ID: 954754471

View in Genome Browser
Species Human (GRCh38)
Location 3:52831755-52831777
Sequence CCGCCGTCCTTCCCTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 144}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954754471_954754475 1 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754475 3:52831779-52831801 TCCGTGACACCAGCCCTGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 146
954754471_954754484 26 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754484 3:52831804-52831826 CAGCTGCCTTGGGAACCTATCGG 0: 1
1: 0
2: 2
3: 19
4: 160
954754471_954754485 27 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754485 3:52831805-52831827 AGCTGCCTTGGGAACCTATCGGG 0: 1
1: 0
2: 2
3: 7
4: 121
954754471_954754482 16 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754482 3:52831794-52831816 CTGAGGGGGCCAGCTGCCTTGGG 0: 1
1: 0
2: 0
3: 26
4: 210
954754471_954754487 29 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754487 3:52831807-52831829 CTGCCTTGGGAACCTATCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
954754471_954754481 15 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754481 3:52831793-52831815 CCTGAGGGGGCCAGCTGCCTTGG 0: 1
1: 0
2: 3
3: 33
4: 302
954754471_954754473 -1 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754473 3:52831777-52831799 GCTCCGTGACACCAGCCCTGAGG 0: 1
1: 0
2: 2
3: 13
4: 145
954754471_954754474 0 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754474 3:52831778-52831800 CTCCGTGACACCAGCCCTGAGGG 0: 1
1: 0
2: 1
3: 11
4: 136
954754471_954754486 28 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754486 3:52831806-52831828 GCTGCCTTGGGAACCTATCGGGG 0: 1
1: 0
2: 0
3: 5
4: 60
954754471_954754477 2 Left 954754471 3:52831755-52831777 CCTGGATCAGGGAAGGACGGCGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 954754477 3:52831780-52831802 CCGTGACACCAGCCCTGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954754471 Original CRISPR CCGCCGTCCTTCCCTGATCC AGG (reversed) Intronic
900653508 1:3743091-3743113 CCGCCGTCACTGCCTGTTCCCGG - Intergenic
901644647 1:10709917-10709939 CCACCGCCCCTCCCTGGTCCGGG - Intronic
902777651 1:18684894-18684916 CTGCCGGCCTCCACTGATCCGGG + Intronic
904397056 1:30229055-30229077 TCTCCGTCCTTCTCTGATCCAGG + Intergenic
907298415 1:53470269-53470291 CAGCCGTCATTCCCTGACCCCGG + Intergenic
912512980 1:110201021-110201043 ACGCCCTCCTTCCCTGTTTCTGG - Exonic
912577129 1:110683147-110683169 CATCCGTCCTTGCCTGACCCAGG + Intergenic
912689314 1:111792419-111792441 CTTCTGTCCTTCCCTGACCCTGG - Intronic
916213059 1:162373966-162373988 CTGCTGTCCTTCCCAGAACCCGG - Exonic
919705067 1:200668688-200668710 CCTCCTTCCTTCCCAGATCCAGG + Intronic
1064208884 10:13347535-13347557 CCGGCGTCCTCCCCGGCTCCTGG - Intronic
1064267881 10:13839710-13839732 CCCCCTTCCTTTCCTGAACCAGG - Intronic
1067038051 10:42933618-42933640 CCGCCGGCCTTCCCAGGCCCCGG + Intergenic
1070573321 10:77658171-77658193 CTTCCTTCCTTCCCAGATCCAGG - Intergenic
1074285926 10:112098251-112098273 CCTCAGTCCTTCCCAGACCCTGG + Intergenic
1076633784 10:131869499-131869521 CCGCCTTCCTGCCCAGATGCGGG + Intergenic
1077405954 11:2382622-2382644 CTGCCCACCTGCCCTGATCCTGG - Intronic
1077434464 11:2532137-2532159 CCGCCGACCTGCCCTGTTCTGGG + Intronic
