ID: 954754789

View in Genome Browser
Species Human (GRCh38)
Location 3:52833286-52833308
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954754789_954754796 21 Left 954754789 3:52833286-52833308 CCGAGCATTCGGGCAGCAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 954754796 3:52833330-52833352 GAAGACACTCTTGGTGGGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 138
954754789_954754798 28 Left 954754789 3:52833286-52833308 CCGAGCATTCGGGCAGCAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 954754798 3:52833337-52833359 CTCTTGGTGGGTCCGGCTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 88
954754789_954754794 16 Left 954754789 3:52833286-52833308 CCGAGCATTCGGGCAGCAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 954754794 3:52833325-52833347 CAGCCGAAGACACTCTTGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
954754789_954754793 15 Left 954754789 3:52833286-52833308 CCGAGCATTCGGGCAGCAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 954754793 3:52833324-52833346 TCAGCCGAAGACACTCTTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 58
954754789_954754797 27 Left 954754789 3:52833286-52833308 CCGAGCATTCGGGCAGCAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 954754797 3:52833336-52833358 ACTCTTGGTGGGTCCGGCTTTGG 0: 1
1: 0
2: 0
3: 2
4: 43
954754789_954754792 12 Left 954754789 3:52833286-52833308 CCGAGCATTCGGGCAGCAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 954754792 3:52833321-52833343 TTCTCAGCCGAAGACACTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954754789 Original CRISPR CCCCTTGCTGCCCGAATGCT CGG (reversed) Exonic