ID: 954761246

View in Genome Browser
Species Human (GRCh38)
Location 3:52875923-52875945
Sequence CTGGAGAAGCAGTGTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 481}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954761239_954761246 -3 Left 954761239 3:52875903-52875925 CCCATGAGCAGCCAGCTCACCTG 0: 1
1: 0
2: 4
3: 17
4: 195
Right 954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG 0: 1
1: 0
2: 7
3: 66
4: 481
954761238_954761246 18 Left 954761238 3:52875882-52875904 CCTTGTGAGCACTGAGAGGTACC 0: 1
1: 0
2: 0
3: 1
4: 96
Right 954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG 0: 1
1: 0
2: 7
3: 66
4: 481
954761237_954761246 19 Left 954761237 3:52875881-52875903 CCCTTGTGAGCACTGAGAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG 0: 1
1: 0
2: 7
3: 66
4: 481
954761240_954761246 -4 Left 954761240 3:52875904-52875926 CCATGAGCAGCCAGCTCACCTGG 0: 1
1: 0
2: 3
3: 27
4: 299
Right 954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG 0: 1
1: 0
2: 7
3: 66
4: 481
954761235_954761246 26 Left 954761235 3:52875874-52875896 CCAGAAGCCCTTGTGAGCACTGA 0: 1
1: 0
2: 0
3: 19
4: 207
Right 954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG 0: 1
1: 0
2: 7
3: 66
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954761246 Original CRISPR CTGGAGAAGCAGTGTGAGGG TGG Intronic
900098985 1:952937-952959 CTGGGGAAGCTGTGTGAAGCAGG + Intronic
900411975 1:2516626-2516648 CTGGAGAAGCAGCCTCTGGGTGG + Intronic
900566266 1:3333512-3333534 CTAGAGCAGCACGGTGAGGGAGG + Intronic
901013492 1:6214016-6214038 CTTGAGAAAGAGTGTGAAGGAGG + Intronic
902287124 1:15413940-15413962 CTGGAGGAGCAAAGAGAGGGAGG - Intronic
902314328 1:15606508-15606530 CTGGAGAATGAGGGAGAGGGAGG - Intergenic
902379120 1:16044463-16044485 CTGGAGAAGCGGATAGAGGGAGG - Intronic
902571328 1:17348810-17348832 CTGGGAAAGCAGGGAGAGGGAGG - Intronic
904043471 1:27597293-27597315 ATGCAGAATGAGTGTGAGGGTGG + Intronic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
905288278 1:36901675-36901697 CTTGAAAAGCAGTGGGAGAGGGG - Intronic
905914996 1:41678544-41678566 CTGGGGAAGAGGTGTGTGGGTGG - Intronic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906346351 1:45017718-45017740 CTGAAGAGGCTGTGTGAGGCAGG + Exonic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
908430360 1:64050687-64050709 CTGGACTTGCAGTGGGAGGGGGG - Exonic
909891192 1:81009084-81009106 CGGGAGTGGGAGTGTGAGGGAGG - Intergenic
910559222 1:88572282-88572304 ATGGAGAAGAAGTGTGAGAGGGG - Intergenic
910960391 1:92755817-92755839 CTGGAGAAGCAGTGATGGCGAGG + Intronic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
915940619 1:160116184-160116206 CGGGAGATGCAGTGAGAGGAGGG - Intronic
915971791 1:160360357-160360379 CTGGAGAGGCTGTGTGATGCTGG + Intergenic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
916676305 1:167066713-167066735 CTGGAGGAGCAGTGATAGGGAGG + Intronic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
919746010 1:201009548-201009570 CTTGGCAGGCAGTGTGAGGGAGG - Intronic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920079564 1:203362446-203362468 CTGGAGAAGCAGGGATAAGGAGG - Intergenic
920759882 1:208773021-208773043 CTTGAGGAACAGTGTGATGGGGG - Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
922159592 1:223068858-223068880 GAGGAAAAGCAGTGGGAGGGTGG + Intergenic
923110047 1:230883136-230883158 CAGGAGAAGAAGTGTGGGCGGGG + Intergenic
923138759 1:231142428-231142450 CTGGACTAGAAGGGTGAGGGTGG + Intergenic
923216418 1:231852034-231852056 CAGGAACAGCACTGTGAGGGAGG + Intronic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924199621 1:241645496-241645518 CTGGAGAACTTCTGTGAGGGTGG + Intronic
924275457 1:242381759-242381781 GTGGGGAAGCTGTTTGAGGGAGG - Intronic
924722889 1:246639438-246639460 CTGGAGGAGCAGTGTGCGGTCGG + Intronic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063349028 10:5337609-5337631 CTGTGAAAGCCGTGTGAGGGGGG + Intergenic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064711498 10:18130840-18130862 CTGAAGCAGCAGTGAGCGGGTGG + Intergenic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1065688384 10:28308387-28308409 CTAGAGAGGCAGTGTCAGTGAGG - Intronic
1065968318 10:30786153-30786175 CTGGAGATGCAGTTTCAGGCTGG - Intergenic
1065968326 10:30786225-30786247 CTGGAGATGCAGTTTCAGGCTGG - Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066628456 10:37434015-37434037 CTGGAGGAGCAGTGTGGGGAGGG + Intergenic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1067184475 10:44015150-44015172 CTGGACAGTCACTGTGAGGGTGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067328836 10:45295175-45295197 TTAGAGAAGAAGTGTGAGTGTGG - Intergenic
1067572724 10:47383788-47383810 CGGGAGAGACAGTGGGAGGGAGG + Intronic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1069034687 10:63634059-63634081 CTGGATGTGGAGTGTGAGGGAGG - Intergenic
1069069023 10:63975197-63975219 CTGCAGAAGCAGTGATAGGCTGG - Intergenic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1070651914 10:78243527-78243549 CTGAGAAAGCAGTGAGAGGGAGG + Intergenic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071185784 10:83043030-83043052 CTGGACAGGTATTGTGAGGGAGG - Intergenic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071481593 10:86069031-86069053 CTGGAGAAGCTGTGGGAAGGGGG + Intronic
1071785215 10:88892084-88892106 TTTGAGATGCAGGGTGAGGGAGG + Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073860419 10:107732253-107732275 CTGGCGAGGTAGCGTGAGGGAGG + Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074412461 10:113240137-113240159 CTGCAGGAGGAGTGGGAGGGAGG - Intergenic
1074438516 10:113454820-113454842 CTGGGGTAGCAGTGAGTGGGTGG - Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1076409296 10:130234563-130234585 GTGGAGGAGCAGTGAGAAGGGGG - Intergenic
1076501482 10:130939744-130939766 CTGGAGATGGAGGGTGAGGCTGG + Intergenic
1076846447 10:133071731-133071753 CTGGGGAAGGAGTGTGTGGCTGG - Intronic
1077095940 11:799136-799158 ATGGAGAAGCCGTTGGAGGGCGG - Exonic
1077202699 11:1319517-1319539 CTGAAAGAGCAGGGTGAGGGGGG - Intergenic
1077317685 11:1926672-1926694 CTGCAGAAGCAGCGTCATGGTGG - Intronic
1077394852 11:2315800-2315822 CTGGTGGAGGGGTGTGAGGGGGG - Intronic
1077453779 11:2665948-2665970 TTGGGGATGCAGTGTGAGGGAGG - Intronic
1078392078 11:10944009-10944031 CTAGAGAAGTAGAGTGAGGGTGG - Intergenic
1079386667 11:19986181-19986203 CTGGAGATGGAGGATGAGGGTGG + Intronic
1080051125 11:27860117-27860139 CGGGAGAAGCAGTTGAAGGGGGG + Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1081052283 11:38358579-38358601 CTGGAGAGGCAATGTGAGAGAGG + Intergenic
1081443877 11:43110663-43110685 CTTGAGAAGAACTGTGAGTGGGG + Intergenic
1081592874 11:44437185-44437207 CTGGAGAAGGAGTCTGTGAGGGG + Intergenic
1081625569 11:44653340-44653362 CTGGAAAAGCAGTGGCAAGGAGG - Intergenic
1081992162 11:47343657-47343679 CTGGGGGAGCAGGGTGCGGGCGG - Intronic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085469188 11:76746010-76746032 CTGGAGAGGGACTGTGAGGGCGG + Intergenic
1085639812 11:78186416-78186438 CTGGAGAGGCTGTGTGGGGTAGG + Intronic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086393663 11:86391929-86391951 CTGGAGCAGGAGTAAGAGGGAGG + Intronic
1086539356 11:87889246-87889268 CTGTAGAATCAGTCAGAGGGAGG - Intergenic
1087483729 11:98734467-98734489 CTGGCCAGGCAGTGGGAGGGTGG - Intergenic
1089117833 11:116110861-116110883 CTGAAGAGGAAGTCTGAGGGAGG - Intergenic
1089140523 11:116280456-116280478 CTGGAGAAGGAGATTGGGGGAGG - Intergenic
1089195937 11:116694050-116694072 CTGGAGGAGCACTGAGAGGCGGG - Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1090056018 11:123425786-123425808 TTAGAGAAGCAGTGTGGAGGAGG - Intergenic
1090552934 11:127842514-127842536 CTGGACAAGCAGAGTTAGGGTGG - Intergenic
1090602462 11:128387298-128387320 CTGGAGAAGCAGTGGGTGACAGG - Intergenic
1090808254 11:130216349-130216371 CTGAGGTTGCAGTGTGAGGGAGG + Intergenic
1091236649 11:134026704-134026726 CTGGTGTAGGAGTGTGTGGGAGG - Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092196038 12:6550329-6550351 CTGCAGGAGTATTGTGAGGGTGG - Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094368090 12:29705551-29705573 CTGGACAAGCAGTGTAAGCAAGG - Intronic
1094395591 12:30002097-30002119 TGGGAGAAGCAGTGTGATAGGGG - Intergenic
1095141952 12:38674614-38674636 CAGGAGAAGCAGTGTTGGTGAGG + Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096639292 12:52981406-52981428 CTGGAGAAGCATTGTGCAGGAGG - Intergenic
1096659862 12:53117680-53117702 CTGGGGAGGCAGTGGGAGGGTGG + Intronic
1096719497 12:53510453-53510475 GAGGAGCAGCGGTGTGAGGGTGG + Intronic
1097225513 12:57474974-57474996 CTGGGGAAGTAGAGTGAGGCGGG + Intronic
1097909691 12:64956735-64956757 CATGACAAGTAGTGTGAGGGTGG - Intergenic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098169628 12:67733753-67733775 CTAGAGAAGAAATGGGAGGGAGG - Intergenic
1098632482 12:72740883-72740905 CTGCAGTAGCAGTGAGAGAGGGG - Intergenic
1099178577 12:79452324-79452346 CTGGAGAAGCTGTGTGACTTGGG - Intergenic
1100164489 12:91901064-91901086 CTTGAGAAGCTGTGAGAGGAGGG + Intergenic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1101363505 12:104049983-104050005 CAGCCGAAGCAGCGTGAGGGCGG - Exonic
1102260370 12:111439722-111439744 CTGGAGCAGCATCGTGGGGGTGG + Intronic
1102449266 12:113028687-113028709 GTGGAGAAGCAGTTTTTGGGAGG - Intergenic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102889336 12:116546187-116546209 TTTGAAAAGCAGTGTGGGGGCGG + Intergenic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1105005787 12:132719758-132719780 CTCGGGAAGCAGCGTGAGGGTGG + Intronic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1107557837 13:41533380-41533402 CTGAAGCCGCAGTGAGAGGGAGG + Intergenic
1107744813 13:43493150-43493172 CAGGAGAGGGAGTGGGAGGGGGG - Intronic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1112010940 13:95293380-95293402 ATGGAAAAGCTGTGTGAGGGTGG - Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1112743096 13:102496680-102496702 CAGGAGAAAGAGTGTGAAGGGGG + Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1114680587 14:24480855-24480877 CTTGATAAGCAGTGTGAGAATGG - Intergenic
1114890050 14:26908736-26908758 CTGGAGAAGGGGTTTGAGGTAGG + Intergenic
1115241083 14:31251637-31251659 CTGGAGAAGCACTGTCATGGCGG - Intergenic
1115650746 14:35401417-35401439 GAGGTGGAGCAGTGTGAGGGAGG - Intergenic
1119599017 14:75962175-75962197 CTGTAGCAGCAGGGTTAGGGTGG - Intronic
1120181170 14:81343441-81343463 CTTGAGAAGAGGTGGGAGGGAGG - Intronic
1120531590 14:85638596-85638618 CTTGAGAAGAAGTGTGAAGTAGG - Exonic
1120886347 14:89454889-89454911 CTGGAGAAGGAGAGGGAGTGGGG + Intronic
1121020253 14:90575573-90575595 CTGCAGCACCAGTGGGAGGGGGG + Intronic
1122004102 14:98688001-98688023 CTGATGGAGCAGTGTTAGGGGGG - Intergenic
1122879018 14:104681748-104681770 CTGGAGAGGCAGGGTGGGCGGGG + Intergenic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1123871646 15:24581144-24581166 CTGGAGAAGAAGCTTGATGGTGG + Intergenic
1124344400 15:28912524-28912546 CTGGAGCATCAGGGTGAGCGCGG + Intronic
1124411600 15:29442013-29442035 CTGGAGAGGAATTGGGAGGGAGG - Intronic
1125180578 15:36878261-36878283 CTGGAGAAGCAGCGTAGGGCGGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128107469 15:65055278-65055300 GTGAGGAAGCAGTGTGAGGCAGG + Intronic
1128114192 15:65095074-65095096 CTGGAGAAGGGGTGTGGGGTAGG + Intronic
1128525778 15:68411347-68411369 TTGAAGAAGGAGTGTGTGGGAGG - Intronic
1128562570 15:68678331-68678353 CTGGGGGCTCAGTGTGAGGGAGG - Intronic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1130004763 15:80084478-80084500 CTGGCCAAGAAGTGGGAGGGAGG + Intronic
1131360480 15:91785997-91786019 CTGGAAAAGCAGGGAGAGTGGGG - Intergenic
1131892016 15:96983352-96983374 CTGGGAATGCAGTGGGAGGGAGG + Intergenic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1132616414 16:843071-843093 ATGGAGAAGAACTGTGAGTGTGG + Intergenic
1132764233 16:1526315-1526337 CTGGGGAGGCTGTGGGAGGGGGG - Intronic
1133024489 16:2982043-2982065 ATGGAGCAGCAGTGTGGGGGAGG + Intergenic
1133026860 16:2992376-2992398 GAGGAGAAGCAGTGTGTGAGGGG - Intergenic
1133581150 16:7145811-7145833 ATGGAGAAGTAGTGTGTGTGCGG - Intronic
1134252594 16:12584970-12584992 CTGAAGGAGCAGGGTGGGGGAGG - Intergenic
1134503813 16:14789621-14789643 CTGGTGAAGCACTGGGCGGGTGG + Intronic
1134576758 16:15339278-15339300 CTGGTGAAGCACTGGGCGGGTGG - Intergenic
1134690814 16:16190108-16190130 CTGGGGAAGGAGTGCGGGGGTGG - Intronic
1134725684 16:16417211-16417233 CTGGTGAAGCACTGGGCGGGTGG + Intergenic
1134941750 16:18294647-18294669 CTGGTGAAGCACTGGGCGGGTGG - Intergenic
1135407890 16:22211149-22211171 GTGGAGAAGAAGTGAGAGAGGGG - Intronic
1135789963 16:25384776-25384798 CAGGAGAGAAAGTGTGAGGGAGG - Intergenic
1136275468 16:29177054-29177076 CTGGAGAAGCCCTGGGGGGGTGG + Intergenic
1136291358 16:29274113-29274135 CTGGAGCAGCCCTGTGTGGGTGG - Intergenic
1136517374 16:30776005-30776027 CTGGGGCAGCGGTGCGAGGGTGG + Exonic
1137838089 16:51613306-51613328 CTGGGGGCGCACTGTGAGGGTGG + Intergenic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138372053 16:56534907-56534929 CTTAAGAAGCTCTGTGAGGGCGG - Intergenic
1138553537 16:57759699-57759721 CTGGAGTGGCAGTGTGGGTGGGG - Intronic
1139942531 16:70615968-70615990 CTGTGGAAGGAGTTTGAGGGGGG - Intronic
1140071332 16:71652945-71652967 CTGGATCGGCAGTGTCAGGGCGG + Exonic
1140123387 16:72101808-72101830 CAGAGGAAGCAGTGTGAGGGAGG - Intronic
1140258315 16:73355975-73355997 CTGGAGAGGCAGCGTGAATGTGG - Intergenic
1140333076 16:74076542-74076564 TTAGAGTAGCAGTGGGAGGGAGG - Intergenic
1140434822 16:74938105-74938127 TTGGAGGAGCAGTGTTTGGGTGG - Intronic
1140850548 16:78931225-78931247 CTGGAGATGCTGTGTGGGGAGGG + Intronic
1142079829 16:88143119-88143141 CTGGAGAAGCCCTGGGGGGGTGG + Intergenic
1142097232 16:88248032-88248054 CTGGAGCAGCCCTGTGTGGGTGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143548503 17:7614568-7614590 CTGCAGCAGCAGTCTGAGTGCGG + Exonic
1144075979 17:11719573-11719595 CTGGGGAAGCTGGGTCAGGGTGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144312713 17:14027713-14027735 CTGGCGAGGCTGTGTGAGGCAGG + Intergenic
1144332044 17:14233614-14233636 CTGGCGAGGCTGTGTGAGGCAGG - Intergenic
1144498781 17:15767969-15767991 CTGGCGAGGCTGTGTGAGGCAGG + Intergenic
1145162163 17:20583003-20583025 CTGGCGAGGCTGTGTGAGGCAGG + Intergenic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1145879892 17:28345258-28345280 CTGCAGAATCAATCTGAGGGAGG + Exonic
1145999352 17:29122034-29122056 CTGGTGATGCAGTGGGGGGGAGG - Intronic
1146466968 17:33094093-33094115 GTGGAGAAGCACTGGGAAGGGGG - Intronic
1146794697 17:35773110-35773132 TTGGAGAAGCAGTTTGGGGGTGG - Intronic
1146948841 17:36891997-36892019 GTGGAGAAGCAGAGTGAAAGAGG + Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147180857 17:38684776-38684798 CTGGAGACGCAGTCTGGTGGGGG + Intergenic
1147261987 17:39214159-39214181 CTTGAAACACAGTGTGAGGGGGG - Intronic
1147523460 17:41197271-41197293 CAGGGGAAGGAGTGTGATGGGGG - Intronic
1148047594 17:44753568-44753590 CGAGAGGAGCACTGTGAGGGGGG + Intergenic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148451822 17:47783543-47783565 CTGGAGAGGCGGTGGGAGAGAGG - Intergenic
1148684137 17:49491291-49491313 CTGGAGGGGCAGGGTGACGGTGG + Intergenic
1149347178 17:55750935-55750957 CTGGAGGAGCGGCCTGAGGGTGG - Intergenic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1150227118 17:63530250-63530272 CCGGTGAGGCAGAGTGAGGGTGG + Exonic
1150947287 17:69761770-69761792 CTGGGGTAGCAGTGTGCGAGGGG + Intergenic
1151399288 17:73845159-73845181 ATGGAGAAGCTGTGTGATGCTGG - Intergenic
1151827862 17:76533337-76533359 CTGGAGAAGCACTGTAATGAGGG + Intronic
1151886679 17:76926816-76926838 CTGGAGAAGGAAAGAGAGGGAGG - Intronic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152210961 17:79003012-79003034 CTGGGGAATCAGTGTGACGGAGG + Intronic
1152471319 17:80491394-80491416 CTCGGGAAGCAGGGTGAAGGGGG + Intergenic
1152580446 17:81163411-81163433 CAGGAAAAGCAGGGTGATGGGGG - Intronic
1152914454 17:83026203-83026225 CTGGAGAACCAGCGAGAGCGTGG + Intronic
1154472852 18:14721847-14721869 CTGGTGCAGCAGAGAGAGGGAGG + Intergenic
1156622065 18:38864393-38864415 CTAGTGAAGCAGTGGGAAGGGGG + Intergenic
1157275043 18:46304360-46304382 CTGGAGAAGCTGTGGGAAGTAGG + Intergenic
1157564460 18:48670494-48670516 CTAGAGAAGCTGTGTGTGTGTGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1161025253 19:2033831-2033853 CTGCAGCTGCAGTGGGAGGGAGG - Intronic
1161208177 19:3053209-3053231 TGGGAGGAGCAGGGTGAGGGTGG - Exonic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1163114358 19:15180226-15180248 CTGGAGCAGCTGTGTCAGGCGGG - Exonic
1165293548 19:34907843-34907865 CTGCAGAAGCAGTGGTAGGTGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166502556 19:43353051-43353073 CTGGAGAAAGAGGGTGGGGGTGG + Intergenic
1167108560 19:47445723-47445745 CTGGGGAAGCCATGTGGGGGAGG + Intronic
1167799037 19:51728474-51728496 CTAGAGAGGAAGTGTGAGTGAGG + Intergenic
1168290262 19:55354124-55354146 TAGGAGGAGCAGTGTGAGGGAGG - Exonic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
925248248 2:2403895-2403917 CTGGAGGGGCAGTGTGCTGGTGG + Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
927717027 2:25359677-25359699 CTTGGGACGCAGTGAGAGGGAGG - Intergenic
929545375 2:42852096-42852118 GTGAAGAGGCAGTGAGAGGGTGG - Intergenic
929722335 2:44383054-44383076 CCGAAAAGGCAGTGTGAGGGCGG - Intronic
930325250 2:49908322-49908344 CTGGAGGAGCACTGTTAGCGGGG - Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
932308926 2:70724477-70724499 GTCGGGGAGCAGTGTGAGGGTGG - Intronic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934626162 2:95855891-95855913 CTGGAGAAGCAAAGAGAGAGCGG - Exonic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
936444724 2:112586553-112586575 CTGGAGGTGGAGGGTGAGGGTGG - Intronic
936467470 2:112766036-112766058 CTGGAGAAGTCGTGTGTGGAGGG + Intergenic
937122350 2:119449633-119449655 CTGGAGCAGGTGTGTGAGGGAGG - Intronic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937608413 2:123829408-123829430 CTGGAGATGCATGGTGATGGTGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938124947 2:128664693-128664715 CTGGGGTAGCAGTGGGAGGAGGG + Intergenic
938199350 2:129360480-129360502 CTAGAGAAGCAGTGTGGGGAGGG - Intergenic
938248395 2:129796233-129796255 CTGGAACAGCATTGGGAGGGTGG - Intergenic
938671351 2:133589387-133589409 CAGGAGAAGCAGTTTCACGGGGG + Intergenic
939994979 2:148911604-148911626 CTGGGGCAGTAGTTTGAGGGAGG + Intronic
940907104 2:159179468-159179490 CTGCAGAAGCTGGGTGGGGGAGG - Intronic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
947724700 2:232389544-232389566 CTGGAAAGGCAGTCTGCGGGGGG - Intergenic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
947991109 2:234488135-234488157 TTGGAGAAGGATTTTGAGGGGGG + Intergenic
948055404 2:235006608-235006630 CTGGCAAAGCAGAGCGAGGGGGG - Intronic
948540944 2:238691145-238691167 CTCAAGAAGCAGAGTGAGAGAGG - Intergenic
948949091 2:241237206-241237228 CAGGAGAGGCAGTGGGAAGGGGG + Intronic
1168949498 20:1786878-1786900 CTGGGGAGGCATTGGGAGGGTGG - Intergenic
1169709712 20:8548031-8548053 CTGGACCAGGAGTGTGTGGGTGG - Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1169889192 20:10434255-10434277 CCGGAGAAGCGGAGTGGGGGCGG - Intergenic
1169933077 20:10854715-10854737 CTGGAGAAAAAGTGTGAGACAGG - Intergenic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170439059 20:16359339-16359361 CAAGAGAAAGAGTGTGAGGGAGG - Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171417310 20:24992041-24992063 CTGGTCACGCAGCGTGAGGGGGG + Intronic
1171449143 20:25224055-25224077 CTGCAGGAGCACTGTGAGGTTGG - Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172247846 20:33458175-33458197 AAAGAGAACCAGTGTGAGGGTGG + Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172766302 20:37352856-37352878 CTGGAGGGGCACTGAGAGGGAGG - Intronic
1173331371 20:42078722-42078744 TGGGAGAAGCAGTCTGGGGGAGG - Exonic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173909202 20:46651528-46651550 CAGGAGGAGCAGGGAGAGGGCGG - Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1175146639 20:56901477-56901499 CAGGAGGAGCAGTGTTAGAGTGG + Intergenic
1176801633 21:13436002-13436024 CTGGTGCAGCAGAGAGAGGGAGG - Intergenic
1177590697 21:23162447-23162469 CTGTAGAGTCAGTGTGAGAGAGG + Intergenic
1177807693 21:25890194-25890216 GTGGATGAGCAGTGTGAGGAAGG - Intronic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179171585 21:38977030-38977052 CTGGGGAGGCAGTGTGGGGGTGG - Intergenic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179680855 21:43020373-43020395 AGGGAGACGCTGTGTGAGGGAGG + Intronic
1180167296 21:46036727-46036749 GGGGAGAGGCAGTGGGAGGGAGG + Intergenic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1182353848 22:29713372-29713394 CTGGGGCAGCTGGGTGAGGGAGG - Intergenic
1182358230 22:29732164-29732186 CTGGAGAAGCAGCATGCGTGGGG - Intronic
1183499584 22:38170478-38170500 CAGGAGCAGCAGTGTCTGGGTGG + Intronic
1183572181 22:38661884-38661906 CAGGAGGAGCAGTGAGAGGTCGG + Intronic
1183614158 22:38932540-38932562 GTTGAAAAGCAGTGTGAGAGAGG + Intergenic
1183954542 22:41371492-41371514 CTGGAGATGGAGAGAGAGGGGGG - Intronic
1184067052 22:42126998-42127020 CAGGAGATGCAGGGTGAGAGTGG + Intronic
1184069777 22:42140702-42140724 CAGGAGATGCAGGGTGAGAGTGG + Intergenic
1184071521 22:42150310-42150332 CAGGAGATGCAGGGTGAGAGTGG + Intergenic
1184692243 22:46122677-46122699 CTGAAGAATCAGTGTCCGGGAGG + Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185330126 22:50248698-50248720 CTGCAGCAGCTGTGTGAGGTGGG + Exonic
1185333758 22:50262586-50262608 CTGGTGAAGGGGTGTCAGGGTGG - Intergenic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
950098968 3:10345820-10345842 CTGGGGGAGCTGTGTGAAGGGGG - Intronic
950103150 3:10370540-10370562 CTGGAGCAGCAGGCTAAGGGAGG - Intronic
950104690 3:10380622-10380644 CTGGAGAAGCAATGGCAGGACGG - Intronic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
953202157 3:40787321-40787343 CTGGAGCAGCAGGGATAGGGAGG - Intergenic
953394093 3:42553255-42553277 CAGGAGAAGCAGTCTGACTGTGG - Exonic
953963350 3:47283196-47283218 GGGGAGAAGAGGTGTGAGGGGGG + Intronic
954110778 3:48431612-48431634 ATGGAGAGGCAGTGATAGGGAGG - Intergenic
954583851 3:51718126-51718148 CAGGAGCAGCTGTGTCAGGGCGG - Exonic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
955002199 3:54937869-54937891 CTGGAGAAGGGGTGAGAGGCTGG + Intronic
955231616 3:57104359-57104381 CTGGAGAAACATTTTGAAGGAGG + Exonic
955523042 3:59793564-59793586 CTGGGGAGGCAGTGCGAGAGGGG - Intronic
958178325 3:90024639-90024661 GTGGAGAATGAGTGAGAGGGAGG - Intergenic
958636192 3:96750319-96750341 CTGCAAAGGCAGAGTGAGGGAGG - Intergenic
959011451 3:101081625-101081647 GTGGAGAGGCTGTGTGGGGGTGG + Intergenic
960740442 3:120827535-120827557 CTGAAGTAGCATTGTGATGGAGG - Intergenic
960745149 3:120879558-120879580 CTGCAGAAGCAGTGTGTGTGGGG + Intergenic
960841572 3:121963896-121963918 CTGCAGAAGCAGTGACAGAGAGG - Intergenic
960999926 3:123367357-123367379 CAGGAGAAGCAGTTTGTGGGTGG - Intronic
961053763 3:123768900-123768922 CTGGAGAAGCAGGCAGAGAGGGG - Intronic
961452161 3:127007127-127007149 CAGGAGAAGCAGGGTGGTGGGGG + Intronic
961486831 3:127222576-127222598 CCAGGGAAGCAGTGGGAGGGAGG + Intergenic
961871977 3:129995243-129995265 CTGGAGGTTCAGTGTGAGTGAGG + Intergenic
962293142 3:134154278-134154300 CTGGGGGAGAAATGTGAGGGAGG - Intronic
962414941 3:135173472-135173494 CTGGAAAAGCAGTGGGTGGGAGG - Intronic
963025265 3:140913093-140913115 CAAGAGGAGCAGTTTGAGGGAGG - Intergenic
963520965 3:146359541-146359563 ATGGAGAGGCAGTGTGAGACTGG + Intergenic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
963940595 3:151092624-151092646 CTGGGGAAGTGGAGTGAGGGAGG + Intronic
965582725 3:170286609-170286631 TTTGAGAAGCAGTTTGATGGGGG + Intronic
966587252 3:181640736-181640758 CTGAAGAAGATGTGTGAGGGAGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
967884144 3:194321983-194322005 CTTGAGCAGCCGTGGGAGGGTGG + Intergenic
968077078 3:195821865-195821887 CTGGAGGAGCAGGGTGAGAGAGG + Intergenic
968186560 3:196636768-196636790 CTCGAAAAGCATAGTGAGGGGGG + Intergenic
969160739 4:5256487-5256509 CAGGGGAAGCAGTGGGAGAGTGG - Intronic
969677858 4:8624653-8624675 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969678813 4:8630289-8630311 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969679769 4:8635939-8635961 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
973630032 4:52811624-52811646 CTGGTGAAGGAGTTGGAGGGAGG + Intergenic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974877734 4:67718205-67718227 GTGGGGAGGCAGGGTGAGGGTGG + Intergenic
975826565 4:78326008-78326030 CTGGAGATGCAGGGTGTGTGTGG + Intronic
975927119 4:79470536-79470558 CTGGAGATGCATGGTGAGGATGG - Intergenic
976049930 4:80999387-80999409 CTGGAGAACAAGTGTGGAGGAGG + Intergenic
977600380 4:98928857-98928879 CTGGGGGAGCGGTGTGGGGGAGG - Intronic
977828108 4:101557334-101557356 CTGGGGAAGTGGGGTGAGGGTGG - Intronic
978937417 4:114395010-114395032 CTGGAGAAGCTGTGTCTGGATGG - Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
980572553 4:134639628-134639650 CTGGATAAGCAGTTTGATGTTGG - Intergenic
981130134 4:141149382-141149404 CTGGGGAAAGAGTGGGAGGGGGG - Intronic
981453239 4:144923490-144923512 CTTGAGATGCAGAGTTAGGGAGG - Intergenic
981606419 4:146545823-146545845 CTACAGAGGCAGTGTGAGAGGGG + Intergenic
981677144 4:147355281-147355303 CTAGATAAGCAGTCTGAGTGAGG + Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982903447 4:161037882-161037904 CTGGAGAAATAGAGTGAAGGAGG + Intergenic
983029715 4:162784723-162784745 CTGGAGATGAAGTCTGAGGGAGG + Intergenic
983450663 4:167907014-167907036 ATGCAGAAGCAATGTGTGGGGGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985007638 4:185549943-185549965 CAGGAGGAGGAGTGTGGGGGAGG + Intergenic
985372538 4:189301633-189301655 CTGGGGAAGCCCAGTGAGGGTGG - Intergenic
985752305 5:1687574-1687596 CTGGGGATCCAGTGTGAGGCTGG + Intergenic
985779686 5:1863809-1863831 CTAGAGAAGGAATGTGAGGAAGG + Intergenic
986278965 5:6306839-6306861 CTGCAGAAGCAGTGTGCAAGGGG - Intergenic
986872780 5:12069588-12069610 CTGGAGAAGCAATGTGATGAAGG + Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
989236196 5:39151189-39151211 GTGGAGGTGGAGTGTGAGGGTGG - Intronic
989568413 5:42924044-42924066 CTGGCGAAGCCATGTGAGGGGGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
992106638 5:73453465-73453487 CTGAAGAAGCAGGGTGGGGGAGG - Intergenic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
992309510 5:75481265-75481287 TTTGAGAAGCAGTCTGAAGGTGG - Intronic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
993233278 5:85267964-85267986 CTGGAAAACCTGTGTGAGAGTGG + Intergenic
993251561 5:85531322-85531344 CTGGAGAGGCTGAGTGGGGGAGG - Intergenic
993743883 5:91572417-91572439 GTGGAGAAGCAGTGGTATGGTGG + Intergenic
994102165 5:95905438-95905460 CTGGAGAAGCAGTGAGAGTCAGG - Intronic
995504071 5:112840606-112840628 CTGGAGAAGGAGTTAGAGGAGGG + Exonic
997569815 5:134917705-134917727 CTGGAGCTGCAGCGGGAGGGAGG + Intronic
998161092 5:139813470-139813492 CTGGATGAGGGGTGTGAGGGGGG - Exonic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999448420 5:151659850-151659872 CTGCAGCAGGAGTGGGAGGGAGG + Intergenic
1000148636 5:158478221-158478243 TTGCAGAAGCAGTGTGGTGGAGG + Intergenic
1000592726 5:163177935-163177957 TTGGAGAAGCAGTTTGTGGGAGG + Intergenic
1001172878 5:169437868-169437890 CTGGATGAGCTGTGTGAGCGTGG + Intergenic
1001924126 5:175623944-175623966 ATGGAGCAGCACTGTGAGTGGGG - Intergenic
1002072470 5:176688369-176688391 CTGCAGCAGCAGTTTGGGGGTGG + Intergenic
1002106361 5:176881209-176881231 CTGGAGAAGCTGTGAGAGGAGGG + Exonic
1002702145 5:181131622-181131644 CTGGAGAAAAAGTGTGAGTGTGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004957188 6:20741144-20741166 CTCCAGATGCAGTGTAAGGGAGG + Intronic
1005168856 6:22957943-22957965 TTGGTAAAGCAGTGTCAGGGTGG - Intergenic
1005645625 6:27835136-27835158 CTTGAAAAACAGTTTGAGGGAGG - Intergenic
1006166932 6:32070687-32070709 CTGGGGAAGCAGTCTGTGAGAGG - Intronic
1008000685 6:46356635-46356657 CTGGAAAAGCCCTGTAAGGGAGG + Intronic
1008973897 6:57401943-57401965 CTGCAGAGGCAGTGGCAGGGAGG + Intronic
1009162787 6:60303448-60303470 CTGCAGAGGCAGTGGCAGGGAGG + Intergenic
1010019240 6:71139926-71139948 CTGCAGAGGCAGTGGCAGGGAGG - Intergenic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1011008728 6:82678888-82678910 CTGAAGAAGCACTGTGGTGGAGG - Intergenic
1012406691 6:98908951-98908973 CTGGAAAAGAAGTGTGATAGAGG - Intronic
1014176134 6:118333230-118333252 CTGGAGAAGCTGTGAGTTGGAGG - Intergenic
1015786054 6:136922348-136922370 CGGGAGCAGCGGAGTGAGGGCGG - Exonic
1016063537 6:139655322-139655344 TTGGAGGAGCAGTGTGAGTTGGG - Intergenic
1018672308 6:166189760-166189782 TTGGAGCAGCTGAGTGAGGGAGG - Intergenic
1019099876 6:169620879-169620901 CTGGAGGAGCAGAGTGCAGGAGG - Intronic
1019215218 6:170438908-170438930 CTGGAGGAGCAGGCTGGGGGTGG + Intergenic
1019358168 7:591739-591761 CTGGAGACGCACTGTCAGTGGGG + Intronic
1019488859 7:1301775-1301797 CTGGAGCAGCCTTGTGAGGAGGG + Intergenic
1020997298 7:15280251-15280273 CTGGTGGAGCAGTGTGGGTGTGG + Intronic
1021957466 7:25840344-25840366 CTGGAGAAGAGGTGTGAGGGAGG - Intergenic
1022384313 7:29887565-29887587 CTGGAGAACCAGTGTGAGCAGGG + Intronic
1022400973 7:30037004-30037026 CTAGAGAAGCTGAGTGGGGGAGG + Intronic
1023890092 7:44385847-44385869 CTGGAGATGCAAGGTCAGGGTGG + Exonic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1025142850 7:56479816-56479838 CTGGGCAGGCACTGTGAGGGAGG + Intergenic
1026095046 7:67340292-67340314 TTGGACATGCAGTGAGAGGGAGG + Intergenic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1027893855 7:84015087-84015109 TTGGAGAAGGAGTGAGAGAGCGG - Intronic
1029361226 7:100089734-100089756 AAGGAGGAGCAGTGTGAGAGTGG + Exonic
1029598123 7:101548494-101548516 CTGGAGAAGCAGTGGAAAGCTGG + Intronic
1029821255 7:103149553-103149575 CTGGAGAGGCAGCCTGAAGGAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031287257 7:119885839-119885861 GTGGAGAATCTGTGTGTGGGGGG + Intergenic
1031484246 7:122309320-122309342 TGGGGGAAGAAGTGTGAGGGTGG + Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1033642899 7:143279273-143279295 CTGGAGGAGCAGTGTGGGAAAGG + Intergenic
1033741226 7:144277208-144277230 CTGGAGCAGCAGTTTGAGGCGGG + Intergenic
1033752677 7:144372406-144372428 CTGGAGCAGCAGTTTGAGGCGGG - Exonic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035117966 7:156540757-156540779 CATGAGAAGCAGGGAGAGGGTGG + Intergenic
1035311613 7:157973160-157973182 CTGGAGCAGCAGTGGGTGGGAGG + Intronic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037699625 8:21262780-21262802 CTGGACAAGCAGTGGGTTGGGGG + Intergenic
1038426881 8:27469519-27469541 CTGGAGAATCTGAGTAAGGGTGG - Intronic
1038646887 8:29369434-29369456 CTGGAGAAGAGGTGTTGGGGAGG + Intergenic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1040984692 8:53280822-53280844 CTGGAGCACCGCTGTGAGGGAGG + Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1043338026 8:79201510-79201532 CTGGACCAGCAGGGTGAGAGAGG - Intergenic
1043451034 8:80367106-80367128 CTTGATAAGCAGTGTGGGAGGGG + Intergenic
1044871199 8:96621609-96621631 CTGGAGAAGAATTCTGAGGTTGG - Intergenic
1046568345 8:115930341-115930363 CTGCAGAAGCACTGTGTTGGAGG - Intergenic
1046957156 8:120073516-120073538 CTGAAGATGCAGTGTGAAGAGGG - Intronic
1047599568 8:126412709-126412731 GAGTGGAAGCAGTGTGAGGGAGG + Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048747237 8:137627603-137627625 CTGGAGTGGCTGAGTGAGGGAGG - Intergenic
1049018109 8:139935919-139935941 CTGGAAATGCAGTGTCAGGATGG + Intronic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049714444 8:144083227-144083249 GTGGAGGAGCAGTTTGCGGGCGG + Exonic
1049825910 8:144667632-144667654 CAGGAGAAGAAGTGTGACTGTGG + Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050659817 9:7872061-7872083 CTTGTGAAGCAGTGTGAAGGGGG + Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1050799864 9:9597143-9597165 CTGTGGAAGCAGGCTGAGGGTGG + Intronic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052494001 9:29203507-29203529 TTGGGGTAGCAGTGTGAGAGAGG - Intergenic
1052823825 9:33161068-33161090 CTGGAGAAGCAGCGGGTGTGGGG + Intronic
1053103609 9:35391773-35391795 CAAGAGAAGTAGTGTGAGGTGGG + Intronic
1053290259 9:36875107-36875129 ATGGGGAAGCAGTGGGAGGCTGG - Intronic
1053443640 9:38135596-38135618 CTGGAAAAGCAGGGTGAGGGGGG - Intergenic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1056127865 9:83554687-83554709 CTGCAGAAGCAGTGGAAGAGAGG + Intergenic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057211048 9:93201315-93201337 CTGGAGGAGCAGGGGGAGTGGGG + Intronic
1057392641 9:94652547-94652569 CTGGATATGGAGGGTGAGGGGGG - Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1060683551 9:125586935-125586957 GTAGATAGGCAGTGTGAGGGAGG - Intronic
1060834660 9:126745997-126746019 CTGCAGTGGCAGTGGGAGGGTGG + Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061527479 9:131178803-131178825 CTGGAGAAGGGAAGTGAGGGAGG - Intronic
1061595337 9:131625208-131625230 CTAGTGAAGCAGGGAGAGGGCGG + Intronic
1061772334 9:132935591-132935613 CTGGAGGAGCCATGTGAGGCAGG + Intronic
1061974470 9:134061403-134061425 CTGGAGGAGCAGTGGCAGGGAGG + Intronic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1062308164 9:135921281-135921303 CTGGCCGAGCAGTGTGAGAGAGG - Intergenic
1062318363 9:135978840-135978862 CTGGAGAAGCACAGAGAGTGAGG - Intergenic
1187564562 X:20435586-20435608 CTGGAGAGGCACGGTGAGGGTGG + Intergenic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1193979893 X:88169144-88169166 CTGGAGAAGCAGTTAGGGGAGGG + Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1195322224 X:103729188-103729210 CTGGGGAAGGAGTGTCTGGGAGG - Intergenic
1195487725 X:105428498-105428520 CAGGAGATGCAGGGTGAAGGTGG - Intronic
1195849721 X:109270174-109270196 CTGGGATAGCAGTGTGAGGATGG - Intergenic
1195900380 X:109791300-109791322 CTTGAGAAGCAGGTTGAGAGAGG + Intergenic
1197371152 X:125627678-125627700 CATGAGAAGCAGTGTCAGGACGG - Intergenic
1197639443 X:128951843-128951865 CTGGGGAGGGAGTGTGAAGGTGG - Intergenic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198640802 X:138754526-138754548 CTGGTGAAGTAATGTGAGTGGGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199600629 X:149539565-149539587 CTGGAGATGCAGGGTGAGCAGGG - Intergenic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200061810 X:153487182-153487204 CTGGTGAGGCAGGGTGGGGGTGG - Intronic
1200871382 Y:8102279-8102301 TTGGAAAAGCAGTATTAGGGTGG + Intergenic
1201673930 Y:16558173-16558195 CTGGGGAAGCACTGTCAGGAAGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic