ID: 954749544

View in Genome Browser
Species Human (GRCh38)
Location 3:52805894-52805916
Sequence AGCCACGGTGGAGGGACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954749544_954749555 24 Left 954749544 3:52805894-52805916 CCACATGTCCCTCCACCGTGGCT 0: 1
1: 0
2: 2
3: 10
4: 209
Right 954749555 3:52805941-52805963 CAGATGGACAATGTGCCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 176
954749544_954749551 0 Left 954749544 3:52805894-52805916 CCACATGTCCCTCCACCGTGGCT 0: 1
1: 0
2: 2
3: 10
4: 209
Right 954749551 3:52805917-52805939 ACTCACTCAGCTCTCCGGGATGG 0: 1
1: 0
2: 0
3: 12
4: 140
954749544_954749550 -4 Left 954749544 3:52805894-52805916 CCACATGTCCCTCCACCGTGGCT 0: 1
1: 0
2: 2
3: 10
4: 209
Right 954749550 3:52805913-52805935 GGCTACTCACTCAGCTCTCCGGG 0: 1
1: 0
2: 3
3: 16
4: 199
954749544_954749553 8 Left 954749544 3:52805894-52805916 CCACATGTCCCTCCACCGTGGCT 0: 1
1: 0
2: 2
3: 10
4: 209
Right 954749553 3:52805925-52805947 AGCTCTCCGGGATGGGCAGATGG 0: 1
1: 0
2: 2
3: 20
4: 167
954749544_954749549 -5 Left 954749544 3:52805894-52805916 CCACATGTCCCTCCACCGTGGCT 0: 1
1: 0
2: 2
3: 10
4: 209
Right 954749549 3:52805912-52805934 TGGCTACTCACTCAGCTCTCCGG 0: 1
1: 0
2: 1
3: 11
4: 162
954749544_954749552 1 Left 954749544 3:52805894-52805916 CCACATGTCCCTCCACCGTGGCT 0: 1
1: 0
2: 2
3: 10
4: 209
Right 954749552 3:52805918-52805940 CTCACTCAGCTCTCCGGGATGGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954749544 Original CRISPR AGCCACGGTGGAGGGACATG TGG (reversed) Intronic
900810517 1:4798316-4798338 AGGCAGGCTGGAGGGACATGTGG + Intergenic
901764488 1:11491162-11491184 AGCCACGGTGGAGGGATGTGGGG + Intronic
902684951 1:18070331-18070353 GGCCAGGGTGGAGGGTCTTGAGG + Intergenic
904560798 1:31395924-31395946 AGCCATGGTGGAGCCGCATGTGG - Intergenic
904616179 1:31751108-31751130 AGCCCTGGTGGAGGGAGACGGGG - Intronic
907037728 1:51230949-51230971 AGCCACGTGGGAGGAAGATGCGG + Intergenic
912063279 1:105701203-105701225 AGCCAAATTGGAGGAACATGAGG - Intergenic
912706652 1:111919919-111919941 AGCCTGGATGGAGGGAGATGGGG + Intronic
915358743 1:155273055-155273077 AGCGACGGAGTAGGGAGATGAGG - Intronic
918437875 1:184534985-184535007 AGGCATGGTGGGGGGACTTGAGG + Intronic
920394166 1:205631810-205631832 AGCCGCGGCGGCGGGAGATGCGG - Exonic
920903714 1:210138195-210138217 AACCATGGTGGAGGCAAATGAGG + Intronic
921177481 1:212607545-212607567 AGCCAGGGTGGCGGGAAAGGCGG - Intronic
922316826 1:224449828-224449850 AGCCACAGGTGAGGGACTTGAGG - Intronic
923070335 1:230558565-230558587 AGGCAAGGTGGAGGGACAACAGG - Intergenic
1062999374 10:1900165-1900187 AGCCAGGCTGGGGGGAGATGGGG + Intergenic
1063088346 10:2839511-2839533 AGCCAGGATGGAGTGACACGGGG + Intergenic
1066067633 10:31773790-31773812 AGCCATGACGGAGGGAAATGGGG + Intergenic
1066648324 10:37633506-37633528 ACCCACCGAGGAGGCACATGTGG - Intergenic
