ID: 954752892

View in Genome Browser
Species Human (GRCh38)
Location 3:52823621-52823643
Sequence CCATCTCTGAGCCCTTGAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 276}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954752886_954752892 -2 Left 954752886 3:52823600-52823622 CCTGGAGCTTCCCAGCCACCACC 0: 1
1: 0
2: 1
3: 58
4: 459
Right 954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 276
954752882_954752892 6 Left 954752882 3:52823592-52823614 CCCCCGGTCCTGGAGCTTCCCAG 0: 1
1: 0
2: 0
3: 13
4: 223
Right 954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 276
954752885_954752892 3 Left 954752885 3:52823595-52823617 CCGGTCCTGGAGCTTCCCAGCCA 0: 1
1: 0
2: 5
3: 34
4: 333
Right 954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 276
954752883_954752892 5 Left 954752883 3:52823593-52823615 CCCCGGTCCTGGAGCTTCCCAGC 0: 1
1: 0
2: 0
3: 17
4: 230
Right 954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 276
954752884_954752892 4 Left 954752884 3:52823594-52823616 CCCGGTCCTGGAGCTTCCCAGCC 0: 1
1: 0
2: 3
3: 52
4: 595
Right 954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954752892 Original CRISPR CCATCTCTGAGCCCTTGAAG AGG Exonic
901154298 1:7125183-7125205 CAATCTCTGACCACTTGAATGGG + Intronic
903128430 1:21263031-21263053 ACATCCCAGAGGCCTTGAAGGGG + Intronic
903361849 1:22781847-22781869 TCATCTCTGATCCCATGGAGAGG + Intronic
903539869 1:24090836-24090858 CCAACTCTGAGGCCTTGGAGGGG + Exonic
903639708 1:24849834-24849856 ACATCTCTGAGCCAAGGAAGGGG - Intergenic
904091394 1:27947360-27947382 AAATCTCTGAGACCTTGAAGAGG + Intronic
904179306 1:28654682-28654704 CCAACACTGAGCCCTTGATATGG - Intergenic
904336074 1:29798963-29798985 CCAACGCTGAGCCCTTGATATGG + Intergenic
905465367 1:38149078-38149100 CCAACACTGAGCCCTTGATATGG + Intergenic
906050624 1:42868384-42868406 CCAACACTGAGCCCTTGATATGG + Intergenic
907116881 1:51976817-51976839 CCACCTCTAAGCCCTTGTACTGG + Intronic
908339381 1:63160996-63161018 CCATCTCTGTGGCTCTGAAGAGG + Intergenic
908654661 1:66375447-66375469 CCATCTCTGAGAGTTTGAAAAGG + Intergenic
908737525 1:67291788-67291810 CCAACACTGAGCCCTTGATATGG + Intergenic
910451273 1:87348307-87348329 CCACCTATGACCCCTTCAAGAGG + Exonic
910588352 1:88902695-88902717 CCAACACTGAGCCCTTGATATGG + Intergenic
910948348 1:92617683-92617705 CCAACACTGAGCCCTTGATATGG + Intronic
911669230 1:100589503-100589525 CCATCTTTGTGACCTTGAACAGG + Intergenic
911883705 1:103271437-103271459 CCAACACTGAGCCCTTGATATGG + Intergenic
912115309 1:106399592-106399614 TCATCCCTGAGCCTTTAAAGTGG - Intergenic
912733190 1:112127858-112127880 CCAACACTGAGCCCTTGATATGG - Intergenic
915004484 1:152623549-152623571 GCATCGCGGAGCCCCTGAAGTGG + Intergenic
916285464 1:163100494-163100516 CCAACACTGAGCCCTTGATATGG + Intergenic
917593114 1:176497877-176497899 ACATTTCTGAGCCCTAGAATTGG + Intronic
917973358 1:180222724-180222746 CCATTTCTCAGCTCTTGAAGAGG - Intergenic
919241900 1:194925180-194925202 CCAACACTGAGCCCTTGATATGG + Intergenic
919330339 1:196162902-196162924 CCAACATTGAGCCCTTGATGTGG + Intergenic
919878585 1:201888295-201888317 CCAGCTCTGTCCACTTGAAGGGG + Intergenic
920444581 1:206006214-206006236 CCATTTCTGCACCCTTGAAAGGG - Intergenic
920556074 1:206905531-206905553 GCATCTCTGAGCCCTTACAGAGG - Intronic
920967960 1:210716933-210716955 CCCTCTGTGGGCCCTGGAAGAGG + Intronic
922421923 1:225466021-225466043 ACATCTCTGAGCCCCTGGACGGG + Intergenic
922567459 1:226610300-226610322 CCATTTCTGGGGCCTTGGAGGGG - Intergenic
923005730 1:230048186-230048208 CTATCTCTGAGCCCTGGAAGAGG - Intergenic
923683506 1:236138349-236138371 CCAACTCTGAGCCTTTCAAGAGG + Intergenic
924847006 1:247784169-247784191 CCAACACTGAGCCCTTGATATGG - Intergenic
1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG + Intronic
1067045604 10:42983560-42983582 CCCTCACTGAGCCCTGGGAGTGG - Intergenic
1067125417 10:43511571-43511593 CCAACACTGAGCCCTTGATATGG - Intergenic
1067180860 10:43985057-43985079 CCATCTCTGCCCACCTGAAGTGG - Intergenic
1069798243 10:71066840-71066862 CTTTCTCTGAGCACTTGCAGTGG - Intergenic
1069863842 10:71488076-71488098 CCAACTCTGTGCCCTTCAAGGGG + Intronic
1071308648 10:84323027-84323049 CCAACACTGAGCACTTGATGTGG + Intergenic
1071446722 10:85755659-85755681 TCACTTCTCAGCCCTTGAAGTGG + Intronic
1072360594 10:94655061-94655083 CCAACACTGAGCCCTTGATATGG + Intergenic
1072803929 10:98412320-98412342 ACACCTCTGTTCCCTTGAAGAGG + Intronic
1073267063 10:102234228-102234250 TGATCTCTGAGCTGTTGAAGGGG - Intronic
1073586540 10:104716016-104716038 CCACCTCAGAGCTCTTGCAGTGG + Intronic
1075494829 10:122911050-122911072 CCATTTCTGAGCCCTGGCAAAGG + Intronic
1076417940 10:130305211-130305233 CCTTCCCTGTGCCCTTGCAGTGG + Intergenic
1078416756 11:11172405-11172427 CCTTCTCTGGGCCCCTGTAGTGG - Intergenic
1078486424 11:11727231-11727253 CCATGGCTGAGCCCGGGAAGAGG + Intergenic
1080173191 11:29330857-29330879 CCATCTTTGAGCTATTGAAGGGG - Intergenic
1083836160 11:65269613-65269635 CCATCTTGGAGGGCTTGAAGAGG + Intronic
1083936183 11:65871323-65871345 CCATCCCTGAGGCCTGCAAGGGG - Exonic
1084556682 11:69879897-69879919 TCATCTCTGTGCCCAGGAAGGGG - Intergenic
1084791965 11:71480828-71480850 CCATCTCTGAGCCCATCGAGTGG + Exonic
1085686092 11:78623137-78623159 CCAACACTGAGCCCTCGATGTGG + Intergenic
1088142479 11:106634022-106634044 CCATTTCTGTTCCCTGGAAGTGG - Intergenic
1092381682 12:8001874-8001896 CCAACACTGAGCCCTTGATATGG + Intergenic
1093031729 12:14294984-14295006 CCAACACTGAGCCCTTGATATGG - Intergenic
1094164119 12:27424688-27424710 TCATCACTGAGCCCTGGAATTGG + Intronic