1077497884 11:2895326-2895348 CAGCCTCCCTTCCCTGCTCCAGG - Intronic
1079452002 11:20605691-20605713 CCGCCGCTCTTCGCAGATCCCGG - Intronic
1083012798 11:59419885-59419907 CTTCCTTCCTTCCCTGATCTAGG - Intergenic
1083055155 11:59812108-59812130 CTTCCTTCCTTCCCAGATCCAGG - Intergenic
1084383117 11:68826057-68826079 CCGCCTTCCCTCCCTGGCCCTGG + Intronic
1085744850 11:79106235-79106257 CTGCCCTCCTTCCCTCATCTAGG - Intronic
1085839642 11:79996702-79996724 CCTCCATCCTTCCCTGTGCCTGG - Intergenic
1086537430 11:87865099-87865121 CCTCCATCCTTCCCTGTTCTTGG - Intergenic
1089177132 11:116557142-116557164 CAGGTGTCCTTACCTGATCCAGG - Intergenic
1092408759 12:8238585-8238607 CCCCCGTCCTTCCCAGGCCCTGG - Intergenic
1094181782 12:27599321-27599343 GCACAGTCCTTCCCTGCTCCTGG + Intronic
1096680395 12:53252031-53252053 CCGCCCTCCTTCCCTTACCCGGG - Exonic
1100329411 12:93570626-93570648 TCGCTATCCTTCCCTGAACCCGG + Intronic
1102524803 12:113504741-113504763 CCACCTTCCTTCCTTCATCCTGG + Intergenic
1103283979 12:119784921-119784943 CCGGCCTCCTTCCTTGCTCCAGG - Intronic
1105748550 13:23400091-23400113 CTTCCTTCCTTCCCAGATCCAGG - Intronic
1107701671 13:43054936-43054958 CCGCCCTCCTTCTGTGCTCCAGG - Intronic
1113431216 13:110251692-110251714 TCGCCGTCTTTCCCTCATCCTGG - Intronic
1113582399 13:111438508-111438530 CCACCGTCCTGCCCTGATAGGGG + Intergenic
1113628753 13:111865813-111865835 CCTCATTCTTTCCCTGATCCAGG - Intergenic
1113795208 13:113053239-113053261 GCGCCGTCCTTCACTGGACCTGG - Intronic
1117254376 14:53963398-53963420 CCGCATTCCCTCCCTGATCAGGG + Intergenic
1122114422 14:99520605-99520627 CCGCCGACCAGCCCTGATCATGG + Intronic
1122635561 14:103128090-103128112 CAGCGGTCCTTCTCTGAGCCAGG + Intronic
1122783985 14:104155575-104155597 TCGCCGTCCTCCCCTGCCCCCGG + Intronic
1122796116 14:104207081-104207103 CCATCTTCCCTCCCTGATCCAGG - Intergenic
1123405786 15:20018749-20018771 CTGCAGGCCTTCACTGATCCTGG + Intergenic
1123515116 15:21025397-21025419 CTGCAGGCCTTCACTGATCCTGG + Intergenic
1124389847 15:29244595-29244617 CCACGCTGCTTCCCTGATCCAGG - Intronic
1127126423 15:55816913-55816935 AAACCGTCCATCCCTGATCCAGG - Intergenic
1128118462 15:65128283-65128305 CCTTCATCCTTCCCTGATCTGGG - Intronic
1132314186 15:100879037-100879059 CCGCCTTCCATCCCAGAGCCCGG - Intronic
1132688377 16:1171662-1171684 CCTCCGTCCTTCCCGCCTCCTGG + Intronic
1132713647 16:1280019-1280041 ACCCCGTCCTTCCCTGACCTGGG - Intergenic
1133349727 16:5093402-5093424 CCCCCGTCCTTCCCAGGCCCTGG - Intronic
1133575664 16:7086922-7086944 CGGCCCTCCTTCCCTTTTCCCGG + Intronic
1134073754 16:11276416-11276438 CCGCCCTCCTCCCCTACTCCAGG - Exonic
1138848729 16:60599854-60599876 CAGCCTTCATTACCTGATCCTGG - Intergenic
1139569902 16:67805390-67805412 CCACCCTCTTTCCCTGATCATGG - Intronic
1139956216 16:70694201-70694223 CTGCCCTCCCTCCCTGACCCTGG - Intronic
1140406409 16:74714155-74714177 CCTCCGTCCTGCCCTCAGCCCGG - Exonic
1142624038 17:1180883-1180905 CTCCTGTCCTTCCCTGCTCCAGG - Intronic
1142698524 17:1646326-1646348 ACCCCGTCCTGCCCTGATGCAGG + Exonic
1143537178 17:7548647-7548669 CTGCCCTTCTTCCCTGAACCAGG + Intergenic
1144964913 17:19070737-19070759 CCGCTGTCTGTCCCTGCTCCTGG - Intergenic
1144983054 17:19181441-19181463 CCGCTGTCTGTCCCTGCTCCTGG + Intergenic
1144985170 17:19196798-19196820 CCGCTGTCTGTCCCTGCTCCTGG - Intergenic
