ID: 954751255

View in Genome Browser
Species Human (GRCh38)
Location 3:52815141-52815163
Sequence AAGACCCTGCTGTTACTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954751254_954751255 -5 Left 954751254 3:52815123-52815145 CCTTTGAGCATGTTGAATAAGAC 0: 1
1: 0
2: 1
3: 11
4: 100
Right 954751255 3:52815141-52815163 AAGACCCTGCTGTTACTCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 126
954751252_954751255 25 Left 954751252 3:52815093-52815115 CCTTTCTGGTGTTCTCATGAATG 0: 1
1: 0
2: 0
3: 22
4: 458
Right 954751255 3:52815141-52815163 AAGACCCTGCTGTTACTCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954751255 Original CRISPR AAGACCCTGCTGTTACTCAG AGG Intronic
901095717 1:6677720-6677742 AAGACTCTACTGCTAGTCAGTGG + Intronic
901612969 1:10513610-10513632 ATGATCCTTCTGTTCCTCAGAGG - Intronic
902715474 1:18269790-18269812 AAGACTCTGCTCTTTCTCAAGGG - Intronic
903177965 1:21591735-21591757 GTGACGCTGCTGTTTCTCAGGGG - Intergenic
907531851 1:55107259-55107281 AAGACCCTTCTTTCACTCTGTGG - Exonic
907712427 1:56896498-56896520 AAGACTCTTCTCTTATTCAGAGG + Intronic
915543270 1:156582113-156582135 CAGAGCCTGATGATACTCAGAGG + Intronic
916312114 1:163409209-163409231 AAGCCTCTGGTGTTACTCAGCGG + Intergenic
922924510 1:229336560-229336582 AGGACCCAGCTGTTCCTCTGGGG - Intronic
923016313 1:230129018-230129040 CACACCCTGCTTTTACTCAGTGG + Intronic
923772854 1:236952411-236952433 AAAACCCTGGTGTTCCTTAGAGG - Intergenic
923824241 1:237481960-237481982 AAGACACTCCTGTTAACCAGGGG + Intronic
924330329 1:242935053-242935075 TAGACCCTGCTTCCACTCAGGGG - Intergenic
1067170717 10:43903889-43903911 CAGTCCCTGCTGCTGCTCAGGGG - Intergenic
1070752082 10:78969895-78969917 GAGCCTCTGTTGTTACTCAGTGG - Intergenic
1075133628 10:119762760-119762782 AATCCCCTGCAGTTACTGAGGGG + Intronic
1076063423 10:127430310-127430332 GAGACCCTGGGGTTCCTCAGAGG + Intronic
1078101019 11:8330352-8330374 ACGACCCTGCTGCTTCCCAGAGG - Intergenic
1081516301 11:43833704-43833726 AGGACTCTGCTGTTACTCAATGG - Intronic
1088528056 11:110777976-110777998 AAGTCCCTGCAGTGACTCAGAGG + Intergenic
1089203422 11:116739378-116739400 AAGCCCCTCCAGTTCCTCAGTGG - Intergenic
1098313844 12:69173763-69173785 CAGATGCTGCTGTTACTTAGAGG + Intergenic
1100121128 12:91370561-91370583 AAGACCCAGCTCTTCCCCAGTGG + Intergenic
1101816387 12:108149263-108149285 AAGACCCTCCATTTGCTCAGAGG - Intronic
1102120475 12:110436952-110436974 AAGTCCATGCTGTAAGTCAGAGG + Intronic
1105779197 13:23691608-23691630 AAGATCTTTCTGTTATTCAGAGG + Intergenic
1110045140 13:70818743-70818765 AAGACCCTGCAGTTAGTGACTGG - Intergenic