1067850897 10:49752852-49752874 AGCCGCGGGGCAGAGACATGGGG - Intronic
1068963097 10:62885151-62885173 AGCCACGGTGTCCGGACAAGTGG - Intronic
1069836043 10:71308727-71308749 AGTCACTGTGGAGGGACTTCTGG - Intergenic
1070284630 10:75073819-75073841 AGCCACAGAGGCAGGACATGTGG + Intergenic
1071682361 10:87718863-87718885 AGCCACACTGGAGCCACATGAGG - Intronic
1072969515 10:100005176-100005198 AGCCACTGTGGAGAGGCATCTGG + Intronic
1075467545 10:122662961-122662983 AGCCAGTGTGGAGGGAAAGGGGG - Intergenic
1075649465 10:124118247-124118269 AGCCAGGGTGGAGGGCCACAGGG - Intergenic
1079089871 11:17473407-17473429 AGCCAGGATGCAGGGACATTGGG + Intronic
1079916802 11:26379119-26379141 AGCCACCCTGGAAAGACATGGGG + Intronic
1080832187 11:35905384-35905406 AGCGACAGTGAGGGGACATGAGG + Intergenic
1081816209 11:45944552-45944574 GGCCAGGGTGGTGGGAAATGAGG - Intronic
1083274395 11:61588456-61588478 CGGCAGGGTGGAGGGACAGGTGG + Intergenic
1084500151 11:69530492-69530514 AGCCATGGGGGAGGGGCCTGGGG + Intergenic
1088986096 11:114909895-114909917 AGGCAAGGAGGAGGGAGATGTGG - Intergenic
1089169637 11:116503059-116503081 AGGCACGGGGCAGGGACAGGTGG - Intergenic
1089862755 11:121604579-121604601 AGCCATGGTGTATGGGCATGAGG - Intronic
1090126163 11:124087121-124087143 AGCCACGGAAGAAGGACCTGTGG - Intergenic
1090523218 11:127501068-127501090 AGTCATGGTGGAGGGTCAAGGGG - Intergenic
1090889421 11:130910182-130910204 AGCCAAGGTGGAGAGATTTGGGG - Intronic
1091348690 11:134874959-134874981 AGCCACTGTGGGTGGAGATGTGG - Intergenic
1091496432 12:977227-977249 TGCCAAGGGGGAGGGACAAGAGG - Intronic
1092721012 12:11440556-11440578 AACCATGGTGGAGGGACAGCAGG + Intronic
1096625489 12:52892881-52892903 AGGCAGGGTGGAGGGAAGTGGGG + Intergenic
1097084030 12:56454355-56454377 AGGCACGGAGCAGGGACATCTGG + Exonic
1097233548 12:57525889-57525911 CCCCACGGTGGAGGGGCCTGGGG + Exonic
1098299787 12:69042725-69042747 AGCCTTGGAGGAGCGACATGTGG + Intergenic
1099529213 12:83755546-83755568 AGCCAAGGTGGAAGGACAAAAGG + Intergenic
1101613927 12:106317691-106317713 AATTACAGTGGAGGGACATGTGG + Intronic
1104917380 12:132272858-132272880 AGCCACGGGGAAGGCACACGAGG - Intronic
1106405284 13:29468001-29468023 AGCATCGGTGGTGGGAGATGAGG + Intronic
1111008492 13:82281463-82281485 AGGCAGTGTGGAGGGAAATGTGG - Intergenic
1113599667 13:111559700-111559722 CCCCACGGTGCAGGAACATGGGG - Intergenic
1114713770 14:24804067-24804089 AGCCACCATGGAGGGTCATGGGG + Intergenic
1117965538 14:61203433-61203455 AGGCATGGTGGAGGGGCTTGGGG + Intronic
1122549493 14:102542284-102542306 AGCCACTGTGCTGGGCCATGTGG + Intergenic
1126553154 15:49954742-49954764 AGCCACTGTGGAGAGCCATTTGG + Intronic
1128650259 15:69406755-69406777 AGCTACTGTGGAGGGTGATGTGG + Exonic
1128913574 15:71539178-71539200 AGCCACAGAGGTGGGAAATGAGG - Intronic
1129150610 15:73685211-73685233 GGCGACGGTGGAGGGAGGTGGGG + Intronic