1095121378 12:38423888-38423910 CCAACACTGAGCCCTTGATATGG - Intergenic
1095603986 12:44045286-44045308 CCAACACTGAGCCCTTGATATGG + Intronic
1095856119 12:46862725-46862747 CCAACACTGAGCCCTTGATATGG - Intergenic
1096181277 12:49551902-49551924 CCATCCTTGCTCCCTTGAAGAGG + Intronic
1097168685 12:57099806-57099828 CAATCTCTGAGTCGCTGAAGCGG + Exonic
1097564514 12:61251498-61251520 CCAACACTGAGCCCTTGATATGG - Intergenic
1098673152 12:73255195-73255217 CCAACACTGAGCCCTTGATATGG + Intergenic
1099401077 12:82204418-82204440 CCATCATTGAGCCCTTGATATGG - Intergenic
1099674197 12:85736446-85736468 CCATCACTCTGGCCTTGAAGGGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1103318601 12:120076997-120077019 CCATCTCTGAGCCCTTTTGGGGG + Intronic
1103409789 12:120702818-120702840 CCATTACTGAGTCCTTGAAATGG + Intergenic
1103902290 12:124309631-124309653 ACCTCCCTGAGCCCTTGGAGCGG + Intronic
1105740249 13:23316132-23316154 CCAACACTGAGCCCTTGATATGG + Intronic
1108914177 13:55587937-55587959 CCAACACTGAGCCCTCGATGTGG - Intergenic
1111317634 13:86582750-86582772 CCAACACTGAGCCCTTGATATGG + Intergenic
1112190504 13:97172818-97172840 CCTTCACTGAGCTCTGGAAGAGG - Intergenic
1113436039 13:110291741-110291763 CCAGCTCAGAGCTCTTGAAGAGG - Intronic
1117028278 14:51643703-51643725 CCATCTCTGAACCTTTGGACTGG - Intronic
1117216984 14:53561125-53561147 CCAACACTGAGCCCTTGATATGG + Intergenic
1118362709 14:65069603-65069625 TCATCTCTGTGCCCTTGATAGGG - Intronic
1119590357 14:75881225-75881247 CCATCTCTGATCCACAGAAGAGG - Intronic
1122888555 14:104722400-104722422 CCAGCTCTGAGCCCTTCCTGGGG - Intronic
1123501033 15:20880547-20880569 CCATGTCACAGCCCTTGAACTGG - Intergenic
1123558285 15:21454261-21454283 CCATGTCACAGCCCTTGAACTGG - Intergenic
1123594515 15:21891527-21891549 CCATGTCACAGCCCTTGAACTGG - Intergenic
1123941569 15:25219142-25219164 CCTTCTCTGAAGCCCTGAAGGGG + Intergenic
1125558430 15:40606414-40606436 CCACCTCTGAGGTCCTGAAGAGG - Exonic
1125833203 15:42730462-42730484 CCATAACTGAGCCCTGGGAGAGG - Intronic
1127281244 15:57495358-57495380 CCAGCTCTGAGACCTCGAGGTGG + Intronic
1127701311 15:61504319-61504341 CCATATCTGAGGCCTGTAAGGGG - Intergenic
1128081203 15:64857990-64858012 CCAGCTCTGAGCCTGTGAATAGG + Intronic
1128535485 15:68486992-68487014 CCCTATCTGGGCCCCTGAAGGGG - Intergenic
1129905741 15:79185977-79185999 CCATCTCTGTGGCCTAGAAGAGG - Intergenic
1130041606 15:80409870-80409892 CCAACTCAGGGCCTTTGAAGGGG - Intronic
1130131984 15:81151359-81151381 CCAACACTGAGCCCTTGATATGG - Intergenic
1130534262 15:84771971-84771993 GGATCTCTGAGTCCTTGAACAGG - Intronic
1131603324 15:93872597-93872619 CCATCACTGAAACCTTGTAGAGG + Intergenic
1202966634 15_KI270727v1_random:181400-181422 CCATGTCACAGCCCTTGAACTGG - Intergenic
1134007217 16:10826086-10826108 TCATTACTGAGCCCTTGAAATGG + Intergenic