1111402567 13:87760208-87760230 AATATCCTGATGTAACTCAGTGG - Intergenic
1111613492 13:90635874-90635896 AAGACCCTGCTCTTGATAAGAGG + Intergenic
1113114319 13:106858734-106858756 AAGAACCTCATATTACTCAGTGG - Intergenic
1113722422 13:112569596-112569618 TTGACCCTGGAGTTACTCAGAGG - Intronic
1118709724 14:68509341-68509363 AGGACCATGCTGTGACTCAGAGG + Intronic
1119473689 14:74914649-74914671 AAGAAACTCCTTTTACTCAGTGG + Intronic
1119752359 14:77088718-77088740 AAGACCCTCCAATGACTCAGAGG + Intergenic
1121577621 14:95001346-95001368 AAGACCCTGCTGGCACTCACAGG + Intergenic
1121641182 14:95485900-95485922 CAGACTCTGCTGGTCCTCAGGGG - Intergenic
1122097107 14:99380408-99380430 AAGACCCTCCTCTTACTGGGAGG - Intergenic
1127065528 15:55233921-55233943 AGGGCCCTACTGTTATTCAGTGG + Intronic
1127808985 15:62546937-62546959 AAGCCCCTGCTGATAGTCTGTGG + Intronic
1129679351 15:77649478-77649500 ATGACCTTGCTGTTTCTCCGTGG - Intronic
1129706838 15:77799237-77799259 AGGACACTGCTCTTGCTCAGAGG + Intronic
1130055943 15:80526136-80526158 AAGCCCTTTCTGTTACACAGTGG + Intronic
1131074304 15:89485519-89485541 AAATCCCTGCTGTTACTCTTAGG - Intronic
1134045629 16:11098885-11098907 CAGACCCTGCTCATCCTCAGAGG + Intronic
1138137563 16:54536664-54536686 CAGCCCCTGCTGTTTCTGAGGGG - Intergenic
1139459676 16:67111563-67111585 AAGGCCCTGCTGATGCTTAGTGG + Intronic
1139732220 16:68956301-68956323 AAGAACCTGCATTTACTCTGAGG + Intronic
1141087835 16:81109346-81109368 AACAGCCTGCTGTTTCACAGTGG + Intergenic
1141568532 16:84920017-84920039 AAGACGCAGCTGTCAGTCAGCGG - Intronic
1143103312 17:4515617-4515639 TAGACCATGATGTTACTCAGTGG + Intronic
1143349772 17:6279101-6279123 AAGATCCTGCAGCTAGTCAGTGG + Intergenic
1144698599 17:17322323-17322345 AAGAGGCAGCTGTCACTCAGAGG + Intronic
1146511044 17:33448951-33448973 AAGACCATGCTATAACTAAGAGG - Intronic
1152247088 17:79190601-79190623 GAGACCCTGCTGTCTCTCCGGGG + Intronic
1152977867 18:241201-241223 AAGACCCTCCTGTTAACAAGTGG - Intronic
1155682191 18:28501903-28501925 AAGACTCTGCTGTTTCTGACAGG - Intergenic
1157369684 18:47099343-47099365 AAGGCCCTGCTCTTGCTCACAGG - Exonic
1159000932 18:62974518-62974540 AGGCCCCTGCTGTTCCTGAGTGG - Intronic
1159004267 18:62998801-62998823 AAGACCCTTCAGTTACCCTGTGG - Intergenic
1159769871 18:72537205-72537227 AAGAACCTGGTGTTCCTGAGTGG - Exonic
1161397374 19:4051950-4051972 AACGCCCTGCTGTGACTCAGAGG + Intronic
1165103270 19:33452803-33452825 CAGACCCTGTTGTTTCTCTGGGG - Intronic
1166438974 19:42793916-42793938 AACACCCTGATGTTATTCAAAGG - Intronic
1166776922 19:45318685-45318707 AAGACCCTCTTGTTTCCCAGTGG + Intronic
926742423 2:16123770-16123792 AAGGCCCTGCTGTGACCAAGAGG + Intergenic