1129521011 15:76186300-76186322 AAACACTGTGGAGGCACATGTGG + Intronic
1132567913 16:631625-631647 CCCCAGGGTGGAGGCACATGGGG - Intronic
1132938905 16:2497283-2497305 AGCCACAGACGAGGGACATCGGG + Intronic
1133597187 16:7304138-7304160 AGCCAGGGAGGAGGGACCGGCGG + Intronic
1134108609 16:11500872-11500894 AGCCGCGGTGGAGGCAGACGAGG - Exonic
1134598016 16:15511294-15511316 AGACACAGTGGAGGGAGAGGAGG - Intronic
1135415611 16:22266284-22266306 AGCCTGGCTGGAGGGAGATGGGG - Intronic
1135576639 16:23591092-23591114 GGCCATGCTGGAAGGACATGGGG - Intronic
1136346490 16:29679352-29679374 AGCAAGGCTGCAGGGACATGGGG - Intronic
1137604767 16:49780087-49780109 AGCCAGGGTAGAGGTACAGGAGG + Intronic
1137870287 16:51943769-51943791 AGCCACTGTGCAGGGACCTGTGG - Intergenic
1140876494 16:79157747-79157769 TGTCAGAGTGGAGGGACATGGGG + Intronic
1141693310 16:85608334-85608356 AGCCCCGGTGCAGGGGCAAGGGG - Intergenic
1142228907 16:88890224-88890246 AGACAGCGTGGAGGGACACGCGG - Intronic
1142239877 16:88940369-88940391 AGCCTCTGTGGAGGGACAGATGG - Intronic
1142352286 16:89585923-89585945 GGCCTCCGTGGAGGGGCATGTGG + Intronic
1142482886 17:229550-229572 AGCCACGACGGAGGGACCTCAGG + Intronic
1144705255 17:17363755-17363777 AGCCACAGGGGAGGGCCAGGCGG - Intergenic
1145280587 17:21464296-21464318 AGCCACTGTGGGGGGAGGTGGGG + Intergenic
1145979443 17:29003226-29003248 AGCCACAGTGGAGGAAAAAGCGG - Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1148680384 17:49470320-49470342 AGGCGCGGGGGAGGGACACGGGG - Intronic
1150237539 17:63605182-63605204 AGCCAAGTTGTAGGGAGATGAGG + Intronic
1150450083 17:65259383-65259405 AGCTACTCTGGAGGGAGATGGGG - Intergenic
1151630728 17:75309227-75309249 AGGCAGGGTGGAGAGACAGGAGG + Intergenic
1152696560 17:81800574-81800596 AGCCAAGGCGGAGGGACCAGGGG - Intergenic
1158078382 18:53559628-53559650 AGCCTCTGTGGAGAGACATTTGG + Intergenic
1158204233 18:54973771-54973793 AGTCAGGGTGGAGGGAGTTGGGG - Intergenic
1159618587 18:70611236-70611258 AGCAACAGTAGAAGGACATGAGG - Intergenic
1160039822 18:75335303-75335325 AACCACGGGAGAGGGAAATGTGG - Intergenic
1161013863 19:1973564-1973586 AGCCAGGGCTGAGGGACCTGGGG - Intronic
1161282986 19:3455851-3455873 AGCCCCGGTGCAGGGAAAGGGGG - Intronic
1161313894 19:3609007-3609029 GGCCATGGTGGAGAGTCATGGGG + Intergenic
1161316947 19:3621594-3621616 AGCCATGGAGGAGGAAGATGTGG - Intronic
1161586576 19:5108933-5108955 AGGCATGGGGGAGGGCCATGCGG - Intronic
1163878843 19:19900331-19900353 AGTCACAGTGGTGGGACGTGTGG - Intergenic
1164402201 19:27910072-27910094 TGCCACGGTGGAGGGGGCTGGGG - Intergenic
1165015511 19:32877424-32877446 AGGCATGCTGGAGGGACTTGGGG - Intergenic
1165421859 19:35726076-35726098 AGACACGGAGGAGGAACATGAGG - Intronic
1166151977 19:40881442-40881464 GGCCACAGTGAAGGGAGATGGGG + Intronic
1166178188 19:41089216-41089238 GGCCACGATGAAGGGAGATGGGG - Intronic
