280 7:154266630-154266652 TGTTTTTGACTGAAATTCATTGG + Intronic
1038098862 8:24349319-24349341 TGGTTTGAACAAATATTCCTGGG - Intronic
1041779763 8:61564712-61564734 TCAGTTAGACTAATATTCATAGG - Intronic
1045350979 8:101339311-101339333 GGGTTTGGACAAATGTTCAATGG + Intergenic
1045962670 8:107987008-107987030 TTGTTTGGATTAATATTTAAAGG - Intronic
1047126215 8:121964125-121964147 CTGTTTGGACTAATCTTCAAGGG - Intergenic
1048061238 8:130921390-130921412 TGGTTTACATTAATATTCAATGG - Intronic
1051907195 9:22108903-22108925 TGGTTTGGTCTGATGTTCAAAGG - Intergenic
1052643865 9:31206384-31206406 TGGGTTTGAATTATATTCATGGG + Intergenic
1054790369 9:69251078-69251100 GGGGTTTGACTTATATTCATAGG - Exonic
1055802589 9:80056518-80056540 TGGTTTGGACAAAGATTTGTTGG + Intergenic
1057604417 9:96489005-96489027 TGGTATGGACACTTATTCATTGG + Intronic
1058086259 9:100751827-100751849 TTTTTTGGATCAATATTCATCGG + Intergenic
1059617754 9:115969074-115969096 AGTATTGGACTAATATACATAGG - Intergenic
1189354000 X:40297948-40297970 TGGCTTGGACTGATCCTCATTGG + Intergenic
1194024103 X:88730080-88730102 TTTTTTGCACCAATATTCATTGG - Intergenic
1195055794 X:101143367-101143389 TGGATTGAACTAATACCCATAGG + Intronic
1197115780 X:122831753-122831775 TGGTTTGGATTAATTATCAGAGG + Intergenic
1197295203 X:124710454-124710476 TGGTTTGGTATAATATTAAGAGG + Intronic
1197514830 X:127413439-127413461 GGTTTTGTATTAATATTCATCGG - Intergenic
1198242251 X:134797408-134797430 GAGTTTGGGCCAATATTCATGGG + Intronic
1202086751 Y:21146063-21146085 TGGTTTGGATTCAAAATCATAGG + Intergenic
1202107731 Y:21387803-21387825 GGGTTTGGGATAATATGCATGGG - Intergenic