1134642087 16:15837448-15837470 TCACATCTCAGCCCTTGAAGAGG - Intronic
1135150541 16:20001565-20001587 CCATCTCTGGGCCTTTGCATGGG + Intergenic
1135811088 16:25587425-25587447 ACATCTCTGAGCCCTTCATGTGG + Intergenic
1136042918 16:27594452-27594474 GAATCTCAGAGCCCTTGATGGGG - Intronic
1137978987 16:53054424-53054446 CCTTCTCTGAGCAGTGGAAGGGG - Intergenic
1141157228 16:81605651-81605673 CCACCTCTGAGCCTTTGCACTGG + Intronic
1141662557 16:85449249-85449271 CCACATCTGAGCCATTCAAGAGG + Intergenic
1141789880 16:86227206-86227228 GCATCTCTGAGCACTTGGAAGGG + Intergenic
1142149722 16:88507315-88507337 CCATCTCTGAGCTCTGGAGGCGG - Intronic
1146367672 17:32241893-32241915 TTATCCCTGAGCCCTTGTAGAGG + Intronic
1146787226 17:35731320-35731342 CCTTCGCTCAGCCCTTGAGGAGG + Intronic
1147476963 17:40721503-40721525 CAATGTCAGAGCCCTAGAAGAGG - Intergenic
1147969792 17:44213113-44213135 CCATCTCTGAGGCATGGAAGAGG - Intronic
1147978295 17:44260245-44260267 CCATCTCTGACACCTTGAAAGGG - Intronic
1150675564 17:67244463-67244485 CAGTCTGTGAGCCCTTGAAAAGG + Intronic
1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG + Exonic
1152466310 17:80468512-80468534 CCATCTCGGAGCCCTTGTGTAGG - Exonic
1155561152 18:27078618-27078640 CCATCTCTGATCCCTGTTAGTGG - Intronic
1157341340 18:46780959-46780981 CCAACACTGAGCCCTTGATATGG + Intergenic
1157536635 18:48463619-48463641 CCATTGCTGAGTCCTTGAAATGG + Intergenic
1157911459 18:51620967-51620989 CTAGCTGTGTGCCCTTGAAGAGG + Intergenic
1158643902 18:59226823-59226845 GCAGCTCTGAGCCCCTAAAGGGG - Intronic
1159075926 18:63682193-63682215 CCATCTCTGAGGCCTAAAGGTGG - Intronic
1161698850 19:5784347-5784369 CCTCCCCTGAGCCCTTGACGAGG - Exonic
1161748294 19:6075142-6075164 ACATCTCTCAGCCCTGGAGGTGG - Intronic
1162900654 19:13793822-13793844 TGGTCTCTGAGCCCTTGAAATGG - Intergenic
1163155464 19:15437837-15437859 CCTTCTCTGAGCCCTGCAACTGG + Intronic
1163889181 19:19995737-19995759 CCATCTGTGAACACATGAAGAGG + Intergenic
1168390654 19:56004769-56004791 CCTTGACTGAGCCCTTGAATTGG + Intronic
925694934 2:6566630-6566652 CCACCTCTGACCCTTTGAAATGG - Intergenic
926123870 2:10259435-10259457 CCATCCCTGTGGCCTGGAAGGGG + Intergenic
926565822 2:14472429-14472451 CCATCTCTCAACACTTGAATTGG - Intergenic
927617276 2:24611873-24611895 TCATCTCTGTGCCTTTTAAGTGG + Intronic
928320968 2:30282547-30282569 CCATCTCTGTCACCTGGAAGAGG - Intronic
929555710 2:42924521-42924543 CCAGCAGTGAGCCCTTCAAGGGG + Intergenic
931158264 2:59659951-59659973 GCATCTCTGCGCCCTTGTAAAGG + Intergenic
932423893 2:71617167-71617189 CCTTCTCTGAGGACTTGAAGAGG - Intronic
932870563 2:75394137-75394159 CCAACACTGAGCCCTTGATATGG - Intergenic
933394337 2:81712410-81712432 CCAACACTGAGCCCTTGATATGG - Intergenic
934551136 2:95262554-95262576 CCATCTCTGAGCCTGGGATGTGG + Intergenic
935184079 2:100715845-100715867 CCAACACTGAGCCCTTGATATGG + Intergenic
935213417 2:100957260-100957282 CCAGCTCAGAGCCCTCCAAGAGG - Intronic
935398697 2:102637901-102637923 CCATCTCTCAGGGCATGAAGAGG - Intronic
935622669 2:105143533-105143555 CCGGATCTGAGCCCTTTAAGAGG - Intergenic
937582243 2:123500884-123500906 CCAGCACTGAGCCCTTGATATGG + Intergenic
940124722 2:150310633-150310655 CCAGTTCTGAGCCCTTGCTGGGG - Intergenic
940460150 2:153954791-153954813 CCAGCTGTGAGTCCTTGCAGAGG - Intronic
943271619 2:185812233-185812255 CCATCACTGTGCCCTAGATGTGG + Intronic
943343161 2:186705542-186705564 GCATCTCTGACCCCTGAAAGGGG + Intronic
943567590 2:189534698-189534720 CCTTTTCTAAGCCCCTGAAGAGG - Intergenic
943833483 2:192490209-192490231 CCAACACTGAGCCCTTGATATGG - Intergenic
944112224 2:196144955-196144977 GCATCACATAGCCCTTGAAGTGG - Intronic
946053214 2:216880841-216880863 CCAGTTCTGAGAACTTGAAGGGG - Intergenic
947434243 2:230059196-230059218 CCATCTGGGAGCCCATGATGAGG + Exonic
947707710 2:232289973-232289995 CCATCTCTGTGCATTGGAAGGGG + Intronic
948790523 2:240374332-240374354 CCTTCTCTGGTCCCTTGAGGAGG - Intergenic
1169530648 20:6481445-6481467 CCATCTCTGAGCCCTAGGGTTGG - Intergenic
1169831625 20:9831592-9831614 GAATGTCTGAGCCCATGAAGTGG - Intronic
1170799426 20:19578833-19578855 ACATCACTGAGCCCTTGATCAGG - Intronic
1171164658 20:22959169-22959191 TTATCTCTGAGCCCTCCAAGGGG - Intergenic
1172094914 20:32455889-32455911 CCTTCTCCGAGCCTGTGAAGTGG - Intronic
1172136508 20:32690094-32690116 CCTTCTCTGCTCCCTTGCAGGGG - Intergenic
1172995846 20:39069892-39069914 CCAGCTCAGAGCTCTTGAACTGG + Intergenic
1173967919 20:47127686-47127708 ACAGCTCTGAGCCCTTGGGGAGG - Intronic
1174392443 20:50226337-50226359 CCTTCTCTGAGCCATTGACATGG + Intergenic
1174453459 20:50633692-50633714 CCTTCTCTCTGACCTTGAAGTGG - Intronic
1175022691 20:55867513-55867535 GCATCTCTGCGCCTTTTAAGTGG - Intergenic
1177913310 21:27057157-27057179 CCAACACTGAGCCCTTGATATGG + Intergenic
1178405160 21:32317526-32317548 CCATCTTGGAGCCCTGGATGGGG - Intronic
1179530909 21:42019088-42019110 CCCTCTCTGATCCCTTCAACTGG + Intergenic
1179613786 21:42568971-42568993 CCTTCCCTGAGCCCTTGTATGGG + Intronic
1179639045 21:42735185-42735207 CCGTCTCTGAGCCCCAGATGCGG + Intronic
1181367259 22:22387583-22387605 CCAACACTGAGCCCTCGATGTGG - Intergenic
1181373581 22:22438215-22438237 CCAACACTGAGCCCTTGATATGG - Intergenic
1181756345 22:25027765-25027787 CCGTCTCTGAGCTCTGGACGAGG - Intronic
1182357307 22:29728015-29728037 CCATCTCTGAGCCCTGCATGTGG - Intronic
1182980778 22:34668801-34668823 CCAACTCTGAGCCCTGGATATGG - Intergenic
1183341220 22:37283023-37283045 CCACCTCTGAGCCTTTGGACTGG - Intronic
1183566180 22:38616896-38616918 CCATCTCTGTGCCTATGGAGAGG - Intronic
1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG + Intronic
