ID: 954754797

View in Genome Browser
Species Human (GRCh38)
Location 3:52833336-52833358
Sequence ACTCTTGGTGGGTCCGGCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954754789_954754797 27 Left 954754789 3:52833286-52833308 CCGAGCATTCGGGCAGCAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 954754797 3:52833336-52833358 ACTCTTGGTGGGTCCGGCTTTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954754797 Original CRISPR ACTCTTGGTGGGTCCGGCTT TGG Exonic
920873659 1:209814975-209814997 AGTCTTGATGGGTCCTTCTTTGG - Intergenic
1075494664 10:122909638-122909660 ACTCCAGGTGGCTCCAGCTTGGG - Intergenic
1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG + Intronic
1101897943 12:108769886-108769908 TCTCTTGCTGGTTCCAGCTTCGG - Intergenic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1106552454 13:30783970-30783992 CCTCTTTGTGTGTCAGGCTTGGG + Intergenic
1108701745 13:52949787-52949809 ACTCCTGCTGGATCCGTCTTGGG + Intergenic
1113735061 13:112672579-112672601 CCTCTTGGTGGGGCCTGCTGGGG - Intronic
1116294902 14:43094575-43094597 ACTGTTGGTGGGTAGGGGTTGGG + Intergenic
1129328329 15:74813571-74813593 ACTCTTTGTAGGTCTGGGTTTGG - Intronic
1151956896 17:77384620-77384642 ACTCTTGGTGGTTCTGGCTCAGG - Intronic
1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG + Intronic
1162524829 19:11201200-11201222 ACTCTGGGGGGGTCCAGCCTTGG + Intronic
1162885018 19:13690540-13690562 TCTCTAGGTGGGACCAGCTTTGG - Intergenic
926327645 2:11799141-11799163 GCTGTTGGTGGTTTCGGCTTAGG - Intronic
934085303 2:88504389-88504411 AGTGTTGGTGGGTCCGGAATCGG - Intergenic
935348364 2:102130490-102130512 ACTCTTGGTGGCACAAGCTTGGG + Intronic
937427410 2:121811870-121811892 ACCCTTTGTGGGTCTGGCCTTGG + Intergenic
941062032 2:160857642-160857664 ACTCCTGGGGGCTCCGCCTTTGG - Intergenic
942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG + Intronic
946054765 2:216891094-216891116 TTTCCTGGTGGGTCCTGCTTTGG - Intergenic
948922071 2:241070548-241070570 GCTCTTCGTGGGTCAGGCCTGGG - Intronic
1168877990 20:1184677-1184699 GGTCTTGGTGGATCTGGCTTGGG - Intronic
1176080026 20:63267840-63267862 TCTCTTGGTGTGTCCGGCCAGGG - Intronic
1182533988 22:30986300-30986322 ACTCTTAGTGAGTCCAGCTAGGG - Intergenic
1184075925 22:42177908-42177930 ACTCTTGGTGGTTCCTGGATGGG + Intronic
1184367705 22:44063015-44063037 ACTCTTGGTGGCTCCTGGGTGGG - Intronic
1185218717 22:49618113-49618135 CCTCCTGGTGGGTAGGGCTTGGG - Intronic
954133135 3:48570118-48570140 ACTCACGGTGGGTCCCGCTGGGG - Exonic
954642924 3:52112768-52112790 ACTCGTCGTGGGTACAGCTTGGG - Intronic
954754797 3:52833336-52833358 ACTCTTGGTGGGTCCGGCTTTGG + Exonic
962920133 3:139943161-139943183 ACTCTTGGGGGCTCTGGCTTGGG - Intronic
968848867 4:3063989-3064011 ACTCTTGGTGGCTCCTGGATAGG + Intergenic
978892938 4:113851830-113851852 TCTCTTGGTGGGTCTGACTCAGG + Intergenic
985674586 5:1224477-1224499 CCTCCTGGGGGGTCTGGCTTTGG + Exonic
989038429 5:37199889-37199911 ACTCTTAGTGAGACTGGCTTGGG - Intronic
997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG + Intronic
1006283529 6:33076159-33076181 ATTCTTGGAGGGTCTGGCTCAGG + Intronic
1013130016 6:107223761-107223783 GCTCTTGGTGGGTCGGGGTCGGG - Intronic
1022499990 7:30876779-30876801 ATTCTTGGAGGGTCCGGATGAGG + Intronic
1032448383 7:132004176-132004198 ACTCCTGGTGAGTCCTTCTTTGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1042454474 8:68984641-68984663 ACTGTTGGTGGCTCAGGATTAGG - Intergenic
1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG + Intronic
1187318534 X:18220415-18220437 GCTCTTGGTGGCTCAGGGTTGGG - Intronic
1198603829 X:138314551-138314573 ACTCTTAGTGGGTCTATCTTAGG - Intergenic