1166770735 19:45280519-45280541 TGCCTGGGTGGAGGGACTTGGGG + Intronic
1167772752 19:51531115-51531137 AGCCACAGGGGAAGGTCATGGGG - Intronic
1168291537 19:55359934-55359956 AGCCACAGGCCAGGGACATGTGG - Exonic
1168526725 19:57094441-57094463 GGCCAAGGTGGATGGACCTGAGG + Intergenic
925126187 2:1458990-1459012 AGTCACGGTGGAGGTGCCTGTGG + Intronic
925345853 2:3171330-3171352 TGCCACGGTGGACACACATGGGG - Intergenic
926373253 2:12201947-12201969 AGCCAGGATGGGGGCACATGTGG + Intergenic
927058953 2:19395742-19395764 ATCTACAGTGGAGGTACATGAGG - Intergenic
928008255 2:27582769-27582791 AGGCAGGCTGGAGGGACACGAGG + Intergenic
928146788 2:28785675-28785697 AGCCGCGGTGCTGCGACATGTGG - Intronic
928301787 2:30131726-30131748 GGCCACGGTGTAAGGGCATGGGG - Intergenic
930313412 2:49770398-49770420 AGGCACTGTGGAGGAAGATGGGG - Intergenic
934208316 2:89952246-89952268 GGCCACAGTGGAGGAACATTTGG - Intergenic
934636759 2:95996375-95996397 AAACAAGGTGGAGGGACATCAGG + Intergenic
934796895 2:97109049-97109071 AAACAAGGTGGAGGGACATCAGG - Intergenic
934836521 2:97594382-97594404 AAACAAGGTGGAGGGACATCAGG + Intergenic
935781640 2:106513740-106513762 AGCCAAGTTTGGGGGACATGGGG + Intergenic
936545283 2:113387062-113387084 AAACAAGGTGGAGGGACATCAGG - Intergenic
940042151 2:149371942-149371964 AGCCTCTGTGGAGGGGCAGGTGG - Intronic
942141379 2:172980523-172980545 AGCCAAGGGGGAGGAGCATGGGG + Intronic
943061805 2:183047629-183047651 AGCCAAAGTGCAGGGCCATGTGG + Intergenic
945991834 2:216402503-216402525 AGGCAGGGTAGAGGGACGTGGGG + Intergenic
947973141 2:234341591-234341613 AGACAGAGTGGAGAGACATGTGG + Intergenic
1171095853 20:22331843-22331865 AGGCAGGGTTGAGGGCCATGAGG - Intergenic
1175020779 20:55846617-55846639 GGCCTCTGGGGAGGGACATGTGG - Intergenic
1179822406 21:43944323-43944345 GCCCACGGGGGAGGGACGTGTGG - Intronic
1179959206 21:44758859-44758881 AGCCCAGGTGGAGGAACATCAGG + Intergenic
1179991392 21:44949859-44949881 ACCTGCGGTGGAGGGACCTGCGG + Intronic
1180029927 21:45200121-45200143 AGCCACCTTGGAGGGCCAGGTGG + Intronic
1184730782 22:46369873-46369895 AGCCAGGGTGGGGTGAAATGGGG + Intronic
949513088 3:4783549-4783571 AGCCAGGCAGGAGGGAGATGGGG - Intronic
951132731 3:19067800-19067822 AGCTAAGGTGGGAGGACATGTGG + Intergenic
951674605 3:25223137-25223159 ATCCACTGAGAAGGGACATGAGG - Intronic
954649694 3:52153676-52153698 AACCACTGTTGAGGGAGATGAGG - Intronic
954749544 3:52805894-52805916 AGCCACGGTGGAGGGACATGTGG - Intronic
954751119 3:52814208-52814230 AGCCACGTTGGAGGGACCCTTGG - Exonic
959777759 3:110188675-110188697 AGCCACGGAGAAGGGAATTGTGG - Intergenic
961390047 3:126547092-126547114 AGGCACGGTGGAGGTGCATTGGG - Intronic
961391047 3:126552604-126552626 AGCCACGCTCGAGGGAGGTGGGG - Intronic
962520816 3:136196115-136196137 AGGCACGGGGGAGGGGCCTGCGG - Intronic
963102962 3:141623311-141623333 AGGCAGGGTGGAGGGACAGAGGG - Intergenic
