ID: 954755152

View in Genome Browser
Species Human (GRCh38)
Location 3:52835217-52835239
Sequence CAGCTGTCCCAGAGGGCAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 249}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954755152_954755160 -6 Left 954755152 3:52835217-52835239 CCCTTTGCCCTCTGGGACAGCTG 0: 1
1: 0
2: 0
3: 26
4: 249
Right 954755160 3:52835234-52835256 CAGCTGCTTGATTCGCCGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 44
954755152_954755156 -10 Left 954755152 3:52835217-52835239 CCCTTTGCCCTCTGGGACAGCTG 0: 1
1: 0
2: 0
3: 26
4: 249
Right 954755156 3:52835230-52835252 GGGACAGCTGCTTGATTCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 91
954755152_954755159 -7 Left 954755152 3:52835217-52835239 CCCTTTGCCCTCTGGGACAGCTG 0: 1
1: 0
2: 0
3: 26
4: 249
Right 954755159 3:52835233-52835255 ACAGCTGCTTGATTCGCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 51
954755152_954755157 -9 Left 954755152 3:52835217-52835239 CCCTTTGCCCTCTGGGACAGCTG 0: 1
1: 0
2: 0
3: 26
4: 249
Right 954755157 3:52835231-52835253 GGACAGCTGCTTGATTCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 82
954755152_954755158 -8 Left 954755152 3:52835217-52835239 CCCTTTGCCCTCTGGGACAGCTG 0: 1
1: 0
2: 0
3: 26
4: 249
Right 954755158 3:52835232-52835254 GACAGCTGCTTGATTCGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 43
954755152_954755164 12 Left 954755152 3:52835217-52835239 CCCTTTGCCCTCTGGGACAGCTG 0: 1
1: 0
2: 0
3: 26
4: 249
Right 954755164 3:52835252-52835274 GGGGGAGGTGCTGGCACTGACGG 0: 1
1: 0
2: 3
3: 49
4: 553
954755152_954755162 3 Left 954755152 3:52835217-52835239 CCCTTTGCCCTCTGGGACAGCTG 0: 1
1: 0
2: 0
3: 26
4: 249
Right 954755162 3:52835243-52835265 GATTCGCCGGGGGGAGGTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 103
954755152_954755161 -3 Left 954755152 3:52835217-52835239 CCCTTTGCCCTCTGGGACAGCTG 0: 1
1: 0
2: 0
3: 26
4: 249
Right 954755161 3:52835237-52835259 CTGCTTGATTCGCCGGGGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954755152 Original CRISPR CAGCTGTCCCAGAGGGCAAA GGG (reversed) Exonic
900356668 1:2268287-2268309 CAGGTGTCTCAGAGGGCTCAGGG + Intronic
901771295 1:11531642-11531664 CAGCTGTCCCACGGGGCAGTGGG + Exonic
902200687 1:14831207-14831229 CAGCTGTACCTGAAGCCAAATGG - Intronic
902360022 1:15937295-15937317 CAAGTGTCCCAGGAGGCAAAGGG + Exonic
902701373 1:18174754-18174776 CAGCTACCCCAGTGGGCAACGGG - Intronic
903853137 1:26320324-26320346 CAGCTGTTTCAGGGGGCACAGGG - Exonic
904679012 1:32215902-32215924 CAGCAGCTCCAGAGGGCAACTGG + Exonic
904995051 1:34625235-34625257 CAGCTGTACCACATGGCAAAGGG - Intergenic
905107091 1:35570428-35570450 CAGGTATCCCAGAGGGCACATGG - Intergenic
905280968 1:36849259-36849281 CAGCTGCCTCTGAGGGCACATGG + Intronic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
908078639 1:60549071-60549093 CATCTCTCCCAGTGGGCAACTGG - Intergenic
908563357 1:65329409-65329431 CAGCTGACCCAGAGAGCATCTGG + Intronic
910864107 1:91771934-91771956 CAGCTGGGCCAGAGGGTGAATGG + Intronic