931175746 2:59852734-59852756 AAGAGCCTGCTGTCTCTCTGGGG - Intergenic
935112852 2:100107894-100107916 AAGACGCAGCTGCAACTCAGAGG + Intronic
937263012 2:120598379-120598401 AAGACCCTGGGGTGACTGAGTGG + Intergenic
938009677 2:127819053-127819075 AACACCCTGGTGTTACCCAAAGG + Intergenic
939152431 2:138488713-138488735 AAGATGCTGCTGTTACTAAAAGG + Intergenic
942228275 2:173835844-173835866 GAGGCCCTGCTGTCACTAAGTGG - Intergenic
1172039006 20:32030892-32030914 AAATCCCTGCTGTCACTCACTGG - Intronic
1175123030 20:56731127-56731149 CAGACCCCGCTGTTACCCACTGG + Intergenic
1175138471 20:56842444-56842466 AAGTGCCTGCTGTTACTCCCTGG + Intergenic
1180644727 22:17329275-17329297 CAGCGGCTGCTGTTACTCAGTGG - Intergenic
1185351290 22:50340826-50340848 AAGTCCCTGCTGTTGCCCACAGG - Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949508925 3:4751720-4751742 AAGTCCCTCCCGTTACTCAGAGG - Intronic
953334587 3:42083469-42083491 AAGACCCTGATGGTCCTGAGGGG - Intronic
954751255 3:52815141-52815163 AAGACCCTGCTGTTACTCAGAGG + Intronic
955941234 3:64148859-64148881 AATACATTTCTGTTACTCAGAGG + Intronic
956619969 3:71212021-71212043 TAGAACCTGCTGTTTCTCAGAGG + Intronic
957776361 3:84760535-84760557 AAGCCCCAGCTGTGTCTCAGTGG - Intergenic
959114717 3:102163096-102163118 AAGAGGCTGCTGTGCCTCAGGGG - Intronic
959934626 3:112016198-112016220 GAGACGCTGATCTTACTCAGGGG - Intergenic
965602521 3:170469137-170469159 AAGAGACTGGTGCTACTCAGAGG - Intronic
967110676 3:186290793-186290815 AACTCTCTGCTGTTACTCAAAGG - Intronic
969563540 4:7964516-7964538 AAGAAACTGCTGATACACAGAGG + Intergenic
971254146 4:24998750-24998772 AAGATACTGCTGTCCCTCAGTGG + Intergenic
977736490 4:100423001-100423023 AAGGCATTGCTGTTACTCACTGG + Exonic
982351157 4:154416729-154416751 GAAACCGTGCTGTTACACAGGGG - Intronic
985492942 5:189781-189803 AACACCCTGCTGTCACTGCGGGG - Exonic
986534134 5:8768982-8769004 GAGACCATGCTGTGACTGAGAGG - Intergenic
990854923 5:60254118-60254140 AAGACACTGATGTTTCTCAAAGG + Intronic
998478953 5:142445397-142445419 AAGGCCCTGGTGCTGCTCAGAGG + Intergenic
1003418202 6:5931989-5932011 AAGGCTCTCCTGTTGCTCAGTGG - Intergenic
1005418802 6:25628381-25628403 AAGACCCTGAAGTTAGTGAGGGG + Intergenic
1007536138 6:42591246-42591268 AAGACTCTTCTGTCACCCAGGGG + Intronic
1009515181 6:64607082-64607104 AAAACCCTGCCGTTTCTCAGTGG + Intronic
1009676126 6:66824002-66824024 AAGATCCTGCTGTTTCTCTGAGG + Intergenic
1013818998 6:114133328-114133350 ATGACCCCACTGTTCCTCAGAGG + Intronic
1015048346 6:128807241-128807263 AATACCATGTTGTTTCTCAGTGG + Intergenic
1017610029 6:156175648-156175670 AGGTCCCTTGTGTTACTCAGGGG - Intergenic
1017966449 6:159271054-159271076 AAAGCCCAGCTGTAACTCAGGGG - Intronic
1018223953 6:161609838-161609860 AAGAACCTGCTGTTTCACTGAGG + Intronic
1018330426 6:162721600-162721622 AAGATCCAGCTGTTTCCCAGTGG - Intronic
1018812280 6:167306844-167306866 GAGACCCTGCTCTTCCTCTGTGG + Intronic
1020240791 7:6393426-6393448 GCCACCCTGCTGTGACTCAGGGG + Intronic
1022049206 7:26648727-26648749 AAAATCCTGCTGTTATTTAGTGG + Intergenic
1022152667 7:27624735-27624757 AAGACCATACTGTTGATCAGGGG - Intronic
1023189535 7:37564874-37564896 AAAACTCTGATGATACTCAGTGG - Intergenic
1024269726 7:47633183-47633205 GATACTCTGCTGTTGCTCAGAGG - Intergenic
1024669334 7:51577750-51577772 AAAACCCTGTTCTTTCTCAGAGG - Intergenic
1026575319 7:71566801-71566823 AGGACCCTCCTGTAACTTAGGGG + Intronic
1032292057 7:130597462-130597484 AATACACTGCTTTTCCTCAGGGG - Intronic
1034063802 7:148117672-148117694 AAGCCCCTGGGGTTACTCTGTGG - Intronic
1034501150 7:151451831-151451853 AAGTCCCTGCTGTGAGGCAGGGG + Intergenic
1036060865 8:5318777-5318799 AAGACTTTGCTGTTAGTAAGTGG - Intergenic
1036084458 8:5598726-5598748 CAGACCCTTCTGTTACATAGGGG + Intergenic
1036565028 8:9931145-9931167 ATGACCCTCTTGTTCCTCAGAGG - Intergenic
1039701254 8:39964060-39964082 AAGGCTCTGTTGTTACTGAGGGG + Intronic
1040713405 8:50217826-50217848 CAGACTCTGCTTTTGCTCAGTGG - Intronic
1041389000 8:57332518-57332540 AAGCCACTGCTGTTAGACAGAGG + Intergenic
1041834140 8:62192733-62192755 AAGCCCCTGATATCACTCAGAGG - Intergenic
1044550223 8:93504055-93504077 AAGCCCCTGATTTTACTAAGAGG + Intergenic
1045295599 8:100869497-100869519 AAATCCCTGCTGTTACTCGAGGG + Intergenic
1048195878 8:132331401-132331423 AGGACCCAGCTGAGACTCAGGGG + Intronic
1048617447 8:136092898-136092920 AAGAATGTGCTGTTTCTCAGTGG + Intergenic
1056815670 9:89799117-89799139 AAGACCTTGGGGTTGCTCAGAGG - Intergenic
1058488434 9:105467080-105467102 AAGGTCATGCTGTTACTGAGTGG + Intronic
1059879608 9:118675683-118675705 AACACCAAGCTGTTACACAGAGG - Intergenic
1060096619 9:120796577-120796599 AAGACCCTGAAGTTGCTCACAGG + Intergenic
1060608383 9:124938658-124938680 AAGAGACTGCTGTTGCTCAGAGG - Exonic
1060898072 9:127231969-127231991 AAGATTCTGGTATTACTCAGAGG - Intronic
1060906193 9:127308188-127308210 AATACCCATCTGTTCCTCAGTGG - Intronic
1061597296 9:131640146-131640168 AAGACCCTGCAGTCTCTCCGGGG + Intronic
1186778316 X:12888207-12888229 AAGACCCAGCTGTGACCGAGTGG + Exonic
1189928043 X:45977865-45977887 AAAAAATTGCTGTTACTCAGGGG - Intergenic
1196208480 X:112967931-112967953 AGGACCCTGATTTTAGTCAGTGG + Intergenic
1201227692 Y:11834188-11834210 TAGACCCTGCTTCCACTCAGGGG - Intergenic