1183724570 22:39581271-39581293 TCAGCTCTGAGCCCTTGATCAGG - Intronic
1183898291 22:40986406-40986428 CCCTCTCTGGGCCTTGGAAGGGG + Intergenic
1184603429 22:45557418-45557440 CCAACACTGAGCCCTCGATGTGG - Intronic
949246007 3:1925872-1925894 CCAACACTGAGCCCTTGATATGG + Intergenic
949398669 3:3642357-3642379 CCATCTCTGGGCCCTGGGAAAGG - Intergenic
949445746 3:4132006-4132028 CCAACACTGAGCCCTTGATATGG + Intronic
949639039 3:6014463-6014485 CCAACACTGAGCCCTTGATATGG + Intergenic
950531904 3:13557085-13557107 TCCTCCCTGAGCTCTTGAAGTGG - Intronic
954325328 3:49860390-49860412 CCATCTTTGAGGCCTGGAAGGGG - Intronic
954543289 3:51410843-51410865 GCACCTCTGTGCCCTTAAAGAGG + Intronic
954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG + Exonic
955700151 3:61674221-61674243 CCATCTCTGAGACATTCAATAGG - Intronic
955728389 3:61957820-61957842 CCCTCTCTGAGGCTTTCAAGTGG - Intronic
956011283 3:64834339-64834361 CCATCTCTGAGCCCCAGGTGTGG - Intergenic
956203228 3:66729115-66729137 CCTACTCTGAGCCTTAGAAGAGG - Intergenic
969584655 4:8084800-8084822 CCCTCTCTGGGCCTTTGATGTGG - Intronic
970998387 4:22294260-22294282 CCATCTATGAGCCCTGGTACTGG - Intergenic
972644224 4:40952931-40952953 TCCTCTCTGAGCCCTAGAAATGG - Intronic
972806054 4:42530276-42530298 CCAGCACTGAGCCCTTGATATGG + Intronic
972882842 4:43447225-43447247 CCAACACTGAGCCCTTGATATGG - Intergenic
973103049 4:46295690-46295712 CTAGCTCTGAGCCCTCGATGTGG + Intronic
975824769 4:78308131-78308153 CCATCTCTCAGCACGTGGAGGGG - Exonic
976282052 4:83335062-83335084 CCATCTCCGCACCCTTCAAGTGG - Exonic
977204843 4:94156582-94156604 CCAGCACTGAGCCGTTGATGCGG + Intergenic
979682781 4:123480101-123480123 ACCTCTCTGAGCCCTTGTGGTGG - Intergenic
980957865 4:139446862-139446884 CCAACACTGAGCCCTCGAAATGG + Intergenic
981198483 4:141948522-141948544 CCAACTCTGTGCCTTTTAAGTGG - Intergenic
981462945 4:145032741-145032763 CCAACACTGAGCCCTTGATGTGG + Intronic
982073848 4:151719379-151719401 CCAGCTCTGAGAACTTGCAGTGG + Intronic
982165423 4:152609506-152609528 CCAACTTTGAGTCCTGGAAGAGG - Intergenic
982597642 4:157406106-157406128 CCATCACTGAGTCCTTGATATGG - Intergenic
982835682 4:160117593-160117615 CCAACACTGAGCCCTTGATATGG + Intergenic
983582816 4:169325761-169325783 CCAACACTGAGCCCTTGATATGG + Intergenic
985692074 5:1319118-1319140 TCAACTGTGAGCCCTTCAAGTGG - Intronic
986223586 5:5792553-5792575 CCATCTCTGAGCCATTGCTGAGG - Intergenic
986261500 5:6151576-6151598 CCAACACTGAGCCCTTGATATGG - Intergenic
986339902 5:6780012-6780034 CCTTCTCTCAGGCCTTGGAGGGG - Intergenic
986745930 5:10744925-10744947 CACTCTCAGAGCTCTTGAAGAGG + Intronic
986766292 5:10931252-10931274 CCAACACTGAGCCCTTGATTTGG + Intergenic
988169074 5:27631890-27631912 CCAACACTGAGCCCTTGATATGG - Intergenic
989497156 5:42122840-42122862 GAAACTCTGAGCCCTTGGAGTGG + Intergenic
991330608 5:65488734-65488756 CCAACACTGAGCCCTTGATATGG - Intergenic
992438659 5:76779390-76779412 CCATCACAGAGCCCTTAAACGGG + Intergenic
993311492 5:86338231-86338253 CCTTCTCTGTGCCCTGCAAGAGG - Intergenic
995552264 5:113293409-113293431 CCATCACTGAGCCATTTATGGGG - Intronic
997839568 5:137226689-137226711 CCATCTCTGGGCCTTTGCATAGG + Intronic
997863110 5:137437305-137437327 CCATCTCTGAATCCCTGTAGAGG + Intronic
998264719 5:140659382-140659404 CCAGCTCTGAGCCCTACCAGGGG - Intronic
998290197 5:140907605-140907627 CCAACACTGAGCCCTTGATATGG - Intronic
1000067712 5:157709774-157709796 ACATCACTGAGCCCCTGAAGAGG + Intergenic
1000417104 5:160994849-160994871 CCAACACTGAGCCCTTGATCTGG + Intergenic
1001107743 5:168869637-168869659 CCATCTCTCAGCCCAAGAAATGG + Intronic
1001399619 5:171438733-171438755 CCATCTGTGAGCCCGGGGAGAGG + Intronic
1001667751 5:173447314-173447336 CCATCTCTGTGCGCATAAAGAGG - Intergenic
1001739005 5:174034606-174034628 CCAGTTCTGAGCCCTTGCTGGGG + Intergenic
1002520978 5:179793200-179793222 CCATCTCACAGGCCTGGAAGGGG + Intronic
1002591796 5:180295659-180295681 ACATCTCTGGGTCCTTGTAGGGG - Intergenic
1004454906 6:15783418-15783440 CCATCTCCGTGCCCATGATGAGG - Intergenic
1006358355 6:33573717-33573739 CCTTCTCTGTTCCCTTGCAGGGG - Exonic
1010323702 6:74541439-74541461 CCAACACTGAGCCCTTGATATGG + Intergenic
1010613476 6:77984881-77984903 TCATCTCTGAGCCCTGGTAGTGG - Intergenic
1010818762 6:80389357-80389379 CCAACACTGAGCCCTTGATATGG + Intergenic
1010938113 6:81885475-81885497 CCAACACTGAGCCCTTGATATGG - Intergenic
1011039220 6:83012352-83012374 CCAACACTGAGCCCTTGATATGG - Intronic
1011669795 6:89672242-89672264 CCATCTCCGAGCTGTTGGAGAGG - Exonic
1018841949 6:167523857-167523879 CCACCTCTGATCTCTTGAACAGG - Intergenic
1021904970 7:25324071-25324093 CCATCACTGAGCCCTAGGTGAGG + Intergenic
1022027561 7:26463024-26463046 GCATTTCTGAACTCTTGAAGAGG + Intergenic
1022288509 7:28978142-28978164 CCATCTCTGAGTCTCTGATGTGG + Intergenic
1022569669 7:31439458-31439480 CACTCTCTGAGCCTTTCAAGAGG - Intergenic
1023237234 7:38102382-38102404 CCAGCACTGAGTCCTTGAAATGG - Intergenic
1023333731 7:39146648-39146670 CCCTCCCTGGGGCCTTGAAGGGG - Intronic
1023923629 7:44649084-44649106 CCTGCTCTGAGCACCTGAAGAGG - Intronic
1024850237 7:53705800-53705822 CCATCTCAAAGCCTTTCAAGAGG - Intergenic
1026046356 7:66908164-66908186 CCAACACTGAGCCCTTGATATGG - Intergenic
1027593765 7:80146697-80146719 CCATCTCAGAGTCCTAGAGGAGG + Intronic
1027685931 7:81278902-81278924 CCAACACTGAGCCCTTAATGTGG + Intergenic
1028068826 7:86423628-86423650 CATTCTCTTAGCCCCTGAAGAGG - Intergenic
1028730045 7:94136194-94136216 CTTTCTCTGAGACCTTGAATGGG - Intergenic
1029124687 7:98287908-98287930 GCATCTCTGGGCCTTTGAACAGG + Intronic
1031337842 7:120558676-120558698 CCCTCTCTGAGCTTTTCAAGTGG + Intronic
1032879409 7:136073284-136073306 CAAACTCTGAGCTATTGAAGTGG - Intergenic
1032923351 7:136575182-136575204 CCAACTCTGAGCCCTCGATATGG - Intergenic
1033417140 7:141172348-141172370 CCATGTCTCTGCCCTTGATGGGG + Intronic
1034281972 7:149860974-149860996 ACATCTCAGAGACCCTGAAGAGG + Exonic
1034694955 7:153044850-153044872 CCTTCTCTCACCCCTAGAAGTGG - Intergenic
1036515044 8:9436229-9436251 GCACCTTTGAGCCTTTGAAGAGG - Intergenic
1041171670 8:55148739-55148761 CCAACTCTAAACCCATGAAGTGG + Intronic
1041972483 8:63760098-63760120 CCAGTTCTGAGCCCTTGCTGGGG + Intergenic
1044150928 8:88774017-88774039 CCAACACTGAGCCCTTGATATGG + Intergenic
1045411794 8:101927556-101927578 CCATCTCTGGGCCTTTGCACGGG - Intronic
1045429248 8:102098004-102098026 CCATCTCTGTGCCCCTGCAAAGG + Intronic
1046128539 8:109940649-109940671 CCAACACTGAGCCCTCGATGTGG - Intergenic
1050329403 9:4530434-4530456 GCATCTCTGCGCCCAGGAAGAGG - Intronic
1050717195 9:8543415-8543437 TCATCACTGAGCAATTGAAGGGG - Intronic
1051231789 9:14962778-14962800 CCATGTCTCAGGGCTTGAAGGGG + Intergenic
1051923915 9:22299830-22299852 GCATCTCTGGGCACTGGAAGAGG - Intergenic
1052829515 9:33203360-33203382 CCATGTCTGAGCCCAAGCAGGGG + Intergenic
1055859525 9:80731105-80731127 CCATCTCTGAGGCTTTGCTGCGG - Intergenic
1056692805 9:88822530-88822552 ACAACTCTAAGCCCTTGAAATGG - Intergenic
1059416211 9:114163980-114164002 CCATCTCTTCACCCTTGATGGGG + Intronic
1061927247 9:133812004-133812026 CCATGTCTGAGCCACCGAAGGGG - Intronic
1186279641 X:7978064-7978086 CCATCACTGAGCCCTCGATGTGG + Intergenic
1186469632 X:9811189-9811211 CCAACACTGAGCCCTTGATATGG - Intronic
1187176119 X:16897753-16897775 ACAGCTCTGAACCCTTGAAAGGG - Intergenic
1190578876 X:51871024-51871046 CCATCTCTGAGCACCTGCTGGGG - Intronic
1191078771 X:56486813-56486835 CCAGTTCTGTGCCCTTGATGGGG + Intergenic
1192661443 X:73046839-73046861 CCAACACTGAGCCCTTGACATGG - Intergenic
1193447290 X:81619708-81619730 CCAACTCTGAGCCCTTGATATGG + Intergenic
1194049814 X:89054691-89054713 TCATATTTAAGCCCTTGAAGAGG + Intergenic
1194178809 X:90688183-90688205 GCATCTGTGTGCCCTGGAAGTGG - Intergenic
1194470898 X:94295705-94295727 TCATCTCTGAGCCTTTGACTGGG + Intergenic
1194584244 X:95714005-95714027 CCAACACTGAGCCCTTGATATGG + Intergenic
1195629636 X:107041528-107041550 ACATCACTGAGCCGTTGAATTGG - Intergenic
1196762640 X:119213252-119213274 CCATCTCTGTGCCTTTGGACAGG + Intergenic
1197044547 X:121979254-121979276 CCAACACTGAGCCCTTGATATGG + Intergenic
1197592006 X:128420331-128420353 CCAACACTGAGCCCTGGATGTGG + Intergenic
1199144330 X:144348031-144348053 CCAACACTGAGCCCTTGATATGG - Intergenic
1200745924 Y:6903925-6903947 CCATCACTGAGCCCTTAATATGG - Intergenic
1201684181 Y:16682734-16682756 CCAACTCTCAGCCATTGAGGTGG - Intergenic