912500695 1:110120166-110120188 CATCTGCCCCAGAGGGCACCAGG - Intergenic
914336068 1:146715990-146716012 CACCTGTTCCTGAGGGTAAAAGG + Intergenic
914916919 1:151824641-151824663 CAGCTCTCCCAGAGGTTAGAAGG - Intronic
915891551 1:159778882-159778904 CAGCAGACCCAGAGTGGAAAGGG - Intergenic
916519839 1:165553717-165553739 CTGCAGTCCCAGAGGGCAGAGGG - Intronic
917801479 1:178574591-178574613 CAGATGTCTCAGTGGGCAAATGG - Intergenic
918143286 1:181735491-181735513 AAGCTGTCACAGTGGGGAAAGGG - Intronic
920082085 1:203382229-203382251 CAGCAGCCCCAGAGGACAAGAGG - Intergenic
920227145 1:204447119-204447141 CAGCTGCCCCAGTGGACAGAAGG + Intronic
920424142 1:205859977-205859999 CAACTGTTCCTGAGGGTAAAGGG - Intergenic
921164045 1:212493545-212493567 CTTCAGTCCCAGAGGGGAAATGG - Intergenic
921931261 1:220756122-220756144 CAGAAGTCCCATAGGCCAAAAGG - Intronic
922458716 1:225798382-225798404 CAACTGTTCCTGAGGGTAAAGGG + Intergenic
922980108 1:229818530-229818552 CAGCCTTCCCAGAGGTCAGAAGG + Intergenic
1067710622 10:48648675-48648697 CAGCTGTCCTGGGGGGAAAATGG + Intronic
1067729725 10:48801568-48801590 CAGCTGTCCCAAATGGCAGCTGG + Intronic
1067778474 10:49179725-49179747 CAGATGTCCCAGATGGGAATTGG + Intronic
1070148465 10:73791365-73791387 CAGCAGTGCCAGTGGGCACACGG + Exonic
1070462066 10:76680329-76680351 CAGCTGCCCCAGAGGGCATGTGG - Intergenic
1070760194 10:79019454-79019476 CAGGTGTCCAAGAGGGAAAGGGG - Intergenic
1070761832 10:79028734-79028756 CAGCTGCCCCAGAGGCCATCTGG - Intergenic
1070941432 10:80351601-80351623 GTGCTGTCACAGAAGGCAAAGGG - Intronic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1073488926 10:103839813-103839835 CAGCCGAACCAGGGGGCAAATGG + Intronic
1074155387 10:110794132-110794154 CAGATCTCCCACAGGGCATAGGG + Intronic
1075261035 10:120963962-120963984 CACCTGTCCAAGAAGACAAAGGG + Intergenic
1075489527 10:122854682-122854704 CATGTGTTCCAGATGGCAAAAGG + Intronic
1075710849 10:124529883-124529905 CAGCTGCCCCAGCGGGGAAGGGG + Intronic
1076800419 10:132820409-132820431 CCGCTGACCCGCAGGGCAAAGGG + Intronic
1076831221 10:132995272-132995294 CAGCCGTCCCAGAGGACGCACGG - Intergenic
1076831247 10:132995398-132995420 CAGCCGTCCCAGAGGACGCACGG - Intergenic
1076940664 10:133604977-133604999 CAACTGTTCCCGAGGGTAAAGGG - Intergenic
1077338169 11:2014587-2014609 CCCGTGTCCCAGAGGGCACAGGG - Intergenic
1077564747 11:3290448-3290470 CAGCTGGCTCAGTGGGGAAAAGG + Intergenic
1077570637 11:3336265-3336287 CAGCTGGCTCAGTGGGGAAAAGG + Intergenic
1080308699 11:30865013-30865035 CATCTGTCCCACTGTGCAAATGG + Intronic
1080578109 11:33618203-33618225 TAGCTGTCCTAGAGGGTCAAGGG + Intronic
1083621987 11:64053728-64053750 CAGCAGTCCCAGAGAGCGGAAGG - Intronic
1085117714 11:73944993-73945015 CAGCTGATCCTGAGGGTAAAGGG + Intergenic
1087779665 11:102288773-102288795 CAGCTGGGCCTGAGGCCAAATGG - Intergenic
1087980842 11:104612399-104612421 GAGCTAGCCCAGAGGGCAAGGGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089198757 11:116710844-116710866 GAGCTGTGCCAGAGGAGAAATGG + Intergenic
1089281824 11:117380077-117380099 CAGCTGTGCCAGAGACAAAAAGG - Intronic
1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG + Intergenic
1202821153 11_KI270721v1_random:69769-69791 CCCGTGTCCCAGAGGGCACAGGG - Intergenic
1091648015 12:2288482-2288504 AAGCTGACTCAGAGGGAAAATGG - Intronic
1092143443 12:6199664-6199686 TAGTTGCCCCAGAGGGAAAAAGG - Intergenic
1092754872 12:11753745-11753767 CTTCTGCCCCAGAGGGCAGACGG + Intronic
1095583517 12:43826412-43826434 CAGCAGTCCCAGCTGGCAATTGG - Intergenic
1095710205 12:45280112-45280134 CATCCTTGCCAGAGGGCAAAAGG - Intronic
1096040286 12:48509279-48509301 CAACTGTTCCTGAGGGTAAAGGG - Intronic
1096729098 12:53592122-53592144 CAGCAGTCACACAGGGCACATGG + Intronic
1097035376 12:56120420-56120442 CAGGTGGCCCAGAGGGGCAATGG - Intronic
1099456739 12:82872193-82872215 CCTCTGTCCCAGAAGGGAAATGG + Intronic
1101252540 12:102950405-102950427 ACGCTGGCCCCGAGGGCAAAGGG - Intronic
1101310378 12:103573441-103573463 CAGCTGTCCCAGATGACTACTGG + Intergenic
1103666779 12:122573814-122573836 CAGCTGTCTCAGTGAGCAGAGGG + Intronic
1104218397 12:126757766-126757788 CAGCTGTCCCTGCAGGCAATAGG + Intergenic
1105264842 13:18806665-18806687 CAGCTGTCTCACATGGCAAGGGG + Intergenic
1110495667 13:76164570-76164592 CTGCTGTTCCAGAGTGCAATGGG + Intergenic
1112327742 13:98454461-98454483 CATCTCTCCCAGAGAACAAATGG + Intronic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1116007480 14:39310825-39310847 GAGCAGTCCCAAAGGGCCAAAGG - Intronic
1117196679 14:53346809-53346831 CAGTTGTCCCTGAGGGCATGGGG + Intergenic
1118493892 14:66288745-66288767 CAGCTGTCCCAGTGACTAAAGGG + Intergenic
1119190738 14:72680135-72680157 AGGCTGGACCAGAGGGCAAAGGG + Intronic
1119634527 14:76263217-76263239 CAGCTCTCCCAGAACTCAAATGG - Intergenic
1120699570 14:87684079-87684101 AAGCTGTCCCAGAGTGCCAAAGG + Intergenic
1120951527 14:90046131-90046153 CAGCTGTGCCAGAAAGCACAGGG - Intergenic
1121124509 14:91397562-91397584 CAGGTGTTGCAGAGGGCGAAAGG - Intronic
1121415344 14:93775417-93775439 CATGTCTCCCAGAGGGCACAGGG - Intronic
1122643018 14:103172310-103172332 CAACTGTTCCTGAGGGTAAAGGG - Intergenic
1123736720 15:23191677-23191699 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124222532 15:27862950-27862972 CAGCTGTCACACAGCGGAAAAGG - Intronic
1124287421 15:28414652-28414674 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287945 15:28420355-28420377 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124295281 15:28496972-28496994 CTGCTGTCCCAGTGGAAAAAGGG - Intergenic
1124463907 15:29919282-29919304 CAGCAGGCCCAGAGGGCATTAGG + Intronic
1124566252 15:30816824-30816846 CAGATGCACCAGCGGGCAAAAGG - Intergenic
1124862812 15:33459356-33459378 CAGCTCTACCCCAGGGCAAAAGG - Intronic
1126495897 15:49290304-49290326 CAGCTGTCATTGAGGGCATATGG + Intronic
1128928305 15:71679356-71679378 TAGCTGTAACAGAGGCCAAATGG - Intronic
1129627250 15:77214719-77214741 CAACTGTGGCAGAAGGCAAAAGG + Intronic
1131426868 15:92352852-92352874 CAGATGTTTCAGAGGGCAAAGGG - Intergenic
1131657430 15:94476260-94476282 CAAATGTCCCAGATGGGAAAAGG - Intronic
1132859814 16:2064639-2064661 CAGCTGTCCCAGAGTGTGACAGG - Intronic
1132888783 16:2194333-2194355 CAGCTGTCCTTGAGGGGAAGAGG - Intronic
1133116710 16:3581707-3581729 CAGCTGTCCCAGGGGGCAGTGGG - Exonic
1133367785 16:5224617-5224639 CAGTCGTTCCTGAGGGCAAAGGG + Intergenic
1137581996 16:49639230-49639252 CACCAGTCCCATAGGCCAAAAGG + Intronic
1139997554 16:70995229-70995251 CACCTGTTCCTGAGGGTAAAAGG - Intronic
1141574005 16:84952649-84952671 GAGCTGACCCAGACGGCAGAAGG + Intergenic
1142304649 16:89278593-89278615 CTGCTGTCCCAGAAGCCCAAGGG + Intronic
1142489576 17:269637-269659 CACCTGTCACAGAGGACAATGGG + Intronic
1143171171 17:4931483-4931505 CATGTGTCACAGAGGCCAAAAGG + Intergenic
1143712646 17:8744946-8744968 CAGAAGTTCCTGAGGGCAAAGGG - Intronic
1143999289 17:11037731-11037753 CAGTTGTGGCAGAAGGCAAAGGG + Intergenic
1144654230 17:17025216-17025238 TAGCTGTCCCAGAGGGCAGCCGG + Intergenic
1145774879 17:27520819-27520841 CATTTGTCCCAGTGGCCAAAAGG + Intronic
1145959996 17:28881647-28881669 CAGCAGTCCCACAGGGGACATGG + Intronic
1146264418 17:31442550-31442572 AAGCTGCCACAGAGGCCAAATGG + Intronic
1146938682 17:36828472-36828494 CAGTTTTCCCAGAGGACCAATGG + Intergenic
1148854915 17:50573418-50573440 CACCTCTCCCAGAGGGCATTTGG + Intronic
1149538047 17:57447631-57447653 CAGTTGTCAAAGAGGGAAAAGGG - Intronic
1149640545 17:58199800-58199822 CAGGTTTTCCAGGGGGCAAATGG + Intronic
1149657203 17:58316463-58316485 CAGCTGCGCCAGAGGGCAGCCGG - Exonic
1150142769 17:62744063-62744085 CAGCTGCTCCAGAGGGCATTTGG - Intronic
1152583940 17:81180880-81180902 CAGCTATCTCAGAGCGCAAGGGG - Intergenic
1152783653 17:82237255-82237277 CAGCTGCCCCAGCGGGCTCAGGG - Exonic
1153818312 18:8810036-8810058 ATGCTGTCCCAGAAGCCAAAGGG + Intronic
1154029756 18:10743312-10743334 GAACTTTCCCAGGGGGCAAATGG + Intronic
1155150902 18:23122128-23122150 ATGGTGTCCCAGAGGGCAAAGGG + Intergenic
1156486211 18:37467315-37467337 CAGAGATCCCAGAGGGCAAGAGG + Intronic
1156586210 18:38433839-38433861 CAGCTGTTCCACAGGGCGATGGG + Intergenic
1161390755 19:4019178-4019200 CAGCTGACCCCGAGGGCAGAAGG + Intronic
1161783860 19:6311196-6311218 CAGGGGTCCCAGAGGTCAATAGG + Intronic
1162693495 19:12452884-12452906 CAACTGTTCCTGAGGGTAAAGGG - Intronic
1163832084 19:19551879-19551901 CAGCTGGGCCAGATGGCAAGCGG - Intergenic
1166883116 19:45940827-45940849 CAGCTGTCCCAGAAGCCGGAGGG - Exonic
925953619 2:8939233-8939255 TGGCTGTGCCAGAGTGCAAAGGG - Intronic
926309646 2:11666236-11666258 CTGCTGCCCCAGAGGCCACAGGG + Intronic
926714857 2:15916205-15916227 CATTTGTCTCAGAGGGAAAATGG + Intergenic
927097438 2:19758141-19758163 GAGCTGTCCCAGAGAGCCATGGG + Intergenic
928637089 2:33258001-33258023 CAGGTTTCTCAGAGGGTAAATGG - Intronic
929646610 2:43635047-43635069 CAGCTCCCACAGAAGGCAAAAGG + Intergenic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
930089427 2:47521016-47521038 CAGCTGTCGGAGACGGCCAACGG - Exonic
930690277 2:54355647-54355669 AAGCTGTCCCAGAAGGCAGCAGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931521690 2:63105068-63105090 CTGGTGTCCCCAAGGGCAAAGGG - Intergenic
933178577 2:79204170-79204192 CAGAGGTCCCAGAGGGGAAGTGG + Intronic
934991160 2:98922535-98922557 CAGCTGGCCCACTGGGCACAGGG - Intronic
936061697 2:109299026-109299048 CAGGTGACCCAGAGGGCACTGGG - Intronic
937428095 2:121816506-121816528 CACCTGCCACAGAGGGCCAAGGG - Intergenic
941490371 2:166136495-166136517 CTGCTGTCCTAGAGAGCAGAGGG - Intergenic
941778446 2:169418390-169418412 CAGCTGACCTAGAGAGCAACTGG + Intergenic
943048639 2:182889143-182889165 CAGCGGTCCCTGAGGGCAACGGG - Intergenic
943548263 2:189308303-189308325 CAGCTGTGCCTGAGTGCCAAAGG - Intergenic
946696038 2:222360220-222360242 CAGCTGTGCAAGAGAGCAAACGG - Intergenic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
948276587 2:236713792-236713814 CTGCTGTCCCAGAAGGCAGCTGG - Intergenic
948872368 2:240809445-240809467 CACCTTTCCCAGATGTCAAAAGG - Intronic
1170782645 20:19439164-19439186 CAGCTGTCACAGAGTGCTAAGGG - Intronic
1170841803 20:19930027-19930049 CACTTGTCCCAGAGTGCAGAGGG - Intronic
1172063183 20:32201031-32201053 CAGCTGCCCCAGTGGGCAACAGG + Intronic
1172323236 20:34013681-34013703 CAGCAGTCCTAGAAGTCAAAGGG - Intronic
1175280091 20:57798155-57798177 CAGCTTTTCCGGAGGGCAATTGG - Intergenic
1175891100 20:62316414-62316436 CAGCTGAGCCACAGGGCACAGGG - Intronic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1179942426 21:44648797-44648819 CAGCTGCCACAGAGAGCACAGGG - Intronic
1181549886 22:23631775-23631797 GAGGTGTGCCAGAGGGTAAACGG + Intronic
1181798506 22:25327757-25327779 GAGGTGTGCCAGAGGGTAAACGG - Intergenic
1182820028 22:33207749-33207771 CAGATATCCAACAGGGCAAAGGG + Intronic
1183796257 22:40120931-40120953 CAGGTGTCCCCAAGGGAAAAGGG + Intronic
1184488403 22:44795474-44795496 CAGCTGGCCCAGAGGGTAGAGGG - Intronic
1184595396 22:45510857-45510879 CAGCTGTCCCAGGCAACAAACGG + Intronic
1184596216 22:45515796-45515818 CAGCTTCCCCAGTGGGAAAACGG - Intronic
1184722414 22:46322613-46322635 AAGCAGGCTCAGAGGGCAAAGGG - Intronic
950346903 3:12303701-12303723 CAGCTGTCCCATAGTGGGAAAGG + Intronic
950884700 3:16353225-16353247 AATCTTTCCCAGAGGCCAAAAGG + Intronic
952558378 3:34559905-34559927 CAGGTGTCTCACAGGGCAAGAGG + Intergenic
952906658 3:38143623-38143645 CAGGAGTCCCTGAGGGCACAGGG - Intergenic
952998044 3:38904469-38904491 CAGCTGTAACAGAGGCAAAAGGG + Intronic
953795026 3:45978450-45978472 CAGATGTCAGAGAGTGCAAATGG + Intronic
954755152 3:52835217-52835239 CAGCTGTCCCAGAGGGCAAAGGG - Exonic
955082256 3:55668631-55668653 CACCAGTCCCAGAGGTCAAGAGG - Intronic
956623310 3:71242682-71242704 CAGTTGTCTCAGAGGACATATGG - Intronic
958895872 3:99828869-99828891 CAGCAGTCCCAGCAGGCAAGTGG - Intronic
961492109 3:127263454-127263476 CAGGGTTCCCAGAGGCCAAAGGG - Intergenic
962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG + Exonic
962462215 3:135624872-135624894 CACCTGTGCCAGAGGCCACATGG + Intergenic
964254947 3:154765912-154765934 CAGCTTCCCCAGAGGGCACCTGG + Intergenic
969145950 4:5124248-5124270 CAGATGTCCGAGTGAGCAAAAGG + Intronic
970427740 4:15961377-15961399 GATCTGTCCCAGAGGAGAAAAGG - Intronic
971601440 4:28596419-28596441 CAGCTGTCCCAAATGGGAGAAGG - Intergenic
972839719 4:42916236-42916258 CAGCAGACCCAGAGAGCAATTGG + Intronic
973323184 4:48830955-48830977 CAGCTGCCTGAAAGGGCAAAGGG + Intronic
973759862 4:54105695-54105717 AAGCAGTCACAGAGGGCAACAGG + Intronic
975563559 4:75729832-75729854 CAGCTGTCTCAGAAAGCAGAAGG + Intronic
977720706 4:100236856-100236878 CATCTGTCTCAGTGAGCAAAGGG + Intergenic
980148537 4:129019609-129019631 CAGCTGTGGCAGGGTGCAAATGG - Intronic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984978122 4:185249050-185249072 CAGATGTCCCACAGGAGAAAGGG - Intronic
985780921 5:1871418-1871440 TTGCTGTCCCCCAGGGCAAATGG - Intergenic
985893592 5:2735994-2736016 GAGCTGCCCCACAGGGAAAAGGG - Intergenic
986396215 5:7333347-7333369 AAACTGTCCAAGTGGGCAAAGGG - Intergenic
988140191 5:27228354-27228376 CAGGTGTCGCAGATGGGAAAAGG + Intergenic
989242536 5:39217503-39217525 CACCTGGCCCAGAAGGCAATCGG - Intronic
990700038 5:58464917-58464939 CAGCTGTGACAGAGACCAAATGG + Intergenic
993935323 5:93993266-93993288 CAGCTGTCTCTCTGGGCAAATGG - Intronic
995893233 5:116981126-116981148 CAAGTGTCCCAGAGGGCACGTGG + Intergenic
996542537 5:124645723-124645745 CAGCTGTCCCAGAGCCCCATGGG - Intronic
997689130 5:135813797-135813819 GAACTTTCCCAGAGGGCAAGAGG + Intergenic
998565788 5:143214794-143214816 CTGCTGACCCAGAAGGCCAAGGG - Intronic
999387490 5:151164934-151164956 CAGCTTCCTCAGAGGGCAACTGG - Intergenic
999435534 5:151560489-151560511 CAGCAGTCCGGGAGAGCAAATGG - Intronic
999658471 5:153833765-153833787 CATCTGTGCCAGAGGGGAAAGGG + Intergenic
1000344569 5:160304034-160304056 CAGGTGTCCCAGGGAGAAAATGG - Intronic
1000772711 5:165376702-165376724 AAGCTGTGCTAGAGGGCAACTGG + Intergenic
1001265251 5:170269397-170269419 CAGCTCTTCCACAGGGAAAAGGG + Intronic
1002094700 5:176824013-176824035 CACCTGTCCCAGCTGGCGAATGG + Intronic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1005406169 6:25490165-25490187 CTGCTTTCCCTGAGGGCACAGGG - Intronic
1006977573 6:38117696-38117718 CGGCTGTCCCAGAAGTGAAAGGG - Intronic
1012323642 6:97885424-97885446 CGGCTGTCACAGAGGGGAAGCGG + Intergenic
1016845362 6:148563529-148563551 GAGCTATTCCAGAGGACAAAGGG - Intergenic
1016927181 6:149362341-149362363 CAGCTATGGCAGAAGGCAAAGGG + Intronic
1018223755 6:161607854-161607876 CAGCCGTCACAGTGAGCAAATGG + Intronic
1018245298 6:161816839-161816861 CAGATGTCCCAAATGGCAACAGG + Intronic
1019291612 7:253233-253255 CAGCTGTCCAAGGTGGCAGATGG + Intronic
1020615371 7:10453135-10453157 AAGCTGTACCAGAGTGCAGAAGG + Intergenic
1021643275 7:22761607-22761629 CATCTGTCCCTGTGGGGAAATGG - Intergenic
1021694371 7:23261952-23261974 CAACTGGCCCAGTGGGAAAAGGG - Intronic
1022133474 7:27425398-27425420 CAGCTGCCCCAGTGGGCAGCTGG + Intergenic
1024547689 7:50536148-50536170 CAGCTATCTCAGTGGGCAGAGGG - Intronic
1024617471 7:51127753-51127775 GAGCAGTCCCAGAGAGCAAAGGG + Intronic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1025143565 7:56485072-56485094 CAACTGTCCCTGAGGACATATGG - Intergenic
1028743874 7:94306274-94306296 AAGCTATTCCAGAGGGCACAGGG - Intergenic
1029723728 7:102388135-102388157 GAGCTGCCTCAGAGGGCACAAGG + Intronic
1034011800 7:147536521-147536543 CAGAAGTCCCAGTGGGCACAAGG - Intronic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1036621603 8:10427757-10427779 TGGCTGTCCCCGAGGGTAAATGG - Intronic
1037645728 8:20791065-20791087 CAGCTGCCCCAGATGCCACAGGG + Intergenic
1037718685 8:21422270-21422292 CAGCTGTCTCATAGGGAAACAGG + Intergenic
1038195740 8:25365696-25365718 CATCTGCCACAGAGTGCAAAGGG + Intronic
1038744055 8:30240881-30240903 AAGCTGTACCAGAGTGCAGAAGG + Intergenic
1038952359 8:32429414-32429436 AAGCTGAGCCAGTGGGCAAAAGG - Intronic
1039276617 8:35939614-35939636 CAGGTGTTCCAGGGTGCAAAAGG - Intergenic
1041081368 8:54218141-54218163 CAGCAGACCCAGTGGGCCAATGG + Intergenic
1041194534 8:55387628-55387650 CAGCTCACTCAGAGGGCAGAAGG - Intronic
1042477737 8:69267812-69267834 AAGATGTCCCAGGAGGCAAAAGG - Intergenic
1046021883 8:108675148-108675170 CAGCTGCCACAGTGGGCAACTGG - Intronic
1047695470 8:127399411-127399433 CAGCTAGCCAAAAGGGCAAAGGG - Intergenic
1048964413 8:139604916-139604938 CAGCTGTCCCAGAGATTAACGGG - Intronic
1049371200 8:142268254-142268276 AAACTGTCCTAGAGTGCAAAGGG + Intronic
1053293301 9:36896263-36896285 CAGCTGGTCCAGGGGGCAACGGG + Intronic
1053366996 9:37529775-37529797 AAGCTGTCCCATGGGGCATAAGG + Intronic
1055550926 9:77431655-77431677 CAGATGTCCCAGAAGGCGCATGG - Intronic
1056542807 9:87588546-87588568 CAGCTTTCACAGATGGCAAATGG + Intronic
1056812895 9:89777934-89777956 CAGCTTTGCCAGAGAGCAGAAGG + Intergenic
1056840376 9:89994092-89994114 CAGCAGTGGCAGAGGCCAAAGGG + Intergenic
1059500428 9:114748108-114748130 CAGCAGTCTCAGTGGGCCAAAGG - Intergenic
1060727573 9:126016469-126016491 CAGCTGGGCCAGGGGGCCAAGGG + Intergenic
1061272030 9:129549256-129549278 CAGCTGGCCCAGCTGTCAAATGG - Intergenic
1061636745 9:131915688-131915710 CAGCTGTGCCAGTGGGCAGTGGG - Intronic
1061998605 9:134204215-134204237 CAGCACTCCCAAAGGGCAACAGG - Intergenic
1062023536 9:134330154-134330176 CAGCTGTCCCAGCAGACACAGGG + Intronic
1062343012 9:136102126-136102148 CAGCTGGCCCAGAGGGAAAGTGG + Intergenic
1062559889 9:137136789-137136811 CAGCTGTCAGAGTGGGCAAGGGG + Intergenic
1191716619 X:64198074-64198096 CAGTTTTCCCAAATGGCAAATGG + Intronic
1191997352 X:67109973-67109995 CAGCAGCCACAGTGGGCAAATGG + Intergenic
1192510009 X:71716059-71716081 CAGCTGTCCCACGGGGAAACGGG - Intronic
1192516688 X:71765494-71765516 CAGCTGTCCCACGGGGAAACGGG + Intronic
1192529141 X:71871182-71871204 CAGCTGTCCCACGGGGAAACGGG - Intergenic
1194922264 X:99780666-99780688 CTGCTGTATCAGAGGGCAAAAGG - Intergenic
1195618168 X:106929226-106929248 CAGGTAAACCAGAGGGCAAAGGG - Exonic
1197154991 X:123260649-123260671 CACTTTTCCCAGAAGGCAAATGG - Intronic
1197278181 X:124504490-124504512 CAGGTTTCCAAGAGGGAAAATGG - Intronic
1198754985 X:139973401-139973423 TAGCTATCACAGAGGGCCAAAGG - Intergenic
1201946131 Y:19512382-19512404 CAGTTGCCCCAGGGTGCAAAGGG + Intergenic