ID: 954777338

View in Genome Browser
Species Human (GRCh38)
Location 3:53031837-53031859
Sequence AAACCTGTGAACCTACTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954777338_954777339 -3 Left 954777338 3:53031837-53031859 CCTGGGAGTAGGTTCACAGGTTT 0: 1
1: 0
2: 0
3: 7
4: 195
Right 954777339 3:53031857-53031879 TTTTAATATTCTCTATAGAGTGG 0: 1
1: 0
2: 5
3: 56
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954777338 Original CRISPR AAACCTGTGAACCTACTCCC AGG (reversed) Intronic
900407022 1:2497245-2497267 AGGCCTGTCCACCTACTCCCAGG + Intronic
902391053 1:16106719-16106741 AAAGCTGTGAGCCTTCTACCTGG - Intergenic
902965584 1:19998809-19998831 AAATCTGTGAGCCTTCTGCCTGG + Intergenic
906060625 1:42946255-42946277 AAACCTGCCTACCCACTCCCTGG + Intronic
907488418 1:54792998-54793020 AGTCCTGTGAGCCTCCTCCCAGG - Intronic
910410705 1:86941420-86941442 AAATCTGTGTACCTACTACTTGG + Intronic
911136516 1:94446301-94446323 AAAGCTGTGAGCCTTCTGCCTGG + Intronic
914767824 1:150654787-150654809 AAAGCTGTGAGCCTTCTGCCTGG + Intronic
915879576 1:159652753-159652775 GAATCTGTGAATCTGCTCCCTGG - Intergenic
916703490 1:167322480-167322502 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
917799609 1:178558924-178558946 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
921226997 1:213030376-213030398 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
924765263 1:247026168-247026190 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1063196587 10:3749268-3749290 AAAGCTCTGAAACTACTCCTGGG - Intergenic
1066802850 10:39209317-39209339 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1066989280 10:42496976-42496998 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1066990558 10:42509347-42509369 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1067133451 10:43587033-43587055 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1068166593 10:53339606-53339628 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1069056470 10:63849505-63849527 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1069390911 10:67933930-67933952 AATCCTTTGGACCAACTCCCTGG + Intronic
1070966953 10:80535858-80535880 AAACCTGTGTGACTACTCCGTGG + Intergenic
1074980225 10:118613647-118613669 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1076416401 10:130292868-130292890 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1078359227 11:10655584-10655606 AATCCTGTGACCCTTGTCCCAGG - Intronic
1081927310 11:46841656-46841678 CATCCTGTGAACCAACTCCCAGG - Intronic
1082301404 11:50510464-50510486 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1083066132 11:59925599-59925621 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1084367892 11:68715195-68715217 AAGGCTGTCAACCTACTCCAGGG - Intronic
1085718464 11:78893173-78893195 ACACCTCTGAAGCTCCTCCCAGG - Intronic
1086478568 11:87207906-87207928 AAAACTGTGAACCTGGTCTCAGG + Intronic
1088492102 11:110398286-110398308 AAAGCTGTGAGCCTTCTACCTGG + Intergenic
1089756352 11:120690424-120690446 AAACCTGTGACCCTGCCTCCTGG + Intronic
1093745623 12:22737618-22737640 ATCCATGTGAAGCTACTCCCTGG - Intergenic
1095912931 12:47447336-47447358 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1096308099 12:50496765-50496787 AAAACTGTGAGCCTTCTGCCTGG - Intergenic
1096450706 12:51738847-51738869 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
1098639741 12:72824562-72824584 AACACTGTGAAATTACTCCCTGG - Intergenic
1100414521 12:94357637-94357659 AAAGCTGTGAGCCTTCTGCCTGG + Intronic
1100586361 12:95983702-95983724 TGACCTGTGAACTTACTCTCAGG - Intronic
1100874861 12:98951166-98951188 AAAGCTGTGAACCAGCTCCAGGG - Intronic
1101501399 12:105307699-105307721 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
1105352441 13:19627856-19627878 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1105710857 13:23007634-23007656 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1107237904 13:38195201-38195223 ATACATGTGAACCTTCTCTCAGG - Intergenic
1109612305 13:64782179-64782201 AACCCAGTAAACCAACTCCCAGG - Intergenic
1110663709 13:78090428-78090450 AAACCTATGAAACTACTACAAGG + Intergenic
1116238540 14:42312101-42312123 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1117082419 14:52165791-52165813 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1117600332 14:57367364-57367386 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1119127009 14:72136901-72136923 TAATTTGAGAACCTACTCCCTGG + Intronic
1121501455 14:94441647-94441669 AAACCCCTGACCCTACTCCAAGG - Intergenic
1122312278 14:100804736-100804758 AAACCAGCAAACCTGCTCCCTGG + Intergenic
1122868517 14:104621962-104621984 AAACCTGTCAACCTTTTCCCTGG - Intergenic
1202843666 14_GL000009v2_random:147338-147360 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1202913070 14_GL000194v1_random:137580-137602 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1202879581 14_KI270722v1_random:45103-45125 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1124897108 15:33787686-33787708 AAACCTGCCAACCTATTGCCTGG - Intronic
1126604971 15:50467167-50467189 AAACATGTGAATATATTCCCAGG + Intronic
1136638448 16:31540933-31540955 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1138293400 16:55867203-55867225 AAACCTGTGAGCCTGCTGTCAGG + Intronic
1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG + Intronic
1145219720 17:21078251-21078273 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1145890878 17:28414794-28414816 AAACCTGGGATCCTCTTCCCAGG - Intergenic
1146344193 17:32047071-32047093 AAATCTCTTAACCTACACCCTGG + Intronic
1156597938 18:38569478-38569500 AATGCTGTTAACCTACCCCCAGG + Intergenic
1157591585 18:48839305-48839327 AAACCTTTGAAGCTACAGCCAGG - Intronic
1157594619 18:48857044-48857066 AAACCTGTGGACTTACTCAGGGG - Intronic
1157735131 18:50040870-50040892 AAATGTGTAATCCTACTCCCTGG - Intronic
1157795590 18:50571321-50571343 AAATCTGTAACCCCACTCCCAGG + Intronic
1162652614 19:12102200-12102222 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
1164024923 19:21343196-21343218 AAACCTGTGAGCCTTCTGCCTGG - Intergenic
1164060717 19:21671317-21671339 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1164261959 19:23575901-23575923 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
1164306362 19:24007175-24007197 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1166467146 19:43042646-43042668 AAAACTGTCCCCCTACTCCCAGG + Intronic
1166659098 19:44634080-44634102 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
1202655200 1_KI270708v1_random:14109-14131 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
927118140 2:19925116-19925138 AAAACTGTGAGCCTTCTGCCTGG + Intronic
927819970 2:26255531-26255553 AATCCTGGGAACCAAATCCCAGG - Intronic
930541168 2:52708593-52708615 AGTCCTGTGAACCTACTCATAGG - Intergenic
930775238 2:55164230-55164252 CTACCTGTGAACCTGATCCCTGG - Intergenic
930918325 2:56721074-56721096 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
938117460 2:128611755-128611777 AAACCTGAGCTCCTCCTCCCAGG + Intergenic
939529425 2:143338760-143338782 AAACCTGTGCACCAATGCCCTGG + Intronic
939929627 2:148217078-148217100 AAATCTCTTAACCTACACCCCGG + Intronic
940301471 2:152180174-152180196 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
941469154 2:165862986-165863008 ATACCTGTGAATGTACTTCCTGG - Intronic
943062392 2:183052523-183052545 AAACCTGTGAGCCTTCTGCCTGG - Intergenic
946206651 2:218113795-218113817 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
947102652 2:226637942-226637964 AAACCTGTAAAGTTACTCGCAGG + Intergenic
948296187 2:236862440-236862462 AAACCTCTGAACTCAGTCCCTGG - Intergenic
948560127 2:238846915-238846937 ATGCCTTTGAACCTATTCCCAGG - Intergenic
1169235719 20:3928383-3928405 AAGTCTGTGCCCCTACTCCCAGG + Intronic
1170356681 20:15499603-15499625 AAGCCTGTGATCCTACACACAGG - Intronic
1171229228 20:23469123-23469145 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1171420669 20:25015184-25015206 CACCCTGTGAAGCCACTCCCAGG + Exonic
1173067060 20:39723141-39723163 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1173787268 20:45803344-45803366 AATCCTGTGAACCAATTCGCCGG + Exonic
1175846609 20:62063123-62063145 AGAGCTGTGAAGCTACTTCCCGG - Intronic
1176632423 21:9152252-9152274 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1176640884 21:9302564-9302586 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1178125935 21:29515823-29515845 AAACTTGTGGACCTGCTCCATGG + Intronic
1180150210 21:45943416-45943438 ACTCCTGTGAGCCTCCTCCCAGG - Intergenic
1180349911 22:11791946-11791968 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1180388298 22:12200306-12200328 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1181116144 22:20633490-20633512 ACACCTGTGAACCTGCTGGCAGG - Intergenic
1182767507 22:32768975-32768997 AACCCTGTGCTCCTACTCCATGG + Intronic
1185180967 22:49362890-49362912 AAACCTGTGAACCTGTTACCTGG - Intergenic
952142098 3:30491388-30491410 AGATCTCTAAACCTACTCCCAGG - Intergenic
954232638 3:49229272-49229294 AAAGCTGTGAGCCTTCTGCCTGG + Intronic
954777338 3:53031837-53031859 AAACCTGTGAACCTACTCCCAGG - Intronic
956129481 3:66039740-66039762 AAGCCTGCGGACCTACTCCGGGG + Intergenic
956853973 3:73257775-73257797 ATATCTGTGGACCTACTACCTGG - Intergenic
959198066 3:103210991-103211013 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
960527914 3:118731205-118731227 AAACCTGAGGACCTACTGACTGG - Intergenic
960788245 3:121398319-121398341 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
961323312 3:126093494-126093516 AAAGCTGTGAGCCTTCTGCCTGG + Intronic
961450365 3:126999763-126999785 AAAGGGGTGAACCTGCTCCCTGG + Intronic
961643715 3:128381242-128381264 AGAGCTGTGAACCAACTGCCTGG - Intronic
962056141 3:131873805-131873827 CATCCTGTGTACCTTCTCCCTGG + Intronic
965669943 3:171136856-171136878 AATTTTGTGATCCTACTCCCAGG - Intronic
966009283 3:175055453-175055475 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
966083607 3:176038241-176038263 AAAACTGTGAAACTACTAGCAGG - Intergenic
966968252 3:185017699-185017721 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
966978406 3:185106727-185106749 AAAGCTGTGAGCCTTCTGCCTGG + Intronic
1202746008 3_GL000221v1_random:102459-102481 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
972080360 4:35141817-35141839 AAAACTGTGAGCCTTCTGCCTGG + Intergenic
973008593 4:45044127-45044149 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
974635999 4:64564674-64564696 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
975352224 4:73359216-73359238 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
976977777 4:91185479-91185501 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
977443652 4:97101393-97101415 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
977625976 4:99190310-99190332 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
977720983 4:100240079-100240101 CATCCAGTGAACCAACTCCCAGG - Intergenic
977856829 4:101905286-101905308 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
979689672 4:123547210-123547232 AAACCTGTTTTCCTCCTCCCAGG + Intergenic
980297516 4:130941832-130941854 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
981623874 4:146734989-146735011 CATCCAGTGAACCAACTCCCTGG - Intronic
984060906 4:174988283-174988305 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
984956336 4:185049614-185049636 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
985635958 5:1036031-1036053 AACCCTGTGAACTCCCTCCCAGG - Intronic
986544848 5:8884359-8884381 AAAAATGTGAACCTACTTGCTGG - Intergenic
988611126 5:32726211-32726233 AAACCTTAAAACATACTCCCCGG + Intronic
989742581 5:44790119-44790141 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
989758784 5:44987639-44987661 AAACCTGTGAGCCTTTTGCCTGG + Intergenic
990109558 5:52306561-52306583 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
993405999 5:87512410-87512432 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
995592422 5:113713321-113713343 AAAGCTGTGAACCTTCTGCCTGG + Intergenic
995711526 5:115040971-115040993 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
996280056 5:121719530-121719552 AATCATGTGAAACTACTGCCTGG - Intergenic
996643980 5:125792909-125792931 ACACCAGTGAACATACTACCAGG - Intergenic
1000518809 5:162274574-162274596 AAACCTGTGAGCCTATTTCTTGG - Intergenic
1005858210 6:29880409-29880431 AAATCTGTGAGCCTTCTGCCTGG - Intergenic
1006113344 6:31762022-31762044 AATCCTGTGGACCTAGACCCAGG - Intronic
1006138725 6:31913995-31914017 CAACCTGCGATCCGACTCCCTGG + Intronic
1008093443 6:47315227-47315249 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1008925336 6:56886110-56886132 AAAGATGTAAAGCTACTCCCTGG + Intronic
1013475281 6:110501251-110501273 AAAGCTGTGAGCCTTCTACCTGG + Intergenic
1013739589 6:113267248-113267270 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1016012106 6:139147853-139147875 AAACCAGTGATCCTACTGCTAGG - Intronic
1019123687 6:169825205-169825227 CACCCTGTGAGCCCACTCCCTGG + Intergenic
1021116951 7:16754534-16754556 CATCCTGTGAACCTACTCAGTGG - Intronic
1021192557 7:17638593-17638615 AAAACTGTGGACCTGCTCCTCGG - Intergenic
1021880515 7:25091017-25091039 AAACCTTTGACCCATCTCCCAGG + Intergenic
1024911309 7:54450243-54450265 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1025122674 7:56318464-56318486 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1027303257 7:76864005-76864027 AATACTGTGAAAATACTCCCAGG + Intergenic
1028780176 7:94727211-94727233 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1032784840 7:135192849-135192871 CAGCCTGTGAACTTGCTCCCAGG - Intronic
1034246664 7:149649929-149649951 AAAGCTGTGAGCCTTCTACCTGG - Intergenic
1034581094 7:152043330-152043352 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
1040381557 8:46877931-46877953 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1040609061 8:48964357-48964379 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1040956233 8:52982844-52982866 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1041196836 8:55409145-55409167 AAAGCTGTGAACCAATTCTCAGG + Intronic
1042446474 8:68890719-68890741 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1044442521 8:92238626-92238648 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1046144128 8:110134867-110134889 AAGCCAGTGAACTTACTCACTGG + Intergenic
1047562970 8:126009119-126009141 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1049857623 8:144873119-144873141 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1054773521 9:69105321-69105343 AAACCTGGGTCCCTCCTCCCAGG - Intergenic
1057992553 9:99785533-99785555 TATCCTGTAATCCTACTCCCAGG + Intergenic
1059314652 9:113413715-113413737 AAACATGTTAACCTGCTGCCTGG - Intronic
1059621325 9:116008710-116008732 CAACCTGGCAACCTACTCTCTGG - Intergenic
1059901131 9:118927286-118927308 AAACCACTTAACCTACTGCCTGG + Intergenic
1061602735 9:131682422-131682444 AAAGCTGTGAGCCTTCTGCCTGG + Intronic
1203687380 Un_GL000214v1:7882-7904 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1203755253 Un_GL000218v1:119876-119898 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1203714630 Un_KI270742v1:132417-132439 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1203648895 Un_KI270751v1:96171-96193 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1188305374 X:28555513-28555535 AAACCAGTGAGTCTACTCACTGG + Intergenic
1189515785 X:41712258-41712280 CAACCAGTGAACCAACTCCCCGG - Intronic
1190052035 X:47157649-47157671 AAACCTGTGCACCAGCTCCAGGG + Intronic
1191833652 X:65441757-65441779 AAAGCTGTGAGCCTTCTGCCTGG - Intronic
1192154268 X:68732132-68732154 AGTACTGTGATCCTACTCCCAGG - Intergenic
1192197551 X:69038570-69038592 AAACCTTTGAAATTACTCCTAGG - Intergenic
1192687550 X:73323041-73323063 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic
1192884721 X:75324414-75324436 AAAACTGTGAGCCTTCTGCCTGG + Intergenic
1198732380 X:139746143-139746165 AAAACTGTGAACCCAGTTCCTGG - Intronic
1200978590 Y:9240066-9240088 AAAGCTGTGAGCCTTCTGCCTGG + Intergenic
1201168869 Y:11237484-11237506 AAAGCTGTGAGCCTTCTGCCTGG - Intergenic