ID: 954761390

View in Genome Browser
Species Human (GRCh38)
Location 3:52877261-52877283
Sequence CTGAGGCATGTGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 389}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954761390_954761394 -9 Left 954761390 3:52877261-52877283 CCCTCCACCTTCACATGCCTCAG 0: 1
1: 0
2: 3
3: 41
4: 389
Right 954761394 3:52877275-52877297 ATGCCTCAGCCACCTGCCACTGG 0: 1
1: 0
2: 6
3: 28
4: 390
954761390_954761399 4 Left 954761390 3:52877261-52877283 CCCTCCACCTTCACATGCCTCAG 0: 1
1: 0
2: 3
3: 41
4: 389
Right 954761399 3:52877288-52877310 CTGCCACTGGCTGCGGCTCCAGG 0: 1
1: 0
2: 2
3: 37
4: 271
954761390_954761396 -3 Left 954761390 3:52877261-52877283 CCCTCCACCTTCACATGCCTCAG 0: 1
1: 0
2: 3
3: 41
4: 389
Right 954761396 3:52877281-52877303 CAGCCACCTGCCACTGGCTGCGG 0: 1
1: 0
2: 2
3: 33
4: 391
954761390_954761402 18 Left 954761390 3:52877261-52877283 CCCTCCACCTTCACATGCCTCAG 0: 1
1: 0
2: 3
3: 41
4: 389
Right 954761402 3:52877302-52877324 GGCTCCAGGCTTGTGCTCTTGGG 0: 1
1: 0
2: 2
3: 19
4: 214
954761390_954761401 17 Left 954761390 3:52877261-52877283 CCCTCCACCTTCACATGCCTCAG 0: 1
1: 0
2: 3
3: 41
4: 389
Right 954761401 3:52877301-52877323 CGGCTCCAGGCTTGTGCTCTTGG 0: 1
1: 0
2: 0
3: 22
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954761390 Original CRISPR CTGAGGCATGTGAAGGTGGA GGG (reversed) Intronic
900884756 1:5407147-5407169 CAGAGGCATGGGAACGTAGAAGG - Intergenic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901740987 1:11341773-11341795 CTGAGGCAGGTGAGTGTGGTTGG + Intergenic
902203461 1:14851076-14851098 CTGACACATCTGATGGTGGAAGG - Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902403566 1:16171360-16171382 CTGAGGCATGGGGAAGTGAAGGG + Intergenic
902876212 1:19342379-19342401 CTGAAGCATGGGGGGGTGGACGG + Intronic
903184851 1:21623081-21623103 GTGAGGCATGGGAAGCAGGATGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
904609364 1:31716589-31716611 CTGAGGGAGGTGGAGCTGGATGG - Intergenic
904631548 1:31846511-31846533 CTGAGCCATGTGAAAAGGGAAGG - Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905300625 1:36984329-36984351 ATGAGGGATGTGAATGTGGTAGG - Intronic
905786542 1:40762495-40762517 CTGGGGCAGGTGAATTTGGAGGG - Intronic
907028149 1:51142860-51142882 CTGAGGCATGAGAATCTGGGAGG - Intronic
907052800 1:51341070-51341092 CTGAGGCAGGAGAACCTGGAAGG + Intronic
907396407 1:54193415-54193437 GTGAGCCATGTGGAGATGGAGGG + Intronic
907614122 1:55906698-55906720 CTGTGGCATGTGAAGGAGTATGG + Intergenic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
908121928 1:60993988-60994010 CAGGGGCAAGTGGAGGTGGAAGG + Intronic
909462351 1:75932107-75932129 CTGAGGTATGTGGACTTGGATGG - Exonic
909555376 1:76948201-76948223 CTGATGCATGCAAAGGTGGGGGG - Intronic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
912553953 1:110502710-110502732 CTGTGGCATGTGGAGGCGGGGGG + Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
913176574 1:116278129-116278151 CTGAGGGATGTGATGATGGTGGG + Intergenic
913319478 1:117578235-117578257 CAGAGGCATGTGAGTGTGGGTGG - Intergenic
913665895 1:121048700-121048722 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914017293 1:143831976-143831998 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
915931205 1:160062031-160062053 CTGAGGCCTGAGAAGGGGAAGGG - Intronic
915986385 1:160469552-160469574 CTGAGCCATCTGAAGGCTGAAGG - Intergenic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