963786218 3:149536840-149536862 AGCCCCCGTGAAGGGACAAGGGG + Intronic
964491757 3:157243567-157243589 TGCCTCTGTGGAGGGGCATGAGG + Intergenic
964618909 3:158700884-158700906 AAGCAGGGTGGAGGGGCATGGGG - Intronic
965517188 3:169634055-169634077 AGCCACAGTGCAGGGACAGCAGG + Intronic
966855757 3:184193003-184193025 AGCCTAGATGGAAGGACATGGGG + Intronic
968614864 4:1572847-1572869 AGCCACTGTGGAGGCAGGTGAGG + Intergenic
969614177 4:8242684-8242706 AGCCAGGGTGGGTGGAAATGGGG - Intergenic
970566098 4:17334076-17334098 AGGCAGGATGGAGGGAAATGGGG - Intergenic
971470783 4:27023843-27023865 AGCCGAGGTGGGGGGATATGGGG + Exonic
972103736 4:35455981-35456003 AGCCACTGTGGAAAGACATTTGG - Intergenic
977785728 4:101032457-101032479 AGCCAAGATAGAGGGAAATGTGG - Intronic
978115539 4:105015993-105016015 AGCCACTGTGGAGGTATATAAGG - Intergenic
981309919 4:143287722-143287744 AACAAGGGAGGAGGGACATGGGG - Intergenic
985194519 4:187414248-187414270 AGCCCCTGGGGAGGAACATGAGG - Intergenic
985366780 4:189239435-189239457 AGCCACTGTGGAGGGAAGTTTGG - Intergenic
985606731 5:861974-861996 AGCCACGGTGGAGGGAGCAGGGG - Intronic
985699583 5:1362417-1362439 AGCCACGTTGGACAGACATGTGG + Intergenic
985999687 5:3620648-3620670 AGCCACGGTGGGAGGGCAGGTGG + Intergenic
986064759 5:4224185-4224207 GGGCAGGGTGGAGGGACAGGAGG + Intergenic
986402365 5:7394568-7394590 AGCCAGGGAGGCGGGGCATGGGG + Intergenic
986426950 5:7642097-7642119 AGCCACTGTGGAAGGCCATGTGG - Intronic
986514546 5:8547511-8547533 AGCCATGGAGGAAGCACATGGGG + Intergenic
986734878 5:10661281-10661303 AGCCATGGTGCAGGTAAATGCGG - Intergenic
992720946 5:79560605-79560627 AGGCTCGGTGAAGGGACATGTGG + Intergenic
997197346 5:131988900-131988922 ATCCACTGTGGAGACACATGAGG + Exonic
999274613 5:150321218-150321240 GGCCACTGTGGAGGGAGGTGGGG - Intronic
999723199 5:154413742-154413764 AGCCTGGGTGGAGTGACATTGGG + Intronic
1001251316 5:170149081-170149103 AGGGACGTTGGAGGGACAAGAGG - Intergenic
1003487301 6:6590678-6590700 TGCCACTTTGGAGGGAGATGGGG + Intronic
1003815828 6:9839080-9839102 AGCCAAGGTGGTGAGAAATGAGG + Intronic
1004395640 6:15245124-15245146 AGCCGCGGGGGAGGGACGCGAGG - Intergenic
1004893907 6:20128083-20128105 AGCCATGGTGGAGGGGCGGGGGG - Intronic
1005854201 6:29848150-29848172 AGGCACAGAGGAGGGACAGGTGG + Intergenic
1005997573 6:30940723-30940745 AGCCCCAGTGGAGGGAAGTGAGG - Intergenic
1006396876 6:33793368-33793390 ACCCACCATGGAGGGACATGGGG - Intergenic
1008324823 6:50165467-50165489 AGCCACTGTGGAAGGAAATATGG - Intergenic
1010892700 6:81334041-81334063 AGCCACGGTGGATGGAACAGAGG + Intergenic
1013664711 6:112335564-112335586 GGCCAAGGTGGTGGGAGATGTGG + Intergenic
1018971133 6:168530211-168530233 AGCCACAGCGGAGGGAAACGGGG + Intronic
1019119632 6:169792731-169792753 ATCCAGGGTGGAGGGACTCGAGG + Intergenic
1019208645 6:170385573-170385595 AGCCACTCTGGATGGCCATGAGG + Intronic
1019701831 7:2477889-2477911 AGGCACGTAGGAGGGACCTGCGG - Intergenic
1019886314 7:3909011-3909033 AGCCAGGGTGGGAGGAGATGAGG + Intronic
1019939521 7:4278245-4278267 AGCCAAGGTGGAGGTCAATGTGG + Intergenic
1021959936 7:25860875-25860897 CGCCTCTGTGGAGGGACTTGGGG + Intergenic
1022717882 7:32915145-32915167 AGTCACGGTGGAAGGCAATGAGG + Intergenic
1024541762 7:50480503-50480525 AGCCACGGTGGACAGAACTGTGG + Intronic
1025607735 7:63051417-63051439 AGCCACTCTGGAGGCTCATGTGG - Intergenic
1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG + Intronic
1034380891 7:150691399-150691421 ACCCACGTTGAAGGGAAATGGGG + Intronic
1040138342 8:43881592-43881614 AGAATCTGTGGAGGGACATGTGG - Intergenic
1040468869 8:47719655-47719677 AGCCAGGCTGGAGGGACCAGGGG + Intronic
1042665422 8:71199360-71199382 AGGCATGGTGCAGGGCCATGAGG + Exonic
1046202461 8:110945201-110945223 ATCCACGGTTGATGGACATCTGG + Intergenic
1048577783 8:135706494-135706516 AGCCACTCAGGAGGGACTTGGGG + Intergenic
1049150485 8:141032153-141032175 CACCGCGGTGGAGGGCCATGAGG + Intergenic
1052318358 9:27139938-27139960 AGCCAAGGTGGCAGGACAGGGGG - Intronic
1052473936 9:28934010-28934032 ATCCTCTGTGGAGGGACATAAGG + Intergenic
1053178157 9:35944408-35944430 AGCCAGACTTGAGGGACATGGGG + Intergenic
1054808254 9:69413019-69413041 AGCCACGGTGCTGGGAGCTGCGG - Intergenic
1054859470 9:69933879-69933901 AGTTACAGTGGTGGGACATGCGG + Intergenic
1056348633 9:85724980-85725002 AGGCACGGTAGAGGGAAATTGGG - Intronic
1057542940 9:95992741-95992763 GGCCAGGGTGGAGGGACATGAGG + Intronic
1057565911 9:96166206-96166228 AACCAAGGTGCAGAGACATGGGG + Intergenic
1057670948 9:97087735-97087757 AGCCACGCTGGACAGAAATGTGG + Intergenic
1058280627 9:103109274-103109296 AGCCACTGTGGAGGGTCTTTTGG + Intergenic
1060150729 9:121286541-121286563 AGCCACGGAGGAGGGGCATTGGG - Intronic
1060471385 9:123951439-123951461 AGCCACGGTGGTGGGAGCAGAGG + Intergenic
1061002813 9:127911996-127912018 AGCCAGTGTGTAGGGGCATGAGG - Intronic
1061144219 9:128787644-128787666 AGGCACGGGGGCGGGGCATGGGG - Intronic
1061218323 9:129234849-129234871 TGGCAGGGTGGAGGGACATCTGG + Intergenic
1062543267 9:137050883-137050905 AGCCAGGGTGGAGGGGCACCTGG + Exonic
1186449061 X:9657048-9657070 AGCCAGAGTGGAGGGAGCTGAGG - Intronic
1188236818 X:27741417-27741439 AGCCATGGTGCTGGGGCATGGGG - Intronic
1188373622 X:29400142-29400164 TGCTAAGGTGGAAGGACATGAGG + Intronic
1190760424 X:53433820-53433842 GGCCACGGCGGAGCGACTTGTGG - Exonic
1192461209 X:71318923-71318945 ACCCAGGGTGGGGGGGCATGGGG + Intergenic
1192633232 X:72792720-72792742 TGCCACGCTGGAGGGAAATCAGG + Intronic
1192648477 X:72928081-72928103 TGCCACGCTGGAGGGAAATCAGG - Intronic
1195675697 X:107505952-107505974 AGCCACTGTTAGGGGACATGGGG - Intergenic
1201063874 Y:10070569-10070591 AGCCAGGAGGGAGGCACATGTGG + Intergenic