ID: 954754793

View in Genome Browser
Species Human (GRCh38)
Location 3:52833324-52833346
Sequence TCAGCCGAAGACACTCTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954754789_954754793 15 Left 954754789 3:52833286-52833308 CCGAGCATTCGGGCAGCAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 954754793 3:52833324-52833346 TCAGCCGAAGACACTCTTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 58
954754786_954754793 22 Left 954754786 3:52833279-52833301 CCTGTTTCCGAGCATTCGGGCAG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 954754793 3:52833324-52833346 TCAGCCGAAGACACTCTTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954754793 Original CRISPR TCAGCCGAAGACACTCTTGG TGG Exonic