920677415 1:208047968-208047990 ATGAGGCATGGGGAGGTTGAGGG + Intronic
921148510 1:212381644-212381666 CCCAGGCCTGGGAAGGTGGAGGG - Intronic
922303639 1:224325326-224325348 CTTAGGGAGGCGAAGGTGGAAGG + Intronic
923298328 1:232616490-232616512 CTGAGGCTTGTTGAGGTGGAAGG - Intergenic
923320951 1:232832503-232832525 TTGTGGCATGTGGAGGTGGGAGG + Intergenic
923524085 1:234759075-234759097 ATGAAGGATGTGAAGATGGAGGG - Intergenic
923712141 1:236395910-236395932 CTGCGGCATGGGCAGGGGGAAGG - Intronic
924064829 1:240210224-240210246 CTGTGGAATGTGTAGGTGGCAGG + Intronic
1063337399 10:5229176-5229198 CTGAGGCAGGTCCAGGTGAAGGG + Intergenic
1063782908 10:9347406-9347428 CTGAGGCATATGAAAATTGAGGG - Intergenic
1063960576 10:11302224-11302246 CTGAGGCATGAGAAGGTGAGAGG - Intronic
1064203377 10:13302421-13302443 CTGGGGCGGGTGCAGGTGGAGGG + Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066442091 10:35448918-35448940 CTGAGGCATGTCAAGGGGCAAGG + Intronic
1067095405 10:43296249-43296271 CTAAGGCATGTAGAGGTAGACGG + Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067547653 10:47206075-47206097 CTCAGGCATTTGAAGGGGCATGG + Intergenic
1068915663 10:62428673-62428695 CTGAGGCATCTAAGGCTGGAGGG + Intronic
1069770638 10:70897190-70897212 CTGGGCCATGTGAAGCTGTAGGG + Intergenic
1070357607 10:75655875-75655897 ATGAGGGATGTGCAGGTGAAGGG - Intronic
1070360237 10:75681419-75681441 CTGAGGCATTTGCAGGTTGACGG + Intronic
1070540234 10:77410371-77410393 CTCAGGCATGAGAAGCTGGCTGG + Intronic
1070799927 10:79239357-79239379 ACCAGGGATGTGAAGGTGGATGG + Intronic
1071119222 10:82258762-82258784 ATGAGGAATGTGAAGGTTGGAGG + Intronic
1071297432 10:84232486-84232508 GTGAGGTCTGTGAAGGTGGTGGG - Exonic
1071787314 10:88916227-88916249 CTTAGGGTTGTGAAGGTTGATGG - Intronic
1074603491 10:114938016-114938038 CTGAGGCTTGTGAAGATCCATGG - Intergenic
1074876251 10:117615777-117615799 CTGAGGCATGTGCTGGGGGCTGG - Intergenic
1074904828 10:117852455-117852477 CTGAGGCACATGAATGAGGAGGG - Intergenic
1075676310 10:124298002-124298024 CTGAGGCATGAGAATCTGGGAGG + Intergenic
1077067123 11:646549-646571 CTGGGGCCTGTGCAGATGGAGGG + Intronic
1077694953 11:4385501-4385523 TGGAGGCACCTGAAGGTGGAGGG + Exonic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078525737 11:12099916-12099938 CTGAGGCATGAGAACCTGGGAGG - Intronic
1079144618 11:17839692-17839714 CTGTGGCATGTGCGCGTGGATGG - Intronic
1079175708 11:18138098-18138120 CTGAGGTGGATGAAGGTGGAGGG + Exonic
1079181455 11:18197275-18197297 CTGAGGTGGATGAAGGTGGAGGG + Intronic
1079263760 11:18910482-18910504 CTGAGGTGGATGAAGGTGGATGG - Intergenic
1079265999 11:18933867-18933889 CTGAGGTGGATGAAGGTGGAGGG - Exonic
1079893905 11:26094403-26094425 CTGAGGAACATGAAGGTAGAAGG - Intergenic
1080117735 11:28639297-28639319 CTGAGGCTTGAGTAGGTGGTTGG + Intergenic
1080204087 11:29708914-29708936 CTGAAACATGTGAAGTTGCAAGG - Intergenic
1081677580 11:44979895-44979917 TGGAGGCATGAAAAGGTGGAGGG + Intergenic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083618546 11:64037831-64037853 CTGAGGCACAGGGAGGTGGAGGG - Intronic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1084020081 11:66412079-66412101 CTGAGGTATCTGTTGGTGGAAGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1084194462 11:67516557-67516579 CTGAGGCCTGGGGAGGTGGTGGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085265086 11:75232819-75232841 CTTAGGGATGTGAAGCAGGAAGG - Intergenic
1085638225 11:78174339-78174361 CTCAGGCAGGTCAAGGTGGGAGG + Exonic
1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG + Intronic
1086193462 11:84108631-84108653 CTGAGGCAAGAGAAGGTAGCAGG + Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089090460 11:115870109-115870131 TTGAGGCATGTGAAAATGCATGG + Intergenic
1089809722 11:121121686-121121708 CTGAGGGTTGTGATGGTGGGGGG + Intronic
1090271813 11:125391399-125391421 GAGAGGCATTTGATGGTGGAGGG + Intronic
1090726615 11:129532728-129532750 CTCAGGCATGTGAAGAGAGATGG + Intergenic
1091111213 11:132970169-132970191 ATGAAGCATGTGAAAGAGGAGGG - Intronic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1093105580 12:15082249-15082271 CTGTGGCATAACAAGGTGGAAGG + Intergenic
1096829230 12:54301349-54301371 CTGAGTCATATCAAGGTGGAAGG + Intronic
1097542849 12:60961883-60961905 CTCAGGCATGTGAACGTTCATGG - Intergenic
1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG + Intronic
1099006730 12:77242965-77242987 CTGAGGCCTATGAAGGTGACTGG - Intergenic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1100363297 12:93897501-93897523 CTCATGCCTGTGCAGGTGGATGG - Intergenic
1101303636 12:103505472-103505494 CTGAGTCATGGGAACGTGGTAGG + Intergenic
1101804115 12:108048413-108048435 CTGAGGTTTGTGGAGGGGGAGGG + Intergenic
1102373719 12:112404132-112404154 CTGAGGCAGGAGAATTTGGACGG - Intergenic
1102676634 12:114664019-114664041 CTGACGTATGTGGAGGTGGAAGG + Intergenic
1102945041 12:116979441-116979463 CTGCTGCTTGTCAAGGTGGAGGG + Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103915682 12:124374449-124374471 CAGAGGCATGTAAGGCTGGAAGG + Exonic
1103974908 12:124696151-124696173 GTGAGGCCTGAGAAGCTGGAGGG - Intergenic
1105006046 12:132721188-132721210 CTGAGGCACGTGGATGAGGAGGG + Exonic
1105501563 13:20977294-20977316 CTGAGGCATGAGAACCCGGAAGG + Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1107117263 13:36760632-36760654 CAAAGGCATGTGAGGGGGGAAGG + Intergenic
1107648179 13:42516616-42516638 CTGAGGCATGAGTAGGTAGGTGG + Intergenic
1108304119 13:49113638-49113660 ATGAGGAATGTAAAGGGGGAAGG - Intronic
1108305443 13:49127557-49127579 GTGAAGCATGTCAAGGAGGAAGG - Intronic
1109405123 13:61887611-61887633 ATGAGGCATGGGAAGGAGAAAGG - Intergenic
1110368082 13:74709887-74709909 CTGAGGCATGGACAGGTGAAGGG - Intergenic
1110384586 13:74894002-74894024 CTGGGGCCTGTCAGGGTGGAGGG - Intergenic
1110397639 13:75049966-75049988 CAGAGGCATGTGCCAGTGGAAGG + Intergenic
1111476614 13:88757856-88757878 CTGAGGGATGTCATGGGGGAAGG - Intergenic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1113035184 13:106040342-106040364 CTTAGCCACGTGAAGTTGGAGGG + Intergenic
1114434914 14:22698071-22698093 CTTATGCATGTGTAGGTGCAGGG + Intergenic
1114840475 14:26257028-26257050 CTTAAGCAGGTGAATGTGGATGG + Intergenic
1116078014 14:40136942-40136964 CTGTGGCCTGTGAGTGTGGATGG + Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118657453 14:67967762-67967784 CTGTGGCTTTTCAAGGTGGAAGG + Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119896073 14:78220902-78220924 CTGTGGCATCTGAATGAGGAAGG + Intergenic
1121229118 14:92343401-92343423 CTGAGTCATGTGGAGGGTGATGG - Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1121434855 14:93912320-93912342 CTGAGTCATGTGGAGTTGGGAGG - Intergenic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1121638066 14:95467016-95467038 CTAAGGCATGTGAAGAGGCAGGG - Intronic
1121712244 14:96047336-96047358 CTGGGACATCTGCAGGTGGATGG + Intronic
1122051517 14:99064154-99064176 CAGGGGCTTTTGAAGGTGGAAGG - Intergenic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1123025450 14:105421648-105421670 CCGAGGCATGGGAAGGTTGGAGG - Intronic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124419938 15:29512238-29512260 CTGAAGCATGTGTAGTTTGAGGG - Intronic
1124951931 15:34331236-34331258 CTGAGGCATGAGAACCTGGGAGG - Intronic
1125457982 15:39880063-39880085 CTGAGTCTTGAGAAGGTTGAAGG - Intronic
1125767429 15:42144987-42145009 ATGAGGGCTGTGAAGGTGAACGG + Intronic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1131116872 15:89801395-89801417 CTGAGGCATGGTCAGGTGGGTGG - Intronic
1131360168 15:91783734-91783756 CTTAGGCATGGGAAAGAGGAAGG - Intergenic
1132685153 16:1159046-1159068 CTGAGGCACTTCAGGGTGGAGGG + Intronic
1133220449 16:4317170-4317192 CTGGGGCCTGGGAAGCTGGAAGG + Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134661042 16:15984857-15984879 CTTTGGCAGGTGAAGGTGGGAGG + Intronic
1135136528 16:19889020-19889042 ATGAGGCTTGGGAAGGTTGAGGG + Intergenic
1135847594 16:25932760-25932782 CTGAGGCTTAAGAAGGTGAAAGG + Intronic
1136050421 16:27646303-27646325 TTGAGGGATGTGAAGCTAGAGGG - Intronic
1136502617 16:30680429-30680451 TTGGGGCAGGTGAAGGTGAAAGG - Intergenic
1139776437 16:69319704-69319726 CAAAGACAAGTGAAGGTGGAAGG + Intronic
1142363281 16:89637165-89637187 CTGGGGGCTGTGAGGGTGGACGG + Intronic
1143579746 17:7818583-7818605 ATGAGGAAGGTGAAGGTCGAAGG + Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1145799270 17:27672743-27672765 ATGAAGCATGAGAAGGTAGAGGG - Intergenic
1146913946 17:36666100-36666122 CTGAGGCTGGTGAAGGTTGTGGG + Intergenic
1147039158 17:37704184-37704206 TTGAGGCATGAGAAGGCTGAAGG - Intronic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147985236 17:44302765-44302787 CTGAGGCAAGAGAATCTGGAAGG + Intergenic
1149082791 17:52678281-52678303 CTCAGGCATGTGAAGGCACAGGG - Intergenic
1150782269 17:68133666-68133688 CTGAGGGTTGTGTAGGTGGCTGG + Intergenic
1151183864 17:72349496-72349518 AGGAGGCGTGGGAAGGTGGAGGG + Intergenic
1151620299 17:75240914-75240936 CTGAGGCCTGGGGTGGTGGAGGG + Exonic
1152015342 17:77746979-77747001 ATGAGGCATGGGGAGGCGGAGGG - Intergenic
1152694672 17:81738171-81738193 CCGAGGCCTGAGACGGTGGAGGG + Intergenic
1152905082 17:82965548-82965570 CGGAGGCATGGCAAGGCGGAGGG + Intronic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155913999 18:31537902-31537924 CTGAGGCAGGTGAACCTGGGAGG + Intronic
1156449401 18:37258574-37258596 CTGAGGCAGGTGAGTGGGGAGGG + Intronic
1156572572 18:38275007-38275029 TGGAGCCATTTGAAGGTGGAGGG + Intergenic
1156641362 18:39104167-39104189 CTGAGGCTGTTGAAAGTGGAGGG + Intergenic
1156971883 18:43166774-43166796 CTCAGGAATGTAAAGATGGAAGG + Intergenic
1157556300 18:48615271-48615293 CTGAGAGCTGTGGAGGTGGACGG + Intronic
1158188126 18:54795155-54795177 CTCAGGCATGTGACAGTGGATGG - Intronic
1160665659 19:326846-326868 CAGAGGCTTGTGAAGGAGGCCGG + Intronic
1161084061 19:2325895-2325917 CTGAAGCCTGTGGAGGTGGACGG - Intronic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1163518077 19:17776732-17776754 CGGAGACATGGGGAGGTGGAGGG - Intronic
1163696980 19:18768990-18769012 CTGAGGCACGAGCAGGTGGCTGG + Intronic
1164137269 19:22426771-22426793 CTGCAGCATGTGAAAGTGGGGGG + Intronic
1164491811 19:28721469-28721491 TTGAAGCATTTGAAGGTGAAGGG - Intergenic
1164576593 19:29408868-29408890 CTCAGGCATGTGACGGTGCTTGG - Intergenic
1165247373 19:34505181-34505203 CTGAGGCCTGAGGTGGTGGAAGG + Exonic
1166267938 19:41696537-41696559 CTGAACCCTGTGAAGGAGGAAGG - Intronic
1166380392 19:42352497-42352519 CTGGGGCACATGGAGGTGGAGGG + Intronic
1167410351 19:49340427-49340449 CAGGGGAATGTGAAGGCGGAGGG - Exonic
1167703012 19:51061680-51061702 CGGAGGGATGTAAAAGTGGAAGG - Intronic
1167953339 19:53045242-53045264 AGGAGGCTTGTGAAGGTGGCAGG + Intronic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
925013647 2:504947-504969 AAGAGGCATATGAATGTGGAAGG - Intergenic
926124660 2:10264752-10264774 CTCAGGAATGTGCGGGTGGAAGG - Intergenic
927125765 2:20011741-20011763 CTGAGGCATATCAAGTTGAAGGG - Intronic
927212958 2:20649916-20649938 CTCAGCCATGTGCAGATGGATGG - Intronic
927620717 2:24654965-24654987 CTTAGGTATGTGGAAGTGGAAGG - Intronic
928186406 2:29115218-29115240 CTGAGGGCTGTGAAGGCGGTGGG + Intronic
928749942 2:34459328-34459350 CTGAGGCTTTTCCAGGTGGATGG - Intergenic
928757938 2:34547842-34547864 CTGAGGCATGTAAAAATGCATGG + Intergenic
929143564 2:38687186-38687208 CTGAGGCATGCGAGGATGGCAGG + Intronic
932501941 2:72190137-72190159 CTCAGGGAGGTGAAGGTGGGAGG - Intronic
933207809 2:79529197-79529219 ATGAGGCATGAGAAGGTGGTAGG + Intronic
933447447 2:82400081-82400103 CTTAGGCATATGAAGGTTCAAGG - Intergenic
934995342 2:98952718-98952740 CTGAGTCATGTGGAGGAGGCTGG - Intergenic
935580213 2:104750140-104750162 CTGAGGCCTGTGGAGGTTGAAGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936946338 2:117934333-117934355 CTGGGGTATGAGTAGGTGGAGGG - Intronic
938242418 2:129753581-129753603 CTGAGGCATGGGGAGGTTAAAGG - Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
941627262 2:167843907-167843929 CTGAGGCATGTGAAGTTTCTAGG + Intergenic
941949285 2:171136474-171136496 CTGAGGCAAGTGAACCTGGGAGG + Intronic
942037685 2:172026723-172026745 CTGAGACATGTTAAGATGAATGG + Intronic
942515533 2:176748525-176748547 CAAAGGCATGGGAAGGAGGATGG + Intergenic
943300181 2:186188580-186188602 TTTAGGCATGTAGAGGTGGAGGG - Intergenic
944317951 2:198303496-198303518 CTGGACCATGTGAAGCTGGAAGG - Intronic
944766783 2:202872009-202872031 CTGAGGCGTGGGGAAGTGGAAGG + Intergenic
944794996 2:203175024-203175046 ATGAGGCATATGAAGAAGGATGG + Intronic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
946805088 2:223463629-223463651 CTGAGGCTTGTCCAGGTGCAGGG - Intergenic
948619952 2:239228032-239228054 CAAAGGGATGGGAAGGTGGAAGG + Intronic
948733174 2:239980015-239980037 CTGAGGGATGTGGGGGTGTAGGG - Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1170621340 20:17998991-17999013 CTGAGGCTTTTGAACTTGGACGG - Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1171847020 20:30283517-30283539 TCCAGGCATGTGCAGGTGGAAGG - Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1173501358 20:43556445-43556467 CTGAGGAATGTCAAAGTGAAGGG + Intronic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1174178121 20:48657696-48657718 CTGGGGCGTGTGCAGGTGGGTGG - Intronic
1174745338 20:53056754-53056776 CTGAAGCATGTCCAGGTGCAGGG - Intronic
1175788237 20:61725240-61725262 CTGCGGTGTGTGCAGGTGGACGG - Intronic
1176378281 21:6097889-6097911 CTGCGGCATCCCAAGGTGGAAGG + Intergenic
1179126590 21:38596289-38596311 CTGAGGCATGTGAAGATCACAGG + Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179745191 21:43440358-43440380 CTGCGGCATCCCAAGGTGGAAGG - Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1181048901 22:20229504-20229526 CTGAGGCATGGGGAGGTGATGGG + Intergenic
1181132595 22:20742102-20742124 CTGAGGCTTGAGAAGGTGAGGGG + Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182849413 22:33459309-33459331 CTGAGGCCTGTGCATTTGGAGGG - Intronic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1184915561 22:47566419-47566441 CTGAGGTCTGTCATGGTGGAGGG + Intergenic
1185141840 22:49106907-49106929 CAGAGGCATGTGAGGGAGAAAGG - Intergenic
1185402089 22:50624474-50624496 CAGAGGCCTGGGAGGGTGGAGGG + Intronic
950199159 3:11030642-11030664 CTGAGGCATTTGAGGGACGAGGG + Intronic
951324862 3:21289196-21289218 ATGAGGCCAGTGAAGGTGGCAGG - Intergenic
951382081 3:21996037-21996059 CTCAGGGATGTGCAGGTGCAGGG + Intronic
952494090 3:33900876-33900898 GTGAGGTATGTGAGGGAGGAAGG + Intergenic
952902741 3:38120781-38120803 ATGAGGCAGGTGAGGTTGGATGG - Intronic
953105069 3:39869901-39869923 ATGAGATATGTCAAGGTGGAGGG + Intronic
953126229 3:40094048-40094070 TTGGGACATGTGAAGGGGGAGGG - Intronic
953378039 3:42445156-42445178 CTGAGGCATGAGAATCTGGGAGG + Intergenic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954326790 3:49868424-49868446 CTGAGGCATGGGGAGGTGAAGGG - Intronic
954461363 3:50628845-50628867 CTGGGGCTTGGGAAGGTGAAAGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954794622 3:53155182-53155204 CCCAGGCATGTGAAGGTGGTGGG + Intergenic
954951971 3:54483005-54483027 CTGCGACATGTTAAGGTGGTGGG - Intronic
955221779 3:57029098-57029120 CTGAGGCTTATGGAGGTGAAGGG - Intronic
955730033 3:61975244-61975266 ATGAGGCATGTGAGGGCAGAGGG - Intronic
956848641 3:73207372-73207394 CTGAGGCCTGTGGAGATGAAGGG + Intergenic
956941585 3:74168138-74168160 CTCAGGCATGTGGAGTTGGCAGG - Intergenic
957279203 3:78128035-78128057 TTGGGGCATGGGAAGTTGGAGGG - Intergenic
957894908 3:86409766-86409788 TAGAGGTCTGTGAAGGTGGAAGG - Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
959263747 3:104113092-104113114 CTGAGGCTTGTGAAGATCCATGG - Intergenic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
962634104 3:137312518-137312540 ATGAGACATCTGAAGGTGGCTGG + Intergenic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
964200281 3:154111456-154111478 CTGAGCCAGGTGAAGCTGAAAGG + Intergenic
964668663 3:159201744-159201766 CTGAGGCAGGTGAATGAGGCAGG - Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966228760 3:177627497-177627519 CGGAGGCATGTGAAGGCTGCAGG - Intergenic
966283045 3:178257664-178257686 CTCAGCCATGTGAAGATGCAGGG + Intergenic
967442788 3:189528285-189528307 CTGAGGCAGGAGAACCTGGAAGG - Intergenic
967611257 3:191508805-191508827 ATGAGGCATGTGAAGGAGCGTGG + Intergenic
968446777 4:656099-656121 CTGAGGCACGTGGAGCTGGCCGG - Intronic
969259999 4:6027409-6027431 CTGAGGCCTGGGAAGAGGGAAGG + Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
970228639 4:13885858-13885880 CTGAGGCAATAGAATGTGGAAGG - Intergenic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
972142817 4:35982533-35982555 GAGAGGCAGGTGTAGGTGGATGG - Intronic
972971679 4:44583541-44583563 CTGTGGCATGTGTGGGTGGCAGG - Intergenic
973377353 4:49296431-49296453 CTAAGGCATGTGAAAGTGAGAGG + Intergenic
973378275 4:49302567-49302589 CTAAGGCATGTGAAAGTGAGAGG + Intergenic
973380790 4:49318940-49318962 CTAAGGCATGTGAAAGTGAGAGG - Intergenic
977295487 4:95204376-95204398 CAGAGGCATGTGAAGTAGGCAGG + Intronic
977366267 4:96072247-96072269 CTGAGGCATGTTAAATTTGAAGG + Intergenic
981034594 4:140156377-140156399 TGGAGGCAAGTGAAGGAGGAGGG - Intergenic
981144707 4:141311036-141311058 CTGAGGGATGTCCAGGTGGCTGG - Intergenic
982137427 4:152285087-152285109 CTGAGGGTTGTGAAGATGGCAGG + Intergenic
982303408 4:153903439-153903461 CTGAGACATTTAAAGTTGGAGGG + Intergenic
982982133 4:162152115-162152137 CTGAGGCCTGAGAAAGTCGAAGG - Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
984412786 4:179416090-179416112 CTAAGACATGTGAAAGTGGAAGG - Intergenic
986137225 5:4992038-4992060 CTGAAGCATGTGCAAGTGGCAGG + Intergenic
988077196 5:26367857-26367879 CTGCAGCATGTGAAACTGGATGG - Intergenic
990410475 5:55535719-55535741 GTGAGGGAGGTGACGGTGGATGG - Intergenic
991588982 5:68229448-68229470 CTAAGTCAGGTGGAGGTGGAGGG - Intronic
991601344 5:68354459-68354481 CAGAGGGATGTGAAGGTGGCGGG - Intergenic
996523390 5:124451492-124451514 CTGAGGGAAGTGGAGATGGAAGG + Intergenic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997865126 5:137455278-137455300 CTGAGGCCAGAAAAGGTGGAGGG + Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1002563615 5:180098336-180098358 CTGAGGGATGTGAAGGATGAGGG + Intergenic
1003353151 6:5339676-5339698 CTGTGGCAGGTCAAGGTGGGTGG - Intronic
1004243998 6:13954878-13954900 AGAAGGCCTGTGAAGGTGGAGGG + Intronic
1005509802 6:26501916-26501938 CTGGTGCATCTGAAGGTGGCTGG + Exonic
1007094755 6:39206363-39206385 CTGAGGCATCTGCAGGGGAATGG - Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1009173513 6:60430400-60430422 CTGATGCATGTAAAGTGGGAAGG - Intergenic
1009807895 6:68626124-68626146 CTGAGGCATGAGAAGCGGGCAGG + Intergenic
1012094006 6:94934660-94934682 CTGAGGGAAGTCATGGTGGAGGG - Intergenic
1013067122 6:106694683-106694705 CTGAGGTAGGTGAAGGGGTAAGG - Intergenic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014102621 6:117528646-117528668 CTCAGGCAATTGCAGGTGGATGG - Intronic
1014522823 6:122466133-122466155 CTGAGGCATTTGAACTTGGGAGG + Intronic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1016892578 6:149021221-149021243 CTTATGCAAGTGAAGGTGGGAGG + Intronic
1018803946 6:167244270-167244292 GTGAGGCTTGTGACGGAGGAGGG + Intergenic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1023074473 7:36469413-36469435 AGGAGGCATGGGAAGGAGGAGGG - Intergenic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1023980639 7:45068073-45068095 CTGAGGCATGGGAAAGTGAAAGG - Intronic
1024177484 7:46856014-46856036 CTGAGGCATCTGATGAGGGAAGG - Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025850102 7:65238035-65238057 CTGCAGCATGTGAAAGTGGGTGG + Intergenic
1025945357 7:66100312-66100334 CTCAGGCCTGTAAAGGAGGAGGG + Intronic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026848508 7:73710812-73710834 CGGAGGCAGGTGGAGGTTGAGGG + Intronic
1027680882 7:81220261-81220283 CAGAGGCTTGGGAAGGTTGAGGG - Intergenic
1027842191 7:83326893-83326915 CGGAGGCATGTGAAGGGTTAAGG + Intergenic
1029566289 7:101340442-101340464 CTTAGGCATCCGAAGCTGGAGGG + Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1034254641 7:149717895-149717917 CTGAGGCAGGAGAACCTGGAAGG - Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1035473721 7:159128136-159128158 CTGAGGGATGTGACGGGGGTGGG + Intronic
1035642761 8:1196604-1196626 CAGAGGCATCTGCAGGTCGAGGG + Intergenic
1036025212 8:4900099-4900121 GCCAGGCATGGGAAGGTGGAAGG - Intronic
1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG + Intronic
1037587168 8:20285301-20285323 CTGAGGCAGGTCAGGGTGGCAGG - Intronic
1038528608 8:28298043-28298065 TTGAGGCATTTGAGGGTGAAAGG - Intergenic
1040663120 8:49598258-49598280 CTGAAGCATGTAACGCTGGACGG - Intergenic
1042076582 8:65001891-65001913 TTGAGGCATGTTAAGGTGTTAGG + Intergenic
1042112527 8:65395842-65395864 CTGAGCCATGTGTATGTGTAGGG + Intergenic
1042342135 8:67691503-67691525 CTGAGGCCTGAGAAGGTGGTGGG + Intronic
1042405403 8:68399315-68399337 CGGAGGCATGGAAAGGTGGGAGG - Intronic
1043546075 8:81317090-81317112 CAGAGGCATGTGAAGACAGAGGG + Intergenic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1045826795 8:106407673-106407695 CTGAAACATGTGATGGAGGAAGG + Intronic
1046239784 8:111475598-111475620 AGGAGGCATGTGAGGGTGGCAGG + Intergenic
1046795839 8:118370771-118370793 CTGGGGCCTGTCAGGGTGGAGGG + Intronic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047115256 8:121834639-121834661 CTGTTGCATGTGAAGGAGTAGGG + Intergenic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1047376471 8:124301721-124301743 CTGGGACATGTGAAGTTGGCTGG - Intergenic
1048182214 8:132205961-132205983 CTTTGGTATGTGAAGGTGGAAGG + Intronic
1049301441 8:141872706-141872728 CAGAGGCAGGTGAGGGTGGTGGG + Intergenic
1049313778 8:141948009-141948031 CTCAGGCATGGTAGGGTGGAGGG + Intergenic
1049486410 8:142866039-142866061 CTGGGGCATGTGCAGGTGCCTGG + Intronic
1049509829 8:143021922-143021944 CTGGGGCAGGTGGAGGTGCAGGG - Exonic
1051250108 9:15150904-15150926 TGTAGGCATGTGAAGGTAGATGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052035644 9:23677305-23677327 CTGGGGCCTGTGTAGGGGGAGGG + Intergenic
1052801537 9:32972680-32972702 CTGATGCATGGAAAGGTGGTTGG - Exonic
1055297104 9:74844943-74844965 CTGTGGCATCTCAAGGTAGAGGG + Intronic
1055674963 9:78648730-78648752 CTGGGGCCTGTCAGGGTGGAGGG + Intergenic
1057045328 9:91881860-91881882 CTGAGGCATCTGAATTTTGAGGG + Intronic
1057731685 9:97614639-97614661 ATGCGCCATGTGAAGGTGCAGGG + Intronic
1057731939 9:97617204-97617226 ATGCGCCATGTGAAGGTGCAGGG + Intronic
1058748589 9:108016614-108016636 CTGGGGCATGAGAGTGTGGAAGG + Intergenic
1058875575 9:109241911-109241933 ATGAGCCATGTGAATGGGGATGG + Intronic
1058893364 9:109379992-109380014 CCTAGGCATGTGGAGGAGGAGGG + Intronic
1059009557 9:110441866-110441888 CTGAAGCATTTTAAGATGGATGG - Intronic
1060488637 9:124065602-124065624 CTGGGGCATGTCAACTTGGAAGG - Intergenic
1060990278 9:127845050-127845072 CTGAGGAATGTGCCGGGGGAAGG + Intronic
1061382856 9:130268709-130268731 CTGGGGCATGTGGAGCTGGCTGG + Intergenic
1061465821 9:130778651-130778673 CTGGGGGATCTGAAAGTGGATGG - Intronic
1062106657 9:134758556-134758578 CTGAGGCGCGTGAAGGGGGCAGG + Intronic
1062147389 9:134997212-134997234 CTCAGGCCTGTGAAGATGGCGGG + Intergenic
1062448807 9:136607018-136607040 CAGAGGCCTTTGAAGTTGGAAGG - Intergenic
1185770687 X:2763464-2763486 CTGGGGCATGTGGCGGTGGGAGG + Intronic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186481906 X:9902348-9902370 TGGAGGCATGGGAAGGTGGATGG + Intronic
1187407589 X:19017577-19017599 ATGGGGCATGTGAAGCTGAATGG + Intronic
1187409650 X:19039126-19039148 CTGAGGCATGGAAAGGTTAAAGG + Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1189401623 X:40674736-40674758 CTCAGACATGTGAAGGTGACAGG + Intronic
1190932579 X:54961959-54961981 CTGAGGCCTGAGATGCTGGAAGG + Intronic
1192302666 X:69921958-69921980 CAGAGGTATGTGGAGGAGGAGGG - Intronic
1192773489 X:74217521-74217543 ATGATGCAGGTGAAGCTGGAAGG - Intergenic
1194414751 X:93597262-93597284 CTGAGGGATGTAGAGGTGGTTGG + Intergenic
1195310055 X:103624143-103624165 CTGAGGCCTGGGAAGGAGGCTGG - Intronic
1195455516 X:105064820-105064842 TTGAAGGATGTGAAGGTGGAAGG + Intronic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1196076180 X:111578743-111578765 CTGATGTACATGAAGGTGGAGGG - Intergenic
1198837994 X:140824915-140824937 CTGGGGCCTATGAGGGTGGAGGG - Intergenic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic
1201305911 Y:12550401-12550423 TGGAGGCATGGGAAGGTGGATGG + Intergenic