1145087735 17:19956902-19956924 CCTCCTTCCTTCCCTCAACCAGG - Intronic
1147150785 17:38512456-38512478 TCGCCCTCCTTCCCTGGGCCAGG - Intergenic
1148075120 17:44931322-44931344 CAGCCGCCCTGCCCTGACCCAGG + Intronic
1148510265 17:48162893-48162915 CCGCCAGACTTTCCTGATCCAGG + Intronic
1148955899 17:51353407-51353429 CGGCAGTCCTTCCCTGAGCGGGG - Intergenic
1151597569 17:75087835-75087857 CCGCCGCCCCTCCCGCATCCTGG + Intronic
1151724515 17:75876549-75876571 CCCCCCTCCTTCCCTGACCCCGG + Intronic
1151812437 17:76452650-76452672 ACGCCGTCCTTCCCTGGCCTCGG + Intronic
1152814268 17:82398139-82398161 CCACCGTGCTTGCCTGAGCCAGG + Intronic
1160519375 18:79495207-79495229 CCTCCGTCCTTCCCTGAGGTGGG + Intronic
1161335415 19:3710326-3710348 CGGCTGTCCTTCTCTGAGCCAGG - Intronic
1162567264 19:11451235-11451257 CCCCCGTCCTTCTCTGGGCCTGG - Intergenic
1164783867 19:30914001-30914023 CCATCGTCCTGCCCTGCTCCTGG + Intergenic
1164825754 19:31283853-31283875 CTCCCCTCCTTGCCTGATCCAGG - Intronic
1165996285 19:39846249-39846271 CCGGCCTCCGTCCCTGACCCCGG + Intronic
927459315 2:23284344-23284366 CCCCCCTTCTTCCATGATCCAGG - Intergenic
928682243 2:33714448-33714470 CTTCCTTCCTTCCCAGATCCAGG - Intergenic
929537631 2:42793234-42793256 TCGCGGTCCTGCCCTGAGCCCGG - Intergenic
931632243 2:64311610-64311632 TCACCTTCCTTCCCTGAGCCTGG - Intergenic
936524577 2:113234126-113234148 CTGGCTTCCTTCCCTGGTCCTGG + Intronic
936787731 2:116114508-116114530 CTCCCTTCCTTCCCAGATCCAGG - Intergenic
948147085 2:235716012-235716034 CCGCCGTCCACCCCAGCTCCAGG - Intronic
1168849231 20:965281-965303 CTCCCGTCCCTCCCTGAGCCTGG - Intronic
1171122532 20:22579163-22579185 GCGCCCCCCTTCACTGATCCCGG - Intergenic
1171404443 20:24900406-24900428 CCGCTTTCCTCCCCTGATGCTGG + Intergenic
1172050276 20:32111929-32111951 CCGCAGTCCTTCCCATTTCCAGG - Intronic
1172926949 20:38546498-38546520 AGGCTGTCCTTCCCTGATCCTGG - Intronic
1173649293 20:44652691-44652713 CCTCCGTCCTTACCTCCTCCCGG - Intergenic
1174509753 20:51042144-51042166 CCGCTCTCTCTCCCTGATCCAGG + Intergenic
1179934035 21:44591230-44591252 CCCCTGTCCTTCCCAGATGCTGG - Intronic
1181867225 22:25868343-25868365 CCGCCTTCTTTTCCAGATCCAGG - Exonic
1183086713 22:35491420-35491442 CGGTCGACCTTCCCTGCTCCAGG + Intergenic
1185311954 22:50161176-50161198 CCACCGTCCTCACCTCATCCTGG + Intronic
951137220 3:19118181-19118203 CTGCCACCCTTCCCTCATCCTGG - Intergenic
954754471 3:52831755-52831777 CCGCCGTCCTTCCCTGATCCAGG - Intronic
961185085 3:124907766-124907788 CCAGTGTCCTTCCCTGGTCCTGG + Intronic
961349615 3:126291588-126291610 CCGGCCTCCTTCCCTCCTCCAGG - Intergenic
961887698 3:130107127-130107149 CCCCCGTCCTTCCCAGGCCCTGG - Intronic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
969060740 4:4432379-4432401 CCACAGTCCTTCCCTGCTCATGG + Intronic
975672483 4:76795462-76795484 CTGCCCTTCTTCCCTGACCCAGG - Intergenic
982226578 4:153172726-153172748 CCACCTCCCTCCCCTGATCCTGG - Intronic
984639118 4:182143923-182143945 CCTCCCTCCTTCCCTCCTCCCGG - Intergenic
984715025 4:182917359-182917381 CCGACTTCCTTCCCTGAGCACGG - Exonic
985729933 5:1541459-1541481 CCACCTTCCTTCACTGGTCCTGG - Intergenic
987199691 5:15563597-15563619 CCTCCTTCCTTCTCTGCTCCTGG + Intronic
989541651 5:42625803-42625825 CTTCCTTCCTTCCCAGATCCAGG - Intronic
989830207 5:45907469-45907491 CATCCTTCCTTCCCAGATCCAGG - Intergenic
991392762 5:66166120-66166142 CCACTGTCCTTTCCTGATTCTGG - Intronic
995663273 5:114510338-114510360 CTTCCTTCCTTCCCAGATCCAGG + Intergenic
997561035 5:134846244-134846266 CCGCCGCCCTACCCCGCTCCCGG - Intronic
998060504 5:139115128-139115150 CCTCCCTCCCTCCCTGATCCTGG - Intronic
999558725 5:152775139-152775161 CTTCCTTCCTTCCCAGATCCAGG - Intergenic
1000040180 5:157479551-157479573 CGGCCCTCCTTCCCTGCTGCAGG + Exonic
1001639329 5:173233998-173234020 CCGGCCTCCCTCCCCGATCCTGG + Intronic
1002800167 6:514825-514847 CCGCCCTCCTCCCCTCCTCCTGG - Intronic
1006154507 6:32007007-32007029 CCGCAGTTCTTCCCCAATCCAGG + Intergenic
1006160819 6:32039743-32039765 CCGCAGTTCTTCCCCAATCCAGG + Exonic
1006413633 6:33890604-33890626 CTTCCTTCCTTCCCAGATCCAGG + Intergenic
1006650164 6:35544941-35544963 CTGCCCTCCTTCCCTGACCCTGG - Intergenic
1007601115 6:43081901-43081923 AGACCTTCCTTCCCTGATCCTGG + Intronic
1008131062 6:47720530-47720552 CAGTCCTCCTTCCCTGACCCTGG - Intronic
1011527249 6:88278108-88278130 CAGCCATCCTTGCCTGAGCCTGG - Intergenic
1015285877 6:131485830-131485852 CCACAGTCCTTGCCTGAGCCTGG - Intergenic
1017959682 6:159210818-159210840 CAGCCGACCTTCACTGCTCCCGG + Intronic
1020321117 7:6939441-6939463 CCCCCGTCCTTCCCAGGCCCTGG - Intergenic
1021689778 7:23220823-23220845 TCTCCCTCCTTCCCTGACCCAGG - Intergenic
1023995743 7:45157974-45157996 CCGCGGTCCTTCCCTTGCCCCGG + Intronic
1024855051 7:53769452-53769474 CCCCCCTGCTTCCCTGATCCAGG + Intergenic
1029526988 7:101100743-101100765 ACGGCGTCCTTCCCTGCTTCTGG + Intergenic
1029917939 7:104231288-104231310 CCGCCCTCCTTTCCCGCTCCAGG + Intergenic
1032411555 7:131697151-131697173 CTGCAGTCCTTCTCTGAGCCAGG + Intergenic
1032919902 7:136534029-136534051 CTGCCGCCCTTCCCCGGTCCTGG - Intergenic
1033159275 7:138981759-138981781 TTGCCGGCCTACCCTGATCCGGG - Intergenic
1034286691 7:149888640-149888662 CCTCCTTCCTTCCCTGTTCCTGG - Intergenic
1035303097 7:157910351-157910373 CCGGCGTACGTGCCTGATCCTGG - Intronic
1035303115 7:157910435-157910457 CCGGCGTACGTGCCTGATCCTGG - Intronic
1035481494 7:159190879-159190901 CCCCAGTCCTTCCCTTATGCAGG - Intergenic
1041609326 8:59826279-59826301 CTTCCTTCCTTCCCAGATCCAGG + Intergenic
1044012552 8:87012553-87012575 CGGCCTTCCTTCCCAGATCCAGG + Intronic
1045556800 8:103222253-103222275 CTTCCTTCCTTCCCAGATCCAGG - Intronic
1047194112 8:122705897-122705919 TAGCCGTCATTCCATGATCCAGG + Intergenic
1049166084 8:141127469-141127491 TCTCCCTCCTTCCCTGAGCCGGG - Intronic
1050431118 9:5562802-5562824 CTGCCTGCCTTCCCTGGTCCAGG - Intronic
1053381778 9:37654978-37655000 CCTCCCTCCTTCCCTGCCCCCGG + Intronic
1056283677 9:85066737-85066759 CCCAGGTCCTTTCCTGATCCAGG + Intergenic
1057239848 9:93399072-93399094 CTGCCCTCCCTCCCTGATGCGGG + Intergenic
1057349327 9:94281973-94281995 CTTCCTTCCTTCCCAGATCCAGG - Intronic
1057748770 9:97773167-97773189 CCACCATACTTCCCTGATTCTGG - Intergenic
1060295351 9:122339388-122339410 CAGCCGTCCTTCCCTCGTCCTGG - Intergenic
1061200118 9:129133171-129133193 CCGCCTTCCTTCCCTGAGGCAGG + Intronic
1187257644 X:17656682-17656704 CCTCCTCCCTACCCTGATCCCGG + Intronic
1197807616 X:130412670-130412692 CCGCCCTCTGTCCCTAATCCTGG - Exonic
1200018274 X:153181470-153181492 CCGAGGTCCTTCCGTTATCCTGG + Intronic