ID: 954778999

View in Genome Browser
Species Human (GRCh38)
Location 3:53045747-53045769
Sequence GAGGGGCGGCGGCGGCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1782
Summary {0: 1, 1: 1, 2: 22, 3: 275, 4: 1483}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954778999_954779007 -7 Left 954778999 3:53045747-53045769 CCCCGGCGCCGCCGCCGCCCCTC 0: 1
1: 1
2: 22
3: 275
4: 1483
Right 954779007 3:53045763-53045785 GCCCCTCCAGGCCGCCGCGCGGG 0: 1
1: 0
2: 3
3: 27
4: 228
954778999_954779016 9 Left 954778999 3:53045747-53045769 CCCCGGCGCCGCCGCCGCCCCTC 0: 1
1: 1
2: 22
3: 275
4: 1483
Right 954779016 3:53045779-53045801 GCGCGGGAAGGCCCAGCCGGTGG 0: 1
1: 0
2: 1
3: 26
4: 170
954778999_954779014 6 Left 954778999 3:53045747-53045769 CCCCGGCGCCGCCGCCGCCCCTC 0: 1
1: 1
2: 22
3: 275
4: 1483
Right 954779014 3:53045776-53045798 GCCGCGCGGGAAGGCCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 174
954778999_954779011 -3 Left 954778999 3:53045747-53045769 CCCCGGCGCCGCCGCCGCCCCTC 0: 1
1: 1
2: 22
3: 275
4: 1483
Right 954779011 3:53045767-53045789 CTCCAGGCCGCCGCGCGGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 116
954778999_954779006 -8 Left 954778999 3:53045747-53045769 CCCCGGCGCCGCCGCCGCCCCTC 0: 1
1: 1
2: 22
3: 275
4: 1483
Right 954779006 3:53045762-53045784 CGCCCCTCCAGGCCGCCGCGCGG 0: 1
1: 0
2: 6
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954778999 Original CRISPR GAGGGGCGGCGGCGGCGCCG GGG (reversed) Intronic
900095969 1:940286-940308 GGGGGGGGGGGGCGGCGGCGCGG - Intronic
900105844 1:980666-980688 GAGGGCTGGCGCCGGGGCCGAGG + Exonic
900162909 1:1232801-1232823 TAGAGGCGGCGGCGGCGCGCGGG - Exonic
900171994 1:1273798-1273820 AGGCGGCGGCGGCGGCGCTGCGG - Exonic
900269148 1:1778350-1778372 GACGGCTGGCGGCGGCGCGGCGG - Intronic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900325884 1:2108440-2108462 GTGGGGCCGTGGCGGCTCCGAGG + Intronic
900342163 1:2194472-2194494 GAGGGCCTGGGGCGGCGCGGGGG + Intronic
900349749 1:2228694-2228716 GCGGGGCGGCGGCGGGGGCCGGG + Exonic
900513195 1:3069840-3069862 GAGGGGCGGAGGAGGGGGCGCGG + Intronic
900654170 1:3746985-3747007 GAGGGGCGGCGGATGCTCGGAGG + Intergenic
900667416 1:3824871-3824893 GAAGGGCGGCAGTGGCACCGTGG + Intronic
900974274 1:6007507-6007529 GAGGCGCGGAGGAGGCGCAGAGG - Intronic
901022175 1:6261032-6261054 CGGCGGCGGCGGCGGCGCCTAGG - Intergenic
901056026 1:6448972-6448994 CAGGGGCGGCGGCGGCGGTGGGG - Exonic
901060183 1:6468248-6468270 GGGGTGCGGCGGCGGAGACGGGG + Exonic
901109551 1:6784685-6784707 GGCGGGCGGCGCCGGGGCCGTGG + Intergenic
901242873 1:7704966-7704988 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
901243011 1:7705522-7705544 GCGGGGCTGGGGCGGCGTCGGGG + Intronic
901279933 1:8026162-8026184 GAGGAGCGGCGGCTGCCCCGCGG + Exonic
901433871 1:9234699-9234721 GCGGGGCGGGGGCGCCGGCGAGG - Intergenic
901443430 1:9293044-9293066 CAGCGGCGGCGGCGGCACCCCGG + Exonic
901443648 1:9293622-9293644 GAGAAGCCGCGGCGGCTCCGGGG - Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
901673039 1:10867101-10867123 GAGCGGCTGCGGGGGCGGCGGGG - Intergenic
901796293 1:11681265-11681287 GAGGGGCGGGGGCCGGGCCTCGG + Exonic
902214127 1:14924046-14924068 GCGGGGCGGGGGCGGGGCGGGGG + Intronic
902250633 1:15152762-15152784 AAGGGGCGGAGGCAGAGCCGCGG + Exonic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902726232 1:18337977-18337999 GAGGGCCGGGGGAGGCGGCGTGG + Intronic
902823236 1:18956230-18956252 CGGGGGCGGCGGCGGCGGCGGGG - Exonic
902823381 1:18956716-18956738 GCGGGGCCGCGGCGGGGGCGGGG - Intergenic
902951016 1:19882749-19882771 GAGCGAGGGAGGCGGCGCCGGGG + Intronic
902998080 1:20243113-20243135 GAGGGGAGGCGGCAGCGGAGAGG - Intergenic
903044289 1:20553887-20553909 CGCGGGCGGCGGGGGCGCCGGGG - Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903155567 1:21440276-21440298 GAGGCGCGGCGGCGCGGCTGCGG + Intronic
903724550 1:25431053-25431075 GAGAGACGGCGGCGGCGGCGCGG + Exonic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903828649 1:26161963-26161985 GGGCGGCGGCGGCGGCTCGGAGG + Exonic
903907539 1:26696958-26696980 GAGCGGCGGCGGCGGGGGCCTGG + Exonic
904215398 1:28914774-28914796 GCGAGGCGGCGGCGGCGGCGCGG + Intronic
904256933 1:29260086-29260108 GAGGGGCGGGGCCGGCGACGGGG + Intronic
904528809 1:31155026-31155048 GAGGGGCGGAGCCCGGGCCGGGG + Intergenic
904563336 1:31413157-31413179 GCGGGGCCGGGGCGGGGCCGGGG + Intronic
904620454 1:31772032-31772054 CCGTGGCGGCGGCGGCGGCGCGG + Intergenic
904642108 1:31938519-31938541 GAGGAGCGGGGGAGGCGCCCAGG - Intronic
905037829 1:34929348-34929370 CCGGGGCGTGGGCGGCGCCGGGG + Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905408486 1:37753207-37753229 CAGGGCCGCCGTCGGCGCCGCGG - Exonic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905449163 1:38046227-38046249 GGGGGGCGGCGGCGGCGGCCTGG - Exonic
905449325 1:38046762-38046784 GCGGAGCGGCGGCGGCGGCGCGG - Exonic
905648273 1:39639691-39639713 GCGGGGCCGGGGCGGGGCCGGGG - Exonic
905670804 1:39788922-39788944 GGGGGGCGGGGGCGGGGCCTGGG + Intergenic
905672260 1:39799557-39799579 GGGGGGTGGCAGCGGCGACGGGG - Intergenic
905674700 1:39817251-39817273 GGGGGGTGGCAGCGGCGACGGGG + Intergenic
905793450 1:40802434-40802456 GAGGGGCCGGGGCGGTGCTGCGG - Intronic
905847115 1:41242243-41242265 GAGGCGCGGGGGAGGGGCCGGGG - Intergenic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906078408 1:43068396-43068418 AGGGGGCGGCGGGGGCGGCGGGG + Intergenic
906204354 1:43979234-43979256 GGAGGGAGGCGGCGGCGCTGTGG + Intronic
906624485 1:47313980-47314002 GAGAGGCGGCAGCGGGGCCCTGG - Intronic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906640509 1:47438222-47438244 GGTGGGCGGCGGCAGCGGCGGGG + Exonic
906640564 1:47438398-47438420 GGGGGGCGGCGGCCGCAGCGGGG + Exonic
906640728 1:47439068-47439090 GAGGCGCGGCGGCGCGGCCTGGG - Exonic
906960960 1:50419264-50419286 GCAGGGCTGCGGCGGCGACGTGG - Exonic
907010725 1:50960242-50960264 CAGGGGCGGAGGCGGCGGCCAGG - Exonic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907440399 1:54475014-54475036 GGGAGGCGGCGGAGGAGCCGGGG - Intergenic
908128184 1:61050653-61050675 GCGGGGCCGCGGCGGCTCCAAGG - Intronic
908132170 1:61083756-61083778 TGGTGGCGGCGGCGGCGGCGGGG - Intronic
908355845 1:63324099-63324121 CAGCGGCCGCGGCGGCGCCCAGG - Exonic
908474000 1:64470782-64470804 GAGGGGCGGCCGCCGCGCCCGGG - Exonic
908581973 1:65525766-65525788 CAGAGATGGCGGCGGCGCCGGGG - Intronic
908714286 1:67053749-67053771 AGCGGGCGGCGGCGGCGGCGCGG - Intronic
908780544 1:67685960-67685982 GGGGGGCGGCGATGGCCCCGAGG + Intronic
909008227 1:70302300-70302322 CAGGGGCGGCGGGGGGGCGGGGG + Intronic
910676421 1:89821109-89821131 GAAGCGCGGCGGAGGAGCCGGGG - Exonic
910758983 1:90717495-90717517 GTGGCGCGGCGGTGGCGGCGCGG + Intergenic
910758984 1:90717498-90717520 GCGCGGCGGTGGCGGCGCGGAGG + Intergenic
911612239 1:99970036-99970058 GACGGGAGCCGGCGGCGCTGCGG + Intronic
911618371 1:100038657-100038679 GAGGCGAGGCTGCGGCGACGAGG - Intronic
912185508 1:107270698-107270720 GGGGGGCGGGGGCGGGGGCGGGG - Intronic
912411560 1:109483909-109483931 GCCGCGCGGCGGCGGCGCCAGGG + Intronic
912966666 1:114242535-114242557 ACGGGGCGGCGGCCGGGCCGAGG - Intergenic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913518263 1:119623290-119623312 GCGCGGGGGCGGCGGCGCTGCGG - Exonic
913959344 1:143327111-143327133 GACGGACAGCGGCGGCGCGGCGG + Intergenic
914053663 1:144152491-144152513 GACGGACAGCGGCGGCGCGGCGG + Intergenic
914053699 1:144152623-144152645 GGCGGACGGCGGCGGCGCGGCGG + Intergenic
914125475 1:144813830-144813852 GGCGGACGGCGGCGGCGCGGCGG - Intergenic
914125487 1:144813874-144813896 GGCGGACGGCGGCGGCGCGGCGG - Intergenic
914125499 1:144813918-144813940 GGCGGACGGCGGCGGCGCGGCGG - Intergenic
914125534 1:144814050-144814072 GACGGACAGCGGCGGCGCGGCGG - Intergenic
914386157 1:147172225-147172247 GAGGCGCAGGGGCGGGGCCGGGG - Intronic
914869078 1:151458682-151458704 AAGGGGCGGGGGCGGGGGCGCGG - Intronic
915325324 1:155078919-155078941 CGGCGGCGGCGGCGGCTCCGGGG + Exonic
915358833 1:155273370-155273392 TAGGGGCGGGGACGGAGCCGGGG - Intronic
915441924 1:155950866-155950888 GCGGGGAGGCTGCGCCGCCGAGG + Exonic
915552245 1:156642032-156642054 AGGGGGCGGGGGCGGCCCCGGGG + Exonic
915572210 1:156750947-156750969 AGGGGGTGGCGGCGGCGCCTGGG + Intronic
915908924 1:159900211-159900233 GAGGGGCGGGGCCGGGGGCGGGG - Intergenic
915934782 1:160084067-160084089 GAGGAGCCGCCGCGGCGCCGCGG + Exonic
916233347 1:162561659-162561681 GGGGGGCCGCGGCGGCGGGGCGG - Exonic
916390050 1:164321448-164321470 GCAGGGCGGCGGCGGCGCGCAGG - Intergenic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916694396 1:167221314-167221336 GCGGCGGGGCGGCGGGGCCGGGG + Intronic
916792528 1:168136767-168136789 GCGGGGAGGCGGCTGGGCCGGGG - Intronic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
916975639 1:170074590-170074612 GCGGGGCAGCAGCGGCGCTGTGG + Exonic
917130995 1:171742035-171742057 GAGGCGCTGCTGCGGCGCTGCGG - Exonic
917291616 1:173477260-173477282 GGGCGGCGGGGGCGGGGCCGCGG - Exonic
917418293 1:174834599-174834621 GGGGGGCGGCGGGGGGGGCGGGG - Intronic
917817503 1:178725501-178725523 GAATGGCGGCGGCGGCGCTGCGG + Intronic
918066450 1:181105148-181105170 GAGGGCTGGGGGCGGCTCCGCGG + Intergenic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
919861142 1:201740141-201740163 GGGGGGCTGCGGCGGGGCTGGGG - Intronic
920511787 1:206557240-206557262 GAGGGAGGGCGCTGGCGCCGGGG + Intronic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
920528505 1:206685321-206685343 CGGCGGCGGCGGCTGCGCCGGGG - Exonic
920528590 1:206685608-206685630 GAGGGGTGGCCGCGGCGGGGCGG + Intronic
920705783 1:208249473-208249495 GAGGGGCGGCTGAGGTGCCTTGG + Intergenic
921029788 1:211327038-211327060 GCGAGGCGGCGGCTGGGCCGGGG + Intronic
921217705 1:212951363-212951385 GAGCGGCGGCGGGAGCTCCGCGG - Exonic
922315063 1:224434633-224434655 GCGGGGCGGCTGCGGGGGCGCGG + Intronic
922335504 1:224615961-224615983 GAGGGGCGGCTGCGGCGTTTAGG + Intronic
922730728 1:227947738-227947760 GGGCGGGGGCGGCGGGGCCGGGG - Intronic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923126789 1:231040322-231040344 GAGGAGAGGGGGCGGGGCCGGGG - Intergenic
924052425 1:240092265-240092287 AGGGGGCGGCGGCGGCGGCGGGG + Exonic
924198958 1:241640197-241640219 CTGGGACGGCGGCGGGGCCGCGG - Exonic
924289725 1:242524715-242524737 CCGGGGCGGCGGCGGCGGCGGGG + Intergenic
924706586 1:246507323-246507345 GAGGGGCGGGGCGGGCGCGGTGG + Intergenic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1062795820 10:344382-344404 GTGGGGCGGGGGCGGGGCGGGGG + Intronic
1063008166 10:1994702-1994724 GAGGGGCAGGGGCTGGGCCGGGG + Intergenic
1063116628 10:3076378-3076400 GAGGGGCTGGGGCGGGGGCGCGG - Intronic
1063418289 10:5890444-5890466 GTGGGGCAGCGGGGGCCCCGGGG + Intronic
1063458967 10:6203491-6203513 GCCGGGCGGCGGGGGCGCTGTGG + Intronic
1064086283 10:12349028-12349050 GACGGGCGGCGGCGGCGGCTGGG - Intergenic
1064208846 10:13347430-13347452 GCGGGCCGGCGGCGGGGCGGAGG + Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064274193 10:13891765-13891787 CGGGGGCGGCGGCGGGGACGGGG - Intronic
1064443068 10:15370930-15370952 AGTGGGCGGCGGCGGGGCCGGGG - Intronic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1065023199 10:21517330-21517352 GGCGCGCGGCGGCGGCGCCCGGG + Exonic
1065024380 10:21526594-21526616 GAGGCGCGGCGGGGGCGTCGAGG - Intergenic
1065140529 10:22714650-22714672 GGGAGGCGGCTGCGGCGCCGCGG + Intergenic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065660282 10:27998925-27998947 AGGCGGCGGCGGCGGCGCCCGGG - Intronic
1066026102 10:31362034-31362056 ACGGGGCGGCGGCGGGGCAGAGG + Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066370407 10:34814833-34814855 GCGGGGAGGGGGCGGCGGCGGGG - Intronic
1066370501 10:34815123-34815145 GGCAGGCGGCGGCGACGCCGGGG + Exonic
1066429216 10:35336454-35336476 GCGGGGCGGGGGCTGCGGCGAGG + Intronic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464216 10:35639479-35639501 GCCGGGGGGCGGCGGCGGCGGGG - Exonic
1067334435 10:45348492-45348514 GTGGGGCGGCGGCTGGGCAGAGG - Intergenic
1067369777 10:45672593-45672615 GACGGCCGGCGGCGGCAGCGCGG + Intronic
1068204177 10:53827434-53827456 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1069043318 10:63717568-63717590 GCGGGGGGGGGGCGGCGCCGAGG - Intergenic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1069698353 10:70404348-70404370 GCGGGCAGGCGGCGGCGGCGGGG - Intergenic
1070167689 10:73911072-73911094 GAGAGGGAGGGGCGGCGCCGGGG + Exonic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1070954260 10:80454219-80454241 GAGGGGCGGGGCCGGAGGCGCGG - Exonic
1071573815 10:86711760-86711782 GGGGGCGGGCGGCGGCGGCGCGG + Intronic
1071695440 10:87864139-87864161 GGGGTGCGGCGGCGGCGCACGGG - Exonic
1072454105 10:95561261-95561283 GCTCGGCGGCGGCAGCGCCGGGG - Intronic
1072654398 10:97319972-97319994 GGCGGGAGGCGGCGGCGCCCCGG - Exonic
1073058285 10:100715770-100715792 GACAGGCGGCGGCGGCGGTGAGG + Intergenic
1073340919 10:102744007-102744029 GGAGGGAGGTGGCGGCGCCGTGG + Exonic
1073392734 10:103192972-103192994 GAGGCGTCGCGGCGGCGCGGAGG + Intronic
1073392746 10:103193006-103193028 GTGGGGCGGGGGCCGCACCGAGG + Intronic
1073428938 10:103473463-103473485 CAGGCGCGGGGGCTGCGCCGGGG - Exonic
1074088367 10:110225951-110225973 GAGGGGCGGGAGCAGCGCCGGGG - Intronic
1074121734 10:110498352-110498374 GGAGGGCGGCGGCGGCGTCGCGG + Exonic
1074182577 10:111077294-111077316 CCGGGACGGCGGCGGCGGCGGGG - Exonic
1074503355 10:114045005-114045027 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
1074546268 10:114404277-114404299 AGGGGGCGACAGCGGCGCCGCGG - Intronic
1074829912 10:117241093-117241115 GAGCGGCGGCGGCGGGGCGCTGG + Exonic
1074843284 10:117375437-117375459 GTGTGGCGGCGGCGGCAGCGGGG + Exonic
1074853251 10:117455491-117455513 GAGGGGAGGCTGAGGCCCCGAGG - Intergenic
1075031830 10:119029401-119029423 GAGCGGCGCCCGAGGCGCCGGGG + Intergenic
1075119058 10:119651311-119651333 GAGGAGCGGGGGCGGGGCCTCGG - Intergenic
1075206990 10:120456925-120456947 GGGAGGCGGCGGCGGCGGTGGGG + Intergenic
1075334490 10:121598458-121598480 CGGGGGCGGCGGCGGCGGCGCGG - Intronic
1075501723 10:122980705-122980727 GAGGGGCGGGGCCTGGGCCGCGG + Intronic
1075587156 10:123666311-123666333 GCCGGGCGGCGGCGGCGCCGAGG + Intergenic
1075697482 10:124447614-124447636 GGGCGGCGGCGGCGGCGGCTCGG - Exonic
1075999826 10:126905685-126905707 GCGGGGCGGCGGCGCGGGCGCGG - Intronic
1076035643 10:127196607-127196629 GAGGTGGGGCGGGGGCGGCGCGG + Intronic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076371736 10:129959772-129959794 GCGGGGCGCTGGCGACGCCGCGG - Intronic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076374190 10:129972702-129972724 GCGGGGCTGCGGCGGAGGCGCGG - Intergenic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076750061 10:132537986-132538008 GCGGGGCGTCAGCTGCGCCGGGG - Exonic
1076765491 10:132630791-132630813 GGGAGGCGGCGGGGGCGGCGGGG + Intronic
1076792883 10:132786114-132786136 CGGCGGCGGCGGCGGCTCCGGGG + Intergenic
1076854464 10:133109073-133109095 GAGGGGCAGGGGTGGGGCCGGGG - Intronic
1076864434 10:133160113-133160135 GAGGGGCGGAGCCGGCGCCCAGG - Intergenic
1076884494 10:133255547-133255569 GAGGGTGGGCGGCGGGACCGCGG - Intergenic
1076905020 10:133357299-133357321 GACGGGCGGCGCCGACCCCGAGG - Intronic
1076985978 11:236368-236390 GAGGCGGGGCCGGGGCGCCGGGG - Exonic
1076985981 11:236376-236398 GGGAGGCGGAGGCGGGGCCGGGG - Exonic
1076985998 11:236407-236429 GAGGCGGGGCTGGGGCGCCGGGG - Exonic
1077008519 11:369982-370004 GGGGGGCGGGGGCGGCGCGGGGG + Intronic
1077008532 11:370009-370031 GGGGGGCGCGGGCGGCGCGGGGG + Intronic
1077018470 11:407174-407196 GGCGGGCGTCGGCGGCGCAGGGG + Intronic
1077056749 11:597645-597667 GAGGGGCGTCGTCGGCACTGTGG + Intronic
1077194370 11:1272056-1272078 GCGGGGCGCCGGAGGGGCCGCGG + Intergenic
1077208895 11:1359083-1359105 CAGAGGCGGCGGCGGGGCTGGGG - Intergenic
1077254644 11:1574708-1574730 GAGGGGCCGGGGAGGCGCCAAGG + Intergenic
1077360645 11:2138967-2138989 GACAGGCGGTGGCGGCACCGGGG + Intronic
1077386200 11:2270638-2270660 GAAAGGCGACGGCGGCGGCGCGG - Exonic
1077425601 11:2474557-2474579 GAGGGGCAGCGGTGGAGCCCAGG + Intronic
1077495307 11:2884336-2884358 TAAGCGCGGCGGCGGCCCCGGGG - Intronic
1077685050 11:4283362-4283384 GAGGGGCGGCTGCTGGGCGGAGG - Intergenic
1077690138 11:4334568-4334590 GAGGGGCGGCTGCTGGGCGGAGG + Intergenic
1077898807 11:6473950-6473972 GAGGGGCCGGGGCGGGGCTGCGG + Intronic
1078057551 11:8019694-8019716 GAGGGGCGGGGCAGGGGCCGGGG + Intronic
1078093721 11:8283735-8283757 GAGGGGCGGAGGCGGCCCTCCGG + Intergenic
1078190834 11:9091567-9091589 GGGCGGTGGCGGCGGCGGCGCGG + Exonic
1078210289 11:9265045-9265067 GAGTGGCGGCGGCGGCGGAGGGG - Exonic
1078256611 11:9664112-9664134 GAGGGGCGTCCGAGGCGCGGAGG + Exonic
1078514272 11:12009143-12009165 GAGGGGCGGCGGCGGGGGAGGGG - Intronic
1079459766 11:20669497-20669519 CTGGCGCGGCGGCGGCGGCGTGG - Intergenic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080034872 11:27700414-27700436 GCGCGGCGGCGGCAGCGTCGGGG + Intronic
1080503831 11:32893340-32893362 GAGGGTGGGCGGCGGGGTCGCGG + Intronic
1080836293 11:35944029-35944051 GAGGGGCGGGGTCAGCGCCGAGG + Intronic
1081207562 11:40293197-40293219 GGGGGGCGGGGGCGGGGGCGGGG + Exonic
1081528396 11:43942463-43942485 GCGGGGGGCGGGCGGCGCCGGGG + Exonic
1081636954 11:44727514-44727536 GAGGGCCGGGGGCTGCGCCCAGG + Intronic
1081807870 11:45900086-45900108 GCGGGGCCGGGGCGGGGCCGAGG - Intronic
1081870728 11:46381555-46381577 GAGCGGGGGCGGGGACGCCGGGG + Intronic
1081873010 11:46391707-46391729 GAGGGCCGGGGGCGGGGACGGGG + Intergenic
1081873205 11:46392343-46392365 GAGGGGCGCCGTCGGGGCCTGGG + Intergenic
1082076934 11:47981453-47981475 GAGGGGCGGCGGGGGCGACAGGG + Intronic
1082787507 11:57324889-57324911 TAGCAGCGGCGGCGGCGGCGGGG - Intronic
1083296562 11:61718476-61718498 GAGGGGGGGCTGGGGCACCGTGG - Intronic
1083560725 11:63671193-63671215 GAAGGGCGGCGGCGCGGGCGGGG + Intronic
1083571368 11:63763736-63763758 GCGGGGCGGGGGCGGAGGCGGGG + Exonic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083644745 11:64165782-64165804 GGGGGGCGGCGGCGGTGGGGCGG - Exonic
1083656951 11:64234485-64234507 GTGGGGCGGGGGCGGGGCGGCGG - Intergenic
1083659810 11:64246791-64246813 GGGCGGCGGCGGGGGCGCCCGGG + Exonic
1083669330 11:64291576-64291598 TTGGGGCGGCGCCGGCGGCGAGG + Intronic
1083672035 11:64305298-64305320 GAGGGGCGGGGCCGGAGACGCGG - Intergenic
1083883222 11:65558386-65558408 GCGGCGCGGCGGCGGCGAGGGGG + Intronic
1083936598 11:65872836-65872858 AAGGGCGGGCGGAGGCGCCGGGG - Exonic
1083995105 11:66267749-66267771 GAGGGGCGGCGACGGTCCCCTGG + Exonic
1084001029 11:66295516-66295538 GGGGGGCCGCTGGGGCGCCGTGG + Exonic
1084021336 11:66420059-66420081 CGGGGGCGGGGGCGGGGCCGGGG - Intergenic
1084146146 11:67266409-67266431 CGGAGGCGGCGGCGGCTCCGGGG + Exonic
1084285579 11:68128540-68128562 GAGGGGCGGGGTTGGCGGCGAGG + Intergenic
1084489574 11:69471138-69471160 GACGGGCGGCGAGGGGGCCGGGG - Intergenic
1084561191 11:69906307-69906329 GAGGGGAGGGGGCAGCGTCGAGG + Intergenic
1084786934 11:71448114-71448136 GAGGGGCCGCTGGGGCTCCGGGG - Intronic
1084968111 11:72754926-72754948 GATGGGCGGCGCGGGCGGCGAGG - Exonic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1085284626 11:75351726-75351748 CGGGGGCGGCGGCGGCGGCCGGG - Intergenic
1085666234 11:78417699-78417721 CATGAGCGGCGGCGGCGACGTGG - Exonic
1086322419 11:85664656-85664678 GAGGGGGAGCCGCGGCGGCGTGG - Exonic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087127302 11:94640688-94640710 GAGGGGCAGGGGCGGGGCGGGGG - Intergenic
1087761744 11:102110375-102110397 GAGGCGGGGCCGCGGCGGCGCGG + Intergenic
1087761811 11:102110659-102110681 GGGCGGGGGCGGAGGCGCCGGGG + Exonic
1089078879 11:115760159-115760181 GCAGGGCGGCGGCGGCGGCCGGG + Intergenic
1089346985 11:117796993-117797015 GCTGGGCGGCGGAGGCGGCGGGG - Intronic
1089543716 11:119206450-119206472 CGGGGGCGGCAGCGGCTCCGGGG + Exonic
1089694856 11:120210844-120210866 GAGAGGGGGCAGCGGCTCCGCGG - Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090238208 11:125164816-125164838 AGGCGGCGGCGGCGGCGCGGCGG + Intronic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090293888 11:125569551-125569573 GAGCCGCGGCGGCGGAGCTGTGG + Exonic
1090366664 11:126212038-126212060 GAGGGACGGCGTCGGTGCCTAGG - Intronic
1091383573 12:78106-78128 GCGGGGAGGCGGGGGCGCCCGGG - Intronic
1091434022 12:459909-459931 CGGGGGCGGGGGCGGGGCCGGGG + Intergenic
1091474085 12:754117-754139 CAGCGGCGGCGGCAGCGCCAAGG + Exonic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091779536 12:3205115-3205137 GAGGGGTGGGGGCGGGGCTGGGG + Intronic
1091792887 12:3281572-3281594 GTGGGGCGGAGGCTGCGCCAAGG + Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1091823259 12:3491755-3491777 GCTGAGCGGCGGCGGCGGCGCGG - Intronic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092743167 12:11649555-11649577 GAGGGGCGGCCGCGGGGGCGCGG - Intergenic
1093685073 12:22046167-22046189 GAGGGGCGGGGGAGGGGGCGGGG + Exonic
1093894693 12:24562751-24562773 GGGGCGCGGGGGCGGTGCCGGGG + Intergenic
1093958617 12:25250351-25250373 GAGGGGAGGCCGGGGCGCCGCGG + Intronic
1094375402 12:29783748-29783770 CAGCGGCGGCGGCGGCGCGATGG - Exonic
1094682683 12:32679683-32679705 CAGGGGCGGAGCCGGCGCGGCGG + Intronic
1095206224 12:39443126-39443148 GAAAGGTGGCGGCGGCGCTGAGG + Intronic
1095261661 12:40105622-40105644 CGCGGGCGGCGGCGGCGTCGGGG - Exonic
1095440796 12:42237790-42237812 GCGGGGCGGGGGCGGCCGCGGGG - Intronic
1095752372 12:45727543-45727565 GTGAGGCGGCGGCGGCGCGGCGG + Intergenic
1096139951 12:49234620-49234642 GCGGGGCGGCGGCTGCGGCCTGG - Intronic
1096241301 12:49961686-49961708 GGGGGGCGGGGGTCGCGCCGGGG + Intergenic
1096503527 12:52079694-52079716 GCGGGCCGGCGGCTGCGTCGGGG - Intergenic
1096647801 12:53047861-53047883 GAGGGAGGGCGGCGGCTCTGGGG - Intronic
1096786852 12:54021766-54021788 CAGGAGCGGCTGCGGCGCCGTGG - Intronic
1096977518 12:55707943-55707965 GAGGGGCGGGGCCGGAGGCGGGG - Intronic
1096977596 12:55708146-55708168 GAGTGGTGGAGGCGGCGCCTTGG + Intronic
1097033256 12:56104685-56104707 CAGAGGCGGCGGCGGCTCAGGGG + Exonic
1097154960 12:57006083-57006105 GAGGGGAGACCGCGGCGCCCGGG - Intronic
1097155014 12:57006250-57006272 GAGGGGCGGCGGGGCCGGCCGGG + Intronic
1097190395 12:57216790-57216812 GAGGCGCGGAGCCGGCGCTGGGG - Exonic
1097190406 12:57216829-57216851 GAGCGGCGGGAGCGGCGGCGCGG - Exonic
1097196823 12:57247009-57247031 GGGTGGCGGTGGGGGCGCCGCGG + Intronic
1097232383 12:57520651-57520673 GAGCGACGGGGGCGGTGCCGCGG - Intergenic
1097267803 12:57755773-57755795 CGGGGGCGGCAGCGGCGGCGCGG - Exonic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1098254792 12:68606082-68606104 GAGGGGAGACGGCGGCGGGGGGG + Intergenic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG + Intronic
1100963102 12:99984843-99984865 CGAGGGCGGCGGCGGCGGCGAGG + Intergenic
1101606009 12:106248048-106248070 GGGAGGCGGGGTCGGCGCCGCGG - Intronic
1101910560 12:108857634-108857656 CGGGGGCGGTGGCGACGCCGAGG - Intergenic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102197195 12:111034071-111034093 GGCGGCCGGCGGCGGCCCCGGGG + Exonic
1102682161 12:114698264-114698286 GTGGGGCGGAGGCTGTGCCGCGG - Intergenic
1102853952 12:116277494-116277516 AGGCGGCGGCGGCGGCTCCGGGG - Intergenic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1102854031 12:116277745-116277767 GACGGGCGCCGGCCGCGCGGGGG + Intergenic
1103377716 12:120469643-120469665 CTGAGGCGGCGGCGGCGACGTGG - Exonic
1103424729 12:120823224-120823246 GGGGGGCGGCGGCGGTGGCGGGG + Intronic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103447504 12:121003899-121003921 GAGGGCTGGCGGGGGCGCTGTGG - Exonic
1103509876 12:121467057-121467079 TCGCGGCGGCGGCGGCGTCGCGG + Intronic
1103547521 12:121712714-121712736 GTGGGGCGGGGCGGGCGCCGGGG + Intergenic
1103563408 12:121804118-121804140 AAGGGGGGGCGCCGCCGCCGCGG - Intergenic
1103623893 12:122204561-122204583 GCCGGGCGGCGGCGGCGGCGGGG - Exonic
1103649709 12:122422841-122422863 GCGGAGCGGCGGGCGCGCCGGGG - Intergenic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104069395 12:125331149-125331171 GCGGGGCGGGGACAGCGCCGGGG + Intronic
1104355887 12:128086935-128086957 AAGGGGCAGCGGCGGGGCGGGGG + Intergenic
1104376189 12:128267104-128267126 CGGGGGCGGGGGCGGGGCCGGGG + Intergenic
1104428271 12:128695858-128695880 GAGGAGGAGCGGCGGGGCCGGGG + Exonic
1104800837 12:131554443-131554465 GAGGGGCAGTGGCAGCACCGGGG + Intergenic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104929251 12:132329475-132329497 GAGGGGGGCCGGGGGCGCCGGGG + Intergenic
1104957944 12:132475137-132475159 GAGGGGGGGCGGGGTCACCGCGG - Intergenic
1104961613 12:132490732-132490754 GGGGCGCGGGGGCGGCGCCTCGG - Exonic
1104961623 12:132490766-132490788 TCGCGGCGGCGGCGGCGCGGGGG - Exonic
1104961626 12:132490769-132490791 GACTCGCGGCGGCGGCGGCGCGG - Exonic
1104983451 12:132583779-132583801 GAGAGGCGTCTGCGGCCCCGGGG - Exonic
1105022817 12:132828695-132828717 GAGGGGCGGCGGCGGGGCCTGGG - Exonic
1105472071 13:20703737-20703759 TCGGGGCGGCGGCGGCGGCGGGG + Intronic
1105678079 13:22696628-22696650 GAGCGGCGGCGGGGGCCCTGGGG + Intergenic
1105900332 13:24747060-24747082 GGGGGGCGGGAGCGGCGCCGCGG - Intergenic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1106087638 13:26557745-26557767 GCCGGGCGGCCGCGGCGCGGCGG + Exonic
1106241999 13:27920263-27920285 CGGGTGCGGCGGCGGCGGCGGGG - Exonic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1106517122 13:30465274-30465296 GCGGGGCGGGCGGGGCGCCGCGG - Intronic
1106568515 13:30906697-30906719 GGGAGCCGGCGGCGGCGCGGGGG + Exonic
1107851413 13:44576560-44576582 TGGCGGCGGCGGCGGCCCCGGGG - Exonic
1108220955 13:48233115-48233137 GCGGGGCGGGGGCGGGGGCGGGG - Intergenic
1108221014 13:48233317-48233339 GAAGGGCGGCGGCGGGCTCGGGG - Exonic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1108518259 13:51222513-51222535 GGCGGGCGGCGGCGGCGAGGAGG + Exonic
1108635889 13:52334024-52334046 GAGGGCCTGCGGGGGCTCCGAGG + Intergenic
1108651921 13:52489224-52489246 GAGGGCCTGCGGGGGCTCCGAGG - Intergenic
1108688925 13:52845819-52845841 GAGGGGCAGCAGCGGCTCCGCGG - Exonic
1109062312 13:57633734-57633756 GACGGGCGGCGGCGGGGGCCTGG + Exonic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1110705919 13:78602140-78602162 GGGGGGCGGCGGCGGCGGCCCGG - Exonic
1112504968 13:99970086-99970108 TGGTGGCGGCGGCGGCGGCGCGG + Intronic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112507851 13:99985565-99985587 CAGTGGCGGGGGCGGCGGCGGGG + Exonic
1113201067 13:107867600-107867622 GGCGGGCGGCGGCGGGGCCGCGG + Intergenic
1113541771 13:111115145-111115167 GCGGGGCGGCGGCGGCGGCTGGG - Intronic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1113655928 13:112067763-112067785 CGGGGGCGGCGGCGGCGGCGGGG + Exonic
1113660464 13:112103840-112103862 GGGGGGCGGGGGCGGGGGCGCGG + Intergenic
1113779755 13:112969276-112969298 GAGGGGGCGCGGCGGAGGCGGGG - Exonic
1113925654 13:113940117-113940139 CAGGGGCGGGGGCTGCGCCTCGG + Intergenic
1114558591 14:23576305-23576327 CAGGGGCGGGGGTGGCGTCGGGG + Exonic
1115197029 14:30812343-30812365 AAGGGGGCGCGGGGGCGCCGGGG + Intergenic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115474566 14:33800605-33800627 CGGGGGCGGGGGCGGCGGCGCGG + Exonic
1115474569 14:33800608-33800630 GGGCGGGGGCGGCGGCGCGGGGG + Exonic
1115651240 14:35404198-35404220 GAGGGGCGGCGGCTGGGCCCTGG - Intronic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1115851793 14:37595162-37595184 GGCGGGCGGGGGCAGCGCCGGGG + Intronic
1116658259 14:47676183-47676205 GAGGGGCAGAGGAGGCGCGGAGG - Intergenic
1116817863 14:49599795-49599817 CCGCGGCGGCGGCAGCGCCGCGG + Intronic
1116861791 14:50001332-50001354 GCGGGGCGGGGGCGGGGGCGGGG + Intronic
1116895669 14:50312614-50312636 GCGGGGCGGGGGCGGGGCCGAGG - Intronic
1117176685 14:53153026-53153048 AGGCGGCGGCGGCGGCGCCTGGG - Exonic
1117424424 14:55580264-55580286 CGGCGGCGGCGGCGGCGCCTCGG + Intronic
1117602581 14:57390672-57390694 GAGTGGCGGCAGCGGCGGCGGGG + Exonic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118137431 14:63045301-63045323 GGGGCGCGGCGGCGGCGACGGGG + Exonic
1118339102 14:64879833-64879855 TGGCGGCGGCGGCGGCGCAGGGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1118809216 14:69261212-69261234 CGGGGGCGGCGGCGGGGCTGCGG + Intronic
1118849327 14:69572403-69572425 GAGGAGCGGCGAGGCCGCCGTGG - Exonic
1119322229 14:73738960-73738982 GAGAGGCGGCGGGAGCGGCGGGG + Exonic
1119357502 14:74019285-74019307 GTGGGGCGGAGGTCGCGCCGAGG - Exonic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119438526 14:74612806-74612828 GAGCGAAGGCGGCGGCGCCAGGG - Intergenic
1119500896 14:75126786-75126808 GCGAGCCGGCGGCGGCGCGGCGG - Exonic
1119519700 14:75277102-75277124 GAGCGGCCGCGGCCGGGCCGGGG + Intergenic
1119539300 14:75428216-75428238 GGGGGGAGGCGGCGCCCCCGGGG - Intronic
1119601967 14:75982471-75982493 GAGGGTCGGCGTCCGCTCCGCGG + Intronic
1119743260 14:77027565-77027587 GACGGGCGGCGGCGGCCCGGGGG + Exonic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1119759659 14:77141547-77141569 GCAGTGCGGCGGCGGCGGCGCGG - Intronic
1120190557 14:81436227-81436249 GGGGGGCGGGGGCGGGGGCGGGG - Intronic
1120809863 14:88792547-88792569 GACGGGAGGCGGCGGCGGCCCGG + Exonic
1120993574 14:90398189-90398211 GGGAGGAGGCGGCGGCGCCGCGG + Intronic
1121311849 14:92939583-92939605 GTGGGGCGGGGGCGGGGCTGTGG - Exonic
1121343122 14:93116433-93116455 GCGGGTCAGCGTCGGCGCCGGGG + Intergenic
1122081691 14:99271293-99271315 CAGCGGCGGCAGCGGCGCGGCGG - Intronic
1122130725 14:99603446-99603468 AAGCGGTGGCGGCGGCGGCGGGG - Exonic
1122156444 14:99753191-99753213 GGGGGGCGGCGGGGGGGCGGGGG - Intronic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122221233 14:100240054-100240076 GTGCGGCGGCGGGGGCGCGGCGG + Intronic
1122418953 14:101563607-101563629 GAGGGTCTGCGGCGGTGCCCGGG + Intergenic
1122581986 14:102777133-102777155 GACGCGCGGCGGCGGGGGCGCGG + Intergenic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122582084 14:102777397-102777419 GCGGGGCGGCGGGCGCGCCGGGG + Intergenic
1122620714 14:103056560-103056582 GAGGTGCGGGGGCGGGGGCGGGG + Intronic
1122620935 14:103057403-103057425 CTGGGAGGGCGGCGGCGCCGAGG - Exonic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1122779617 14:104138248-104138270 GAGGGGCGTCGGCGCCTCCTGGG + Intergenic
1122840774 14:104461619-104461641 GCGGGGCGGGGGCGGGGCGGGGG + Intergenic
1122947721 14:105020824-105020846 GGAGGGCGGCGAGGGCGCCGCGG + Intronic
1122947730 14:105020863-105020885 CCGGGGCGGAGGCGGCGCCCGGG - Intronic
1122961106 14:105093920-105093942 GAGAGGCGAGGGCGGAGCCGCGG + Intergenic
1122975252 14:105168328-105168350 GCGGGGCGGCGGGGGCGGCGGGG - Intronic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1122975403 14:105168822-105168844 GAGGGGGCGGGGCCGCGCCGCGG + Exonic
1123001926 14:105300473-105300495 GAGCAGCGGCGGCGGCTCCTCGG - Exonic
1123004532 14:105314900-105314922 GAGCGGCGGGGCCGGCGCCATGG + Exonic
1123036669 14:105474563-105474585 CCGGGGCGCGGGCGGCGCCGCGG + Intronic
1123684276 15:22786514-22786536 GAGGGGCGGGGGCGGGACGGGGG - Intronic
1123898053 15:24848213-24848235 GGGGGGCGGGGGCGGCGGTGGGG + Intronic
1123898063 15:24848231-24848253 TGGGGGCGGGGGCGGCGGCGGGG + Intronic
1123898067 15:24848237-24848259 CGGGGGCGGCGGCGGGGGCGGGG + Intronic
1124427040 15:29570927-29570949 GCGGCGCGGCGGCGGCGGCATGG - Intergenic
1124453867 15:29822545-29822567 GCGGGGAGGGGGCGGGGCCGCGG + Intronic
1124500345 15:30223032-30223054 GGGGGGGCGCGGCGGCGGCGGGG - Intergenic
1124696901 15:31870849-31870871 GAGGGGCGGGGGCGGGGCACAGG - Intergenic
1124713045 15:32030761-32030783 GAGGGGCAGCGGGGGCGCTGCGG + Intronic
1124743228 15:32315634-32315656 GGGGGGGCGCGGCGGCGGCGGGG + Intergenic
1124957179 15:34367176-34367198 CAGCGGCGGCGGCGGCGCTCTGG + Exonic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1125516367 15:40323542-40323564 GAGGGGAGGCGGCGGCTGCCGGG - Intergenic
1125516486 15:40323924-40323946 GAGGAGCGGCGGCGGAGCGCGGG + Intergenic
1125603903 15:40929460-40929482 GCTGGGCGGCGACCGCGCCGAGG - Exonic
1125677858 15:41512073-41512095 ATGGGGCGGCGCCGGCGCCGGGG - Intronic
1125684982 15:41558851-41558873 GCGGGGCGCCGGCGGGGCCGCGG + Intronic
1125834456 15:42737161-42737183 GAGGGGCGGGGCCGGCGGCGGGG + Intergenic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126668474 15:51094868-51094890 GAGGGGAGGCGCGAGCGCCGAGG + Intronic
1126738050 15:51751614-51751636 CAGGGGCGGCGCCGTGGCCGGGG - Exonic
1126800834 15:52295457-52295479 TGGGGGCCGCGGAGGCGCCGCGG - Intronic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127144112 15:56007290-56007312 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144120 15:56007308-56007330 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144128 15:56007326-56007348 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144136 15:56007344-56007366 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144144 15:56007362-56007384 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1127515521 15:59689393-59689415 GCGTGGCGGCGGCGGAGGCGTGG + Exonic
1127606512 15:60592481-60592503 CTCGGGCGGCGGCGGCGCGGCGG - Intronic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128454949 15:67827103-67827125 TGGGAGCGGCGGCGGCGGCGCGG + Intronic
1128547740 15:68579199-68579221 CGGGGGCGGCGGCGGCGGCCCGG - Exonic
1128799895 15:70490617-70490639 GAGGGGCAGCGGCGGGTCCCTGG - Intergenic
1128841432 15:70854094-70854116 GCGGGACTGCGGCGCCGCCGGGG + Exonic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1128992567 15:72272805-72272827 GGGGGGTGGCGCCTGCGCCGTGG + Intronic
1129026001 15:72574895-72574917 GATGGGCGGGGGCGGCGGGGGGG - Intronic
1129082467 15:73052632-73052654 CAGCGGCGGCGACAGCGCCGCGG - Exonic
1129273885 15:74433259-74433281 GAAGCGCGGCGGCGGCGGCAAGG + Intronic
1129287971 15:74541157-74541179 CAGGGGCGGGGGCGGGGGCGGGG - Exonic
1129298927 15:74614722-74614744 GAGGGGCATGGGCGGGGCCGCGG + Intronic
1129503240 15:76059897-76059919 GAGGGGCGGAGGGAGCGGCGGGG + Exonic
1129676557 15:77634904-77634926 GGGGGGCGGGGGCGGGGGCGAGG + Intronic
1129710914 15:77819862-77819884 GAAGGGCGGCGGCGCCGCGGAGG - Intronic
1129742122 15:77994367-77994389 GAGCGGCGGCGGCAGAGCTGGGG - Intronic
1129752793 15:78077604-78077626 GGAGGGCGGCGGCGGCGGCGAGG - Exonic
1129817246 15:78565712-78565734 GCGGGGCGATGGCGGCGCGGGGG + Exonic
1129823645 15:78620591-78620613 GAGGGCTGGCGCCGTCGCCGGGG - Intronic
1129893783 15:79089485-79089507 CGGCGGCGGCGGCGGCGCAGGGG + Intronic
1130040856 15:80404405-80404427 GTGTGGCGGCGGCGGCGCCTGGG + Exonic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130656435 15:85794779-85794801 CTGAGGCGGCGGCGGCGGCGGGG - Exonic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131257377 15:90871544-90871566 GAGGGGCGCCCGAGCCGCCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131475398 15:92734255-92734277 GGAGAGCGGCGGCGGCGGCGCGG - Intronic
1131693881 15:94855573-94855595 CTGAGGCGGCGGCGGCGGCGAGG + Intergenic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131827372 15:96332033-96332055 GCGGGGCGGCGGCGGCTCCCCGG - Exonic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132111598 15:99105717-99105739 CAGGCGTGGCGGCGGCGCGGCGG - Exonic
1132378412 15:101348176-101348198 GAGGAGCAGCGGAGGCGCAGGGG - Intronic
1132512841 16:352719-352741 GAAGTGCGGGGGCGGGGCCGGGG + Intergenic
1132522460 16:397817-397839 GCCGGGCAGCGGCGGGGCCGGGG - Intronic
1132560214 16:590098-590120 GCGGGGCGGCGGCGAGGCTGAGG + Intronic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132591513 16:728252-728274 GAGGGGCGGGGAGGGCGCCCCGG + Intronic
1132604651 16:788627-788649 GCGCGACGGCGGCGGCGGCGCGG + Exonic
1132741354 16:1414803-1414825 GCGGGGCTGGGGCGGGGCCGGGG - Intergenic
1132743662 16:1428030-1428052 CAGGGGCGGGGGAAGCGCCGAGG + Intergenic
1132754125 16:1474539-1474561 GAGGGGCGCCGGGGCAGCCGTGG - Intronic
1132779411 16:1614449-1614471 CAGGGCCGGGGGCGGCGGCGTGG + Intronic
1132831367 16:1929944-1929966 TAGGGTCGGCGAAGGCGCCGAGG - Intergenic
1132839488 16:1972146-1972168 GAGCGGCGGCGGCGGCAACATGG + Exonic
1132889380 16:2196485-2196507 CAGAGGCGGCGGCGGCCCCGCGG + Exonic
1132947133 16:2537953-2537975 GCGGGGGCGGGGCGGCGCCGGGG + Exonic
1132947137 16:2537959-2537981 GCGGGGCGGCGCCGGGGGCGGGG + Exonic
1133020563 16:2965036-2965058 GAGGGGCGGGGCCTGCGCTGGGG + Intronic
1133156483 16:3880217-3880239 GGGGGGCGGCCGGGCCGCCGGGG - Exonic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133634671 16:7653911-7653933 GATCGGGGGCGGGGGCGCCGCGG - Exonic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133784386 16:8963448-8963470 GGCGGGCGGCGGCGGCGGCAGGG + Exonic
1134134168 16:11668624-11668646 GAGGGGCGCGCGCGGCGGCGGGG + Intronic
1134143578 16:11742646-11742668 AGGGGGCGGCGGCGGCCCCGCGG - Exonic
1134149873 16:11797189-11797211 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1134172080 16:11976756-11976778 AAGCGGCAGCGGCGGCGGCGCGG + Exonic
1134419324 16:14071340-14071362 GAGCGGCGGCGGCGGCGGCCGGG + Intronic
1134527789 16:14957760-14957782 GGGAGGCGGCGGCGGCGCAGGGG - Intergenic
1135135816 16:19884909-19884931 CGGGGGCGGGGGCGGGGCCGCGG - Exonic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135691319 16:24539913-24539935 CCGAGGCGGCGGCGGCGGCGGGG + Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1135976119 16:27109855-27109877 CAGAGGCGGCGGCGGGACCGGGG + Intergenic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136233983 16:28903492-28903514 GCGGGGCGGGGGCGGCGTCATGG - Intronic
1136237764 16:28925108-28925130 GATGAGCGGCGGCGGCGGCCGGG - Exonic
1136399511 16:30010072-30010094 AGGGGGCGGCGGGGGCGGCGGGG - Exonic
1136451899 16:30358322-30358344 GACGGGGGGCGGCGGGGACGGGG + Exonic
1136485934 16:30571664-30571686 GCGGGGAGGCGGCGGCTCCAGGG - Exonic
1136498834 16:30659685-30659707 GGGCGGCGGCGGCGACGACGAGG - Exonic
1136534978 16:30893973-30893995 GACGGGAGGCGGCCCCGCCGCGG - Exonic
1136778980 16:32885565-32885587 GCGGGGCACCGGCGGCACCGGGG + Intergenic
1136891638 16:33975953-33975975 GCGGGGCACCGGCGGCACCGGGG - Intergenic
1137244694 16:46692871-46692893 GCGGGGCGGCGGTGGCGGTGGGG + Intronic
1137675540 16:50302082-50302104 GAGGGGCGGGGCCAGGGCCGGGG - Intronic
1137683308 16:50369090-50369112 GCGGGCCGGGGGCGGGGCCGAGG + Intergenic
1137738469 16:50742263-50742285 GAGGCCAGGCGGCTGCGCCGAGG - Intronic
1137788390 16:51154780-51154802 GTGAGGCGGCAGCTGCGCCGGGG + Intergenic
1137926719 16:52547324-52547346 GAGAGGGGGCGGCCGCGGCGGGG - Intronic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138327889 16:56191103-56191125 GTGGGGCGGGGGCGGAGGCGGGG + Intergenic
1138328054 16:56191655-56191677 GGGGGTCGGCGAAGGCGCCGCGG + Intronic
1138328067 16:56191748-56191770 AGGAGGCGGCGGCGGCGGCGCGG - Intronic
1138426051 16:56932548-56932570 GAGGGGCGCCCGCGTCGGCGGGG - Intronic
1138619100 16:58197772-58197794 GGGTGGCGGCGGCGGCGCGGCGG + Exonic
1139402939 16:66696649-66696671 GAGAGGCGGCGGCGGCGGGCGGG - Exonic
1139403006 16:66696853-66696875 AGGTGGAGGCGGCGGCGCCGCGG + Intergenic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139511605 16:67431202-67431224 GCGGGGCGGGGGCCGGGCCGGGG - Exonic
1139597803 16:67968401-67968423 GAGGGGCCGTGGCGGGGCAGCGG - Intronic
1140091934 16:71846010-71846032 GTGGGGCGGCTCCGGGGCCGGGG + Exonic
1140223109 16:73058189-73058211 GGCGGCCGGCGGCGGCGGCGCGG + Intronic
1140478551 16:75250879-75250901 GAGTGGGGGCGGGCGCGCCGCGG - Intronic
1141079183 16:81035881-81035903 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1141086078 16:81096380-81096402 GAGGCGCGGAGGCGGTGCCGCGG + Exonic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141656528 16:85419754-85419776 GAGGGGTGGGGGCGGGGCGGGGG - Intergenic
1141665292 16:85462677-85462699 GGAGGGCGGCGGGGGCGCCGCGG + Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141797799 16:86286635-86286657 GAGGGGCCGCAGGGGCGCTGCGG + Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141831312 16:86511241-86511263 CATGGGCGGCTGCGGCGGCGCGG + Exonic
1141831313 16:86511244-86511266 GGGCGGCTGCGGCGGCGCGGCGG + Exonic
1142014945 16:87740416-87740438 GAGGGGAGGCGGCTGCTCCTGGG - Intronic
1142136345 16:88453554-88453576 GCGGGGGCGCGGCGGGGCCGCGG - Exonic
1142136348 16:88453562-88453584 GGCGGGCGGCGGGGGCGCGGCGG - Exonic
1142240187 16:88941398-88941420 GTGGCGCAGCGGCGGCGGCGGGG - Intronic
1142285862 16:89171345-89171367 GTGGGGCCGGGGCGGGGCCGAGG - Intergenic
1142285917 16:89171504-89171526 GCGGGGCGGGGCCGGGGCCGAGG - Intergenic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142352736 16:89587337-89587359 GCGGGGCGGGGGCGGGGGCGGGG - Intronic
1142393205 16:89816220-89816242 GAGGGGCGGCCTCTGCGCTGAGG + Intronic
1142395292 16:89828416-89828438 GCGGGGCGGCGACGGGGGCGGGG - Intronic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142417206 16:89949181-89949203 GAGCAGCGGCGGCGTCCCCGGGG - Intronic
1203081391 16_KI270728v1_random:1147654-1147676 GCGGGGCACCGGCGGCACCGGGG + Intergenic
1142474395 17:180817-180839 GGGGCGCGGCGCCGGCTCCGAGG + Intronic
1142596446 17:1032048-1032070 GAGGGAGGGCGGCGGGGTCGGGG - Intronic
1142631441 17:1229008-1229030 GGGGGGCGGCGGCCGCAGCGGGG - Intronic
1142683221 17:1562306-1562328 GAGGGGCGGCCGGGGCGTGGAGG - Intronic
1142683230 17:1562325-1562347 GAGGGGCGGCCGGGGCGTGGAGG - Intronic
1142764777 17:2058893-2058915 GAGCGGCGGGGGCGGCGCGCAGG + Exonic
1142799860 17:2338025-2338047 GAGGGGTGGCGGCGATGGCGGGG + Intronic
1142810602 17:2393932-2393954 GAGGCGCGGGGGAGCCGCCGGGG + Intronic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1142848134 17:2691935-2691957 GCGGGGCGGGGGCGGGGCCGCGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143223654 17:5282376-5282398 GGGCGGCGGCGGCGGCGGCTCGG + Exonic
1143500577 17:7336504-7336526 GAGGGGCAGGGGCGGGGCCTGGG - Intergenic
1143527257 17:7479684-7479706 CGGCGGCGGCGGCGGCGCTGGGG - Intronic
1143537337 17:7549172-7549194 CAGAGGCGGAGGGGGCGCCGGGG + Exonic
1143582640 17:7835674-7835696 GAGGGGCAGCGGCGGAGGCTGGG + Intergenic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1145970956 17:28956211-28956233 TAGGGGCGGGGGCGGGGGCGGGG + Exonic
1146022633 17:29292887-29292909 GGGGGGCGGCCGCGGTGCGGGGG + Intronic
1146058705 17:29593557-29593579 GAGGGACGGCGCCGGAGCCGGGG - Exonic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146283404 17:31559383-31559405 AGGGGGCGGCGGCGGCCCCCAGG + Intergenic
1146339604 17:32007668-32007690 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1146339607 17:32007674-32007696 CGTGGGCGGCGGCGGCGGCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146371092 17:32266006-32266028 GCGAGGAGGCGGCGGCGGCGCGG + Intergenic
1146371132 17:32266152-32266174 CGGGGGCGGCGGCGGCTGCGGGG - Intergenic
1146716202 17:35089076-35089098 AGGCGGCGGCGGCGGCGCTGGGG - Intronic
1146759111 17:35460666-35460688 GCGGGGCGGGGGCGGGGGCGGGG - Intergenic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147037747 17:37694425-37694447 GGGGGGGGGCGGCGGGGCGGGGG - Intronic
1147132841 17:38419214-38419236 GAGGGGCGGGGCCGGCGGGGCGG + Intergenic
1147134731 17:38428404-38428426 GAGGGGCGGGGCCGGGGGCGGGG - Exonic
1147168552 17:38605568-38605590 CGGGGGCGGCGGCCGGGCCGGGG - Intronic
1147402804 17:40191276-40191298 GAGGGGCGGCCAGGGCGCCAGGG - Intronic
1147710319 17:42458834-42458856 GGGGGCCGGCGGCGGCGCAGGGG + Intronic
1147757897 17:42780548-42780570 GCGGGGCGGCGACGGGGGCGGGG + Intergenic
1147793045 17:43025188-43025210 GCGGGGCGGAGGGGGGGCCGCGG + Intergenic
1147793048 17:43025196-43025218 GAGGGGGGGCCGCGGACCCGGGG + Intergenic
1147793082 17:43025287-43025309 GGGAGGCGGCGGCGGGGCCCGGG + Exonic
1147947248 17:44086974-44086996 GAGGGGTGGGGGCGGGGGCGGGG + Intronic
1147971536 17:44220985-44221007 CCCGGGAGGCGGCGGCGCCGAGG - Intronic
1147994633 17:44354054-44354076 CGCGGGCGGCGGCGGCGGCGCGG + Exonic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148054812 17:44787657-44787679 GTGGGGCTGCGGAGGCGCTGGGG - Intergenic
1148323786 17:46771927-46771949 GAGGCGCGGCGGCGGCGCGGCGG - Intronic
1148337461 17:46851402-46851424 GAGGGGCGGGGGCGGTCCAGGGG + Intronic
1148493469 17:48037815-48037837 GCGGGGCGGCGGCGGCGGGCAGG - Intronic
1148551068 17:48551101-48551123 GGGCGGTGGCGGCGGCGGCGGGG - Exonic
1148556597 17:48582230-48582252 CACCGGCGGCGGCGGCGCGGAGG + Intronic
1148786838 17:50149734-50149756 GGCGGGCGGCGGCGGCGGCGGGG + Exonic
1148804914 17:50259173-50259195 GGGGGGCGGCGGGGGCTCAGGGG + Intergenic
1149430729 17:56594138-56594160 GGGGGAGCGCGGCGGCGCCGCGG + Exonic
1149610527 17:57955323-57955345 CAGGCTCGGCGGCGGCGGCGCGG + Exonic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1149712572 17:58756335-58756357 CTGGGGCGGCGGCGGCGGCACGG - Exonic
1149855415 17:60078652-60078674 GAGGGGTGGGGCCGGGGCCGGGG + Intronic
1149905872 17:60526026-60526048 GAGGGGCGGTGGCAGCCACGCGG + Exonic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150250090 17:63700230-63700252 GGGGGTCGGCGGCGGCGCCGGGG - Intronic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150407979 17:64919175-64919197 CGGCGGCGGCGGCGGGGCCGGGG + Intronic
1150692751 17:67378866-67378888 GAGCGGCGGGGGCTGCGACGCGG + Intronic
1150764595 17:67993391-67993413 GCGGCGGGGCGGCGGCGCGGCGG + Intronic
1150791890 17:68205754-68205776 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1150791893 17:68205760-68205782 CTTGGGCGGCGGCGGCGGCGGGG - Intergenic
1150830263 17:68512521-68512543 GACGGGCGGCGGCGGGCGCGAGG - Exonic
1151555213 17:74843173-74843195 CAGGGGCGGCCCCGGCGTCGGGG + Exonic
1151711412 17:75809081-75809103 GAGCGGCGGGGGCGGGGGCGGGG + Intronic
1151783855 17:76265671-76265693 GCCGGGCGGCGGCGGGGGCGGGG + Intronic
1151812443 17:76452667-76452689 GGGGGTCGGCGGCCGGGCCGAGG - Intronic
1151939031 17:77281370-77281392 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1152049232 17:77959232-77959254 CGGCGGCGGCGGCGGCTCCGCGG - Intergenic
1152183528 17:78840328-78840350 GCGGGGCGGGTGCGGCCCCGGGG - Intronic
1152245590 17:79183159-79183181 CGGTGGCGGCGGCGGCGCAGAGG + Intronic
1152362538 17:79839347-79839369 GGCGAGCGGCGGCGGCGGCGGGG - Exonic
1152407347 17:80105143-80105165 CAGGGGCGGGGGCGGCGGCCAGG + Intergenic
1152445086 17:80337743-80337765 GAAGGGCCGCAGCTGCGCCGAGG - Intronic
1152468267 17:80477377-80477399 GCGGGCAGGCGGCGTCGCCGGGG + Intronic
1152477450 17:80527299-80527321 GATGGGCGGTGGCGGCGCAGTGG + Intergenic
1152542135 17:80981751-80981773 GAGGGGCTGCGGCAGCGCCGGGG - Intergenic
1152617855 17:81346085-81346107 GCGGGGCGGCGGGGGCGGGGCGG - Intergenic
1152628651 17:81399802-81399824 GCGCGGCGGCAGCGGCGCTGCGG - Exonic
1152711227 17:81871262-81871284 GCGGGGCGGAGGCGGCGGGGCGG - Intronic
1152716233 17:81902149-81902171 GAGGGGCGGCGGGCGGGCTGGGG - Exonic
1152718496 17:81911228-81911250 GGCGGGCCGCGGGGGCGCCGGGG - Intronic
1152721879 17:81927468-81927490 GCGGCGCGGCGGGGGCGGCGGGG - Intronic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152729217 17:81961501-81961523 AAGGGGCGGCGGCGACGGGGAGG + Intronic
1152744277 17:82031871-82031893 GCGGGGCGGGGGTGGCGCCCGGG + Intronic
1152750896 17:82062030-82062052 GAGGGGCGGAGGGGGCTCTGAGG - Intronic
1152798749 17:82321574-82321596 GGGAGGCGGCGGCGGCGGCTCGG - Exonic
1152817833 17:82418662-82418684 GAGCGGAGGCGGCGGCCGCGAGG + Exonic
1152870630 17:82751571-82751593 GCGGGGCGGGGGCGGGGCGGGGG - Intergenic
1152876319 17:82788389-82788411 GGGAGGCGGCGGCGGGGCTGGGG + Intronic
1152924187 17:83080005-83080027 GAGGGGAGGGGGCCGGGCCGGGG - Intronic
1152924480 17:83080848-83080870 CGGGGGCGGGGGCCGCGCCGAGG - Intronic
1153006188 18:500485-500507 GTAGGGCGGCGGCAGCTCCGCGG - Intronic
1153052190 18:909449-909471 GAGCCTCGGCGGCGGCGCGGGGG + Exonic
1153935222 18:9914594-9914616 TGGCGGCGGCGGCGGCGCCAGGG - Intronic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154202334 18:12308184-12308206 GCGGGGCGGGGGCGGGGGCGCGG + Exonic
1154241557 18:12657959-12657981 GTTGGGCGGCGGCGGTTCCGGGG - Exonic
1154348576 18:13564687-13564709 GAAGGGGGGCGGCAGCGCAGAGG - Intronic
1155392741 18:25352362-25352384 GAGGGGCGGCGGCGCAGGAGCGG - Intergenic
1156350735 18:36298650-36298672 GAGGAGGGGCGGGGGCGCGGAGG + Intronic
1157136675 18:45063475-45063497 CAGGGGCGGCGGCGGTGGCGGGG - Exonic
1157383818 18:47246661-47246683 CAGGGGCGGCGGCGGGGGCGGGG + Intronic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157384298 18:47248308-47248330 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1157799702 18:50609323-50609345 GCGGGGCGGCGGCCGGGCGGAGG + Intronic
1157867202 18:51197234-51197256 CGGTGGCGGCGGCGGCGGCGGGG + Exonic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158434951 18:57428806-57428828 GCGTGGCGGCTGCGGCGTCGAGG - Intergenic
1158435946 18:57435678-57435700 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1158435996 18:57435833-57435855 CAGTGGCGGGGGCGGCGGCGGGG + Exonic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158648893 18:59269373-59269395 GAGGGGCGACAGCGTCGCGGAGG + Exonic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1158976439 18:62715469-62715491 GGGGGGCGGTGGCGGCGAGGCGG + Exonic
1159040285 18:63318414-63318436 CAGGCCCCGCGGCGGCGCCGGGG + Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1159670150 18:71212527-71212549 GGGGGGCGGGGGCGGCGGGGCGG + Intergenic
1160024934 18:75209236-75209258 CGGGGGCTGCGCCGGCGCCGGGG - Exonic
1160163217 18:76491280-76491302 GAGGGCCGGGGCCGGGGCCGGGG - Intronic
1160163949 18:76494839-76494861 GAGGGGCGGGGTGGGGGCCGGGG - Intronic
1160204506 18:76822303-76822325 TGGGGGCGGGGGCGGCGGCGGGG - Intergenic
1160242354 18:77132780-77132802 GACTGACGGCGGCGGCTCCGAGG + Intronic
1160453445 18:78980154-78980176 GCGGGGCGGCGGCGGCTGCGCGG - Intergenic
1160453596 18:78980668-78980690 GCGCGGCGGCGGAGGCACCGTGG - Intronic
1160691092 19:460946-460968 GGGGGGCGCGGGGGGCGCCGGGG + Exonic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160719075 19:589799-589821 GAGGGGCGGGGGAGGGGCGGGGG - Intergenic
1160722561 19:603973-603995 GTGGGGCGGGGGCGGGGCCAAGG + Intronic
1160723679 19:608375-608397 GAGGGGCGGGCCCGGCCCCGGGG + Intronic
1160726787 19:620963-620985 CAGGGGGCGCGGGGGCGCCGGGG + Intronic
1160738811 19:676606-676628 GGGGCGCGGCGGCGGCGGCGGGG + Intronic
1160790456 19:920575-920597 CGGGGGCGGCGGGGGCGGCGCGG - Exonic
1160860880 19:1236852-1236874 GGGGGGGGGCGGCGGCCTCGGGG + Intronic
1160930465 19:1567639-1567661 CCGGGGCGGCGGCGGCGGCGGGG + Exonic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160930621 19:1568095-1568117 CGCGGGCGGCGGCGGCGGCGCGG - Intergenic
1160930703 19:1568310-1568332 CCGAGGCGGCGGCGGCGGCGCGG + Intergenic
1160930715 19:1568358-1568380 GCGGGGCCGGGGCGGGGCCGCGG - Intergenic
1160975132 19:1789336-1789358 GGGTGGCGGCGGCGGGGCTGGGG - Intronic
1160991816 19:1863269-1863291 GGGGCGCCGCGGCGGCGCCGGGG + Exonic
1161006891 19:1941487-1941509 GTGTGGGGGCGGGGGCGCCGGGG - Intronic
1161014865 19:1978530-1978552 GTGGGGCGGGGGCTGCGCAGGGG + Intronic
1161029495 19:2051118-2051140 GTGGGGCGGCGGCGGCACTGCGG - Exonic
1161207200 19:3047268-3047290 GCGGGGCGGCCGCGGCGGGGAGG + Intronic
1161265115 19:3360205-3360227 GAGGGGCGGAGAGCGCGCCGCGG + Intronic
1161384826 19:3985326-3985348 GAGCGGCGGCGGGGCCTCCGCGG - Intronic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161450715 19:4343880-4343902 GGGGGGCTGCGGCGGGCCCGGGG + Exonic
1161461544 19:4400501-4400523 GAGCGGCTGAGGCGGCGCCGGGG - Exonic
1161550670 19:4910356-4910378 GAGGGGGGGCGTGGGCACCGAGG + Intronic
1161608754 19:5229462-5229484 GGGGGGCCGGGGCGGGGCCGGGG - Intronic
1161664542 19:5567619-5567641 GTGGGGCGGGGGCGGCGGCCGGG - Intergenic
1161688947 19:5719820-5719842 GGGGGGCAGCGCGGGCGCCGGGG - Exonic
1161808726 19:6459585-6459607 GCGGAGCGGCGGCAGCGCTGGGG - Exonic
1161816392 19:6502257-6502279 GGGGAGCTGCGGCGGCGGCGAGG + Exonic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162046827 19:8005534-8005556 GGCGGGAGGCGGCGGCGGCGCGG + Exonic
1162079405 19:8209445-8209467 GAGGGCCGGCGGCGGGGCTGGGG - Exonic
1162099858 19:8333263-8333285 GATGGTCCACGGCGGCGCCGTGG + Intronic
1162128247 19:8510884-8510906 CGGGGGCCGCGGGGGCGCCGGGG + Exonic
1162145509 19:8610661-8610683 CAGCGGCGGCGACGGCGCGGAGG - Intronic
1162339938 19:10086298-10086320 GAAGGGCGGAGCCGGCCCCGAGG + Exonic
1162426875 19:10602422-10602444 GAGGGGCGGGGCCGGGGCCCGGG + Intergenic
1162470875 19:10871493-10871515 CGGTGGCGGCGGCGGCGGCGAGG + Exonic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162535837 19:11262472-11262494 CGGCGGCGGCGGCGGGGCCGGGG - Intronic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1162571976 19:11479533-11479555 CAGGGGCGGGGGTGGAGCCGGGG + Intronic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162910980 19:13847640-13847662 GAGGGGAGGCTGGGGCGGCGGGG + Intergenic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163154494 19:15432540-15432562 TGGGGGCGGCGGCGGCGGCGCGG + Intronic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163282101 19:16324573-16324595 GACGGGCGGGGGCGGGGCCCGGG + Intergenic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163304982 19:16472099-16472121 GAGGGGCGGGGGCAGGGGCGGGG + Intergenic
1163427079 19:17245693-17245715 GAGGGGCGGCGGGTGCGCGCCGG + Exonic
1163592878 19:18204205-18204227 TAGGGGCGGGAGCGGCGCGGGGG + Intergenic
1163655673 19:18543534-18543556 GAGGCGCGGCGGCCGCGGCTGGG - Exonic
1163807079 19:19405924-19405946 GCCGGGCGGCGGAGGGGCCGGGG - Intronic
1163845755 19:19637400-19637422 GGCGGGCGGCGGGGGCGGCGGGG + Exonic
1164274221 19:23702652-23702674 CAGGGGCGGGGGCGGGGGCGGGG - Intergenic
1164958426 19:32406036-32406058 GGGGCGCGGCCGCGGCGTCGGGG + Intronic
1165227462 19:34365101-34365123 GCGGGTCGGGGGCGGGGCCGGGG + Intronic
1165242805 19:34481548-34481570 GGCGGGCGGCGGAGGCACCGCGG - Intergenic
1165243010 19:34482133-34482155 GAAGGGCAGCGGCGGCCCCGAGG + Exonic
1165420070 19:35718090-35718112 GCGGGGCGCCGGCGGGGGCGGGG + Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165700457 19:37933294-37933316 GAGGGAGGGAGGCGGCGCTGGGG - Intronic
1165721460 19:38082318-38082340 GGGGGGCGGCGGCGGAGCCAAGG + Exonic
1165737123 19:38183807-38183829 GAGGTGCGGAGGCGGGGCCAGGG + Intronic
1165745980 19:38229618-38229640 GCGCGGCGGCAGCGGCGCCCCGG - Intronic
1165774246 19:38395554-38395576 GTGGGGCGGCCGCGGCTACGAGG + Exonic
1165850857 19:38849699-38849721 GGCGGGCGGCGGCGGCGGTGGGG - Exonic
1166083252 19:40458274-40458296 GGTGGGCGGCGGCGGCGGCAGGG + Intronic
1166121737 19:40690804-40690826 GCGGGGCGGTGGCCGCGCCGGGG - Intronic
1166304250 19:41928589-41928611 TGGAGGCGGCGGCGGCGGCGCGG + Intronic
1166304253 19:41928592-41928614 AGGCGGCGGCGGCGGCGCGGGGG + Intronic
1166735048 19:45079166-45079188 GTGGGGCAGTGGCGGCGGCGCGG + Intergenic
1166831791 19:45643721-45643743 GAGGAGCGGCGGCTGCACTGCGG - Intronic
1166843420 19:45712431-45712453 AGGGGGCGGAGGGGGCGCCGGGG + Exonic
1166852849 19:45768692-45768714 GTGAGGCGGCGGCGGCGGCCGGG - Exonic
1166882982 19:45940292-45940314 GGGAGGCGGGGGCGGCGGCGGGG + Exonic
1166888057 19:45973451-45973473 TTGCGGCGGCGGCGGCGGCGGGG + Exonic
1166888064 19:45973469-45973491 CGGGGGCGGCGGCGGCTGCGGGG + Exonic
1166888258 19:45973958-45973980 CGCGGGCGGCGGCGGCGACGGGG + Intergenic
1166949436 19:46416655-46416677 GTGGGGCGGAGGCGGAGGCGAGG + Intergenic
1167072337 19:47228236-47228258 GTGGGGCGGTGGGGGCGCAGAGG + Exonic
1167080856 19:47275247-47275269 TAGCGGCGGCGGCGGCTCAGCGG - Exonic
1167134433 19:47608681-47608703 CGGGGGCGGCGCCGGCGCGGAGG + Intronic
1167134538 19:47609007-47609029 GCGGGGCGGCGGCGGGGGCCCGG + Intronic
1167257985 19:48442649-48442671 CAGGGGCTGTGGCGGCGGCGGGG - Exonic
1167268251 19:48493883-48493905 CGGGCGCGGCGGCGGGGCCGCGG - Exonic
1167369654 19:49072834-49072856 CGCGGGCGGCGGCGGCGGCGGGG - Exonic
1167432289 19:49461643-49461665 GAGGGGCGCCGGGGAGGCCGGGG - Exonic
1167506389 19:49873179-49873201 GGGTGGTGGCGGCGGGGCCGCGG + Exonic
1167557470 19:50205297-50205319 CGGCGGCGGCGGCGGCGCCAGGG - Intronic
1167596770 19:50432229-50432251 GAGGGGCGGCGGCCAGTCCGGGG + Intergenic
1167622737 19:50568302-50568324 GAGCGGCGCCGGCGGGCCCGAGG - Intergenic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1167797546 19:51719647-51719669 GGGTGGCGGCGGCGGCGCGGGGG - Exonic
1167797549 19:51719650-51719672 GGCGGGTGGCGGCGGCGGCGCGG - Exonic
1167862538 19:52297123-52297145 GCGGGGCGGGGGCGGGGGCGGGG - Intergenic
1167889346 19:52527518-52527540 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
1167940565 19:52942712-52942734 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1167995120 19:53395637-53395659 GGAGGGAGGCGGCGGCGCCACGG - Intronic
1168056502 19:53867820-53867842 GCGGGACGGGGGCGGGGCCGGGG - Intronic
1168076198 19:53982020-53982042 CGGGGGCGGGGGCGGGGCCGGGG + Intronic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168076428 19:53982849-53982871 GGGGCGCGGCGGGGGAGCCGAGG + Exonic
1168246951 19:55117271-55117293 GCGGGCGGGCGGCGGCGCGGCGG + Exonic
1168272667 19:55258536-55258558 TGGGGGCGGGGGCGGCGTCGGGG + Exonic
1168276075 19:55279512-55279534 GGGCGGCGGCGGCGGCTCCTCGG - Exonic
1168287532 19:55342095-55342117 GAGGGGCGGCAGCGGTGCAAGGG - Intronic
1168573241 19:57487870-57487892 GAGGCTCGGTGGCGGCGCCCAGG + Exonic
1168574659 19:57500010-57500032 GAGGCTCGGTGGCGGCGCCCAGG + Exonic
1168694423 19:58396604-58396626 CAGAGGCGGCGGGGGCGGCGGGG - Exonic
1202693092 1_KI270712v1_random:105042-105064 GAGAGGCGGCGGCGGCGGAGAGG + Intergenic
1202693104 1_KI270712v1_random:105089-105111 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693116 1_KI270712v1_random:105133-105155 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693128 1_KI270712v1_random:105177-105199 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693140 1_KI270712v1_random:105221-105243 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693152 1_KI270712v1_random:105265-105287 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693164 1_KI270712v1_random:105309-105331 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693176 1_KI270712v1_random:105353-105375 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693188 1_KI270712v1_random:105397-105419 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693200 1_KI270712v1_random:105441-105463 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693211 1_KI270712v1_random:105485-105507 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693223 1_KI270712v1_random:105529-105551 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
926089878 2:10043201-10043223 GCGGGGCGGCGGGGGCGGCGGGG - Intronic
926089907 2:10043254-10043276 GCGGGGCGGAGGGGGCGGCGGGG - Intronic
926252774 2:11165262-11165284 GAGGGGCGGCTGCCGGGCAGAGG + Intronic
926401319 2:12499998-12500020 GAGGGGCGGCAGCAGAGCAGGGG - Intergenic
926422954 2:12716888-12716910 GGGGGGGGGCGGAGGCTCCGTGG + Exonic
927053707 2:19351971-19351993 GAGGCGCCGCTGCGGCTCCGCGG + Exonic
927472215 2:23385242-23385264 GGACGGCGGCGGCGGCGCGGGGG - Exonic
927472218 2:23385245-23385267 CGGGGACGGCGGCGGCGGCGCGG - Exonic
927652345 2:24920203-24920225 GCGCGGCGCCGGCGGCTCCGGGG + Intergenic
928904747 2:36356739-36356761 GAGGGGCGGCCGCCGCCCCCAGG + Intronic
929033666 2:37671694-37671716 GCGGGGCGGGGCCGGCGGCGCGG + Exonic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929133501 2:38602161-38602183 GCGGCGCGGCGGCGGCGGCGGGG - Intronic
929452733 2:42047931-42047953 GAGGGGCGGGGGAGGGGGCGGGG + Intergenic
929537505 2:42792747-42792769 GCGCGGCGGCGGCAGCGCTGGGG + Intergenic
929604176 2:43224531-43224553 GAGGTGCGGCGGCCCCGGCGGGG + Exonic
929760529 2:44802646-44802668 GAGGCCCTGCTGCGGCGCCGCGG + Intergenic
929857846 2:45651236-45651258 GAGGGCGGGCGCCGGCGCCCAGG + Intergenic
929872552 2:45771403-45771425 GAGGGGAGGTGGCCGCGCCAGGG - Intronic
930358216 2:50346865-50346887 CGGCGGCGGCGGCGGCGCAGGGG - Intronic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931348828 2:61470816-61470838 GGCGGGCGGCGGCGGGGACGGGG + Intergenic
931602595 2:64019220-64019242 CAGCGGCGGAGGCGGCGCTGCGG - Intergenic
931649386 2:64454456-64454478 GCGGGGCGGGGGCGGGGGCGCGG - Exonic
932036434 2:68251856-68251878 GTGGGGCGACGGCGGGGCGGCGG + Intronic
932036561 2:68252259-68252281 GGGGAGGGGAGGCGGCGCCGCGG + Exonic
932231498 2:70087557-70087579 GGCGGGCGGCGGCGGCGGAGGGG - Exonic
932414650 2:71566216-71566238 GAGTGGCGGGGGCGGGGCGGGGG + Intronic
932625213 2:73291871-73291893 GGTGGGCGGCGGCGGCGGCACGG + Exonic
932722349 2:74147441-74147463 GAGGGACTGCAGCGGGGCCGGGG - Intronic
932820710 2:74897504-74897526 ATGGGGCGGCGGCGGCGGGGAGG - Intergenic
933666802 2:84971088-84971110 GAGGGGCGGGGGGTGGGCCGGGG + Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933666980 2:84971628-84971650 CCGTGGCGGCAGCGGCGCCGCGG - Intronic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
933776151 2:85772397-85772419 GAGGGGGGGCCGCGGCGGCCGGG - Intronic
933858401 2:86441301-86441323 GAGCGGCGGAAGCGGCTCCGAGG + Exonic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934275659 2:91571451-91571473 GACGGACAGCGGCGGCGCGGCGG + Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
934566977 2:95346598-95346620 GGGGCGCGGCGGCGGCGGCGCGG - Intronic
934662924 2:96152779-96152801 GAGGGGCGGGGGTGGCTCCCAGG + Intergenic
935011497 2:99140976-99140998 GAGTGGCGGGTGCGGGGCCGTGG - Intronic
935046750 2:99489876-99489898 CACTGGCGGCGGCGGGGCCGGGG - Exonic
935095713 2:99942541-99942563 GAGGGGCGGGGGGGGGGTCGCGG + Intronic
935112282 2:100104718-100104740 GGCGGGGGGCGGCGGCGGCGCGG - Intronic
935112293 2:100104740-100104762 GAGGGGCGGGCGCAGGGCCGGGG - Intronic
935237562 2:101151330-101151352 GAGAGGCGACGGCGGCGCGCGGG + Intronic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
936122666 2:109760363-109760385 CAGGGCCGGGGGCGGGGCCGGGG + Intergenic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936221993 2:110611032-110611054 GGGCGGTGGCGGCGGCGGCGCGG - Intergenic
936222027 2:110611110-110611132 CAGGGCCGGGGGCGGGGCCGGGG - Intergenic
936561416 2:113542245-113542267 AGGGCGCGGCGGCGGCGCGGCGG - Intergenic
936561417 2:113542248-113542270 GAGAGGGCGCGGCGGCGGCGCGG - Intergenic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937018928 2:118633068-118633090 GCGGGGCGGGGGCGGGGGCGGGG - Intergenic
937917777 2:127107279-127107301 GAGGGGCGCGCGCGGCGCTGGGG + Exonic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
937951074 2:127388180-127388202 CAGGGGCGGGGGCGGGGCCGAGG - Intronic
938982378 2:136539045-136539067 GAGGGGAGGGGGCGGGGGCGGGG - Intergenic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
940517241 2:154697943-154697965 GAGGGCAGGAGGCGGCGCAGCGG - Intergenic
940971970 2:159904793-159904815 GGGCGGCGGGGGCGGGGCCGGGG - Intergenic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941951452 2:171160697-171160719 GCGCGGCGGCGGAGGCGTCGAGG + Exonic
942046163 2:172100624-172100646 GGGGTGCAGCAGCGGCGCCGTGG + Exonic
942046515 2:172102298-172102320 GGCGGGCGGCGGCGGCGGCGGGG - Exonic
942046550 2:172102427-172102449 GAGCGGCGGCGGCGCCGGCCCGG - Exonic
942314196 2:174682934-174682956 GGGGGGCGGCGGCGCCGGAGGGG - Intergenic
942314200 2:174682945-174682967 GCGGGGCGGCGGGGGGGCGGCGG - Intergenic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
942450925 2:176107637-176107659 CGGGGGCGGCGGCGGCGCGGGGG + Exonic
942458177 2:176151929-176151951 GGGCGCCGGCGGAGGCGCCGGGG - Exonic
942653813 2:178194649-178194671 GAGGGCGAGCGGTGGCGCCGCGG - Exonic
942890473 2:180980971-180980993 GAGGTAAGGCGGCGGGGCCGGGG + Exonic
942890494 2:180981011-180981033 CCGGGGCGGCGGCGGCGGTGGGG + Intronic
944811135 2:203328449-203328471 GAGCGGCGGCCGCAGCGCCAAGG - Exonic
945245233 2:207711658-207711680 GGGAGGCGGCGGCAGCGCGGCGG + Intronic
945492837 2:210476469-210476491 CGAGGGCGGCGGCGGCGCCCAGG + Exonic
945530849 2:210950979-210951001 ATGGGGCGGCGGCGGGGCGGAGG - Intergenic
946185530 2:217978662-217978684 GCGGGGCGGGGGCGGTGCCCGGG - Intronic
946326097 2:218985366-218985388 GAGGGGCGGGGGCGGGGTCCTGG - Exonic
946373549 2:219294920-219294942 CATGGGCGGGGGCGGAGCCGGGG - Intronic
946386620 2:219387822-219387844 GAGGGGCGGGGCAGGCGGCGCGG - Exonic
946692418 2:222319502-222319524 GGGCGGCGGTGGCGGGGCCGGGG + Intergenic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
947602679 2:231464268-231464290 GAGGGGCGAGCGCGGCGCCGCGG - Intronic
947774520 2:232697256-232697278 AAGGGGCGGGGGCGGAGCAGGGG + Intergenic
947774553 2:232697439-232697461 GGGACGCGGCGGCGGGGCCGGGG - Intronic
947800948 2:232928237-232928259 GCCGGGCGGCGGCGGGGCGGGGG + Intronic
947840502 2:233204557-233204579 CAGCGGCGGCCGCGGCGTCGGGG - Exonic
948492141 2:238320558-238320580 ACCGGGCGGCGGCGGCGGCGGGG + Exonic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948824681 2:240568504-240568526 GCCGGGCGGCGGCGGCGGCGGGG - Intronic
948874850 2:240820826-240820848 GAGGCGAGGCGGCGGGTCCGCGG - Intergenic
948988716 2:241541258-241541280 GCGGGGCCGCGGCGGGGGCGGGG + Intergenic
949051933 2:241902325-241902347 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051940 2:241902342-241902364 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051947 2:241902359-241902381 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051954 2:241902376-241902398 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051961 2:241902393-241902415 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051968 2:241902410-241902432 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
1168769801 20:408024-408046 GCGGGGCCGGGGCGGGGCCGGGG - Intronic
1168795884 20:610042-610064 GGCGGGCGGCGGCGGCGGCGCGG - Exonic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169191396 20:3660916-3660938 CGCGGGCGGCGGCGGGGCCGTGG - Exonic
1169278453 20:4248786-4248808 GGGCGGCGGCGGCGGCGTGGTGG - Exonic
1169278454 20:4248789-4248811 CGCGGGCGGCGGCGGCGGCGTGG - Exonic
1169327538 20:4687233-4687255 GACGGGCGGGGGCGGGGCCTCGG + Intronic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1169849546 20:10034872-10034894 GAGGGGCGGAGGCGGAGGCGGGG + Intronic
1170612134 20:17923366-17923388 GGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1170688248 20:18588201-18588223 GAGGGGCCGCAGCGGCCCCAAGG - Intronic
1170756804 20:19212486-19212508 GCGGCGCGGCGGGGGCGGCGGGG - Intergenic
1172028955 20:31968267-31968289 GGGAGGCGGCGGCGGCGGCCGGG + Exonic
1172037013 20:32018190-32018212 GAGGGGCGGGGGCGGGGGCGGGG + Intronic
1172037028 20:32018213-32018235 GAGGGGCGGGGGCGGGGGCGGGG + Intronic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172061550 20