ID: 954767727

View in Genome Browser
Species Human (GRCh38)
Location 3:52935288-52935310
Sequence GAGTTGTAGCTTGTAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954767727_954767732 27 Left 954767727 3:52935288-52935310 CCAGGATTTACAAGCTACAACTC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 954767732 3:52935338-52935360 TTTTGTTAATAAAGTTTTACTGG 0: 2
1: 109
2: 997
3: 1523
4: 2027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954767727 Original CRISPR GAGTTGTAGCTTGTAAATCC TGG (reversed) Intronic
902317006 1:15629046-15629068 GAGTTGTAGCTTCTAAACTGTGG + Intronic
904003822 1:27353088-27353110 GAGCTGTAACTTTTAAAGCCAGG + Intronic
905838619 1:41153169-41153191 GAGTTGAAGATTCTCAATCCAGG - Intronic
908702793 1:66920332-66920354 GAGTTGAAGCTGGTAAATGCAGG - Intronic
915196300 1:154192526-154192548 GAGTTTTAGCTTTTGATTCCTGG + Intronic
915326333 1:155082893-155082915 GAGTTGTGGCTGGGAATTCCTGG + Intronic
923380483 1:233412760-233412782 GAGTTGTGATTTGTGAATCCTGG + Intergenic
1064198758 10:13266852-13266874 GAGATGAAGTTTGTAGATCCAGG - Intergenic
1066281006 10:33918388-33918410 GAGTTGAAGATGGTAAATTCAGG + Intergenic
1067694728 10:48526567-48526589 GAGCTCTAGCTTGGAATTCCTGG - Intronic
1070240294 10:74673762-74673784 GAGTTGGAGATGGTAAATGCAGG + Intronic
1071526392 10:86362225-86362247 AAGTTGTAGCTTGTCACCCCAGG + Intronic
1073139032 10:101235812-101235834 GAGTTGAACTTTGTAAAACCAGG + Intergenic
1073443402 10:103565952-103565974 CAGTTGTAGCTTTTAAATTGAGG + Intronic
1076754320 10:132560780-132560802 AAGTTTTAGTTTGTAAATACAGG + Intronic
1085583867 11:77681790-77681812 GAATTGTAGTTTGTAAATTATGG - Intronic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1095344154 12:41129638-41129660 GAGTTGTAGTTAGTAAAACCAGG + Intergenic
1095748327 12:45684008-45684030 AAGTTGTACCTTGCAATTCCAGG + Intergenic
1098533478 12:71568511-71568533 GAGTTGGAACTTGAAAAGCCGGG + Intronic
1098558120 12:71842012-71842034 GAGTTCTAGTTTAGAAATCCAGG + Intronic
1102559100 12:113749448-113749470 GAGCTGTGGTTAGTAAATCCTGG + Intergenic
1102727670 12:115079870-115079892 GGGTTGTAGTTTGTAAGCCCTGG + Intergenic
1103938107 12:124487046-124487068 GAGCTGAAGCTTGGAAATGCAGG + Intronic
1115751416 14:36496009-36496031 GAGTTGTACCTTATAAATTTAGG + Intronic
1118408913 14:65456333-65456355 AAGATGTAGTTTTTAAATCCTGG + Intronic
1118693201 14:68359787-68359809 CAGTTCTGGCTTCTAAATCCTGG - Intronic
1121102139 14:91257048-91257070 GTTTTGTTGCTTGTAAAGCCAGG - Intergenic
1134276329 16:12779822-12779844 TAGTTGTACCTTGTAAACCGAGG - Intronic
1135916898 16:26613385-26613407 GAGGTGAAGCTGGTAGATCCAGG + Intergenic
1139684201 16:68590219-68590241 GAGTTGCACCTTCTAACTCCAGG - Intergenic
1155828066 18:30474122-30474144 GTCTTGTAGCTTGTGAAACCAGG - Intergenic
1158951762 18:62501694-62501716 TAGTTGTAGCTTCTAAATATAGG - Intergenic
929287384 2:40150491-40150513 TAGTTGTTGCTTGCAAATCAAGG - Intronic
931707998 2:64963747-64963769 GAGCTGTAGCATGTCAGTCCAGG - Intergenic
932517402 2:72367241-72367263 AAGATGTATATTGTAAATCCAGG + Intronic
934536011 2:95134210-95134232 GAGATGTGGCTTGGACATCCAGG - Intronic
935092707 2:99911590-99911612 GAAATGCAGCTTGTAAATGCAGG + Intronic
940397448 2:153206890-153206912 GAGTTGTAATTTTTAAATCTAGG - Intergenic
943208699 2:184933637-184933659 GAAATGTAGCATCTAAATCCAGG + Exonic
944862484 2:203828294-203828316 GTCTTGTAGCTTGCAAGTCCAGG + Intergenic
1169097918 20:2919801-2919823 GGGTTGTAGTTTGCCAATCCAGG - Intronic
1172671141 20:36635198-36635220 GCCTTGTAGCCTGAAAATCCAGG + Intronic
1175748922 20:61481342-61481364 GAGTTGCAGCTGGGAACTCCTGG + Intronic
1178494058 21:33071823-33071845 GAGTTTTCGCTCTTAAATCCTGG + Exonic
1180017321 21:45095868-45095890 GAGCTGTAGGCTGTAAGTCCTGG + Intronic
1181101199 22:20540615-20540637 TAGTTTTAGCTTGTAAATTTAGG - Intronic
951590762 3:24261895-24261917 GTCTTGTAGCTTGTAAAGGCTGG - Intronic
954767727 3:52935288-52935310 GAGTTGTAGCTTGTAAATCCTGG - Intronic
956329725 3:68092867-68092889 GAGTTGTAGTGTGTAAATCTTGG - Intronic
963020533 3:140869097-140869119 GCGGTGTAGCTTGTAGCTCCAGG - Intergenic
963168996 3:142232265-142232287 GACCTGAAGCTTGTAAAACCTGG - Intergenic
966597028 3:181733206-181733228 GATTTGTATCTTGGAAATCAAGG + Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982717097 4:158820446-158820468 TAGTAGTGACTTGTAAATCCTGG - Intronic
988683615 5:33506373-33506395 GAGTTGTAGTCTGTAATTCAGGG - Intergenic
998303234 5:141046805-141046827 GCGTCGTAGCTTGTAAAGTCAGG - Intergenic
1012523358 6:100147276-100147298 GAGTTTTAGCATGTAATCCCTGG + Intergenic
1016710007 6:147159555-147159577 GAGTTGTATGTTGTGAACCCAGG + Intergenic
1017580007 6:155853858-155853880 GAGTCTTAGCTTCTAAATGCAGG + Intergenic
1018494201 6:164331659-164331681 GAGATGTGGGTTGGAAATCCAGG - Intergenic
1027865936 7:83646896-83646918 GAATTGTAGCTTGCAAAAACTGG + Intronic
1048844713 8:138595456-138595478 GAGTTCTACCTTCTGAATCCTGG - Intronic
1059595204 9:115712793-115712815 AAGTTTTAGCTTGTAAATTCAGG + Intergenic
1060654703 9:125362233-125362255 GAGTTATATCTGGTAAGTCCAGG - Intronic
1191790566 X:64967950-64967972 GAATGGTAGGTAGTAAATCCAGG + Intronic
1193147660 X:78093726-78093748 CAGATGTAGCTTGTCAATCTTGG - Intronic
1196209949 X:112985018-112985040 GGGTTGAAGCTTATAACTCCTGG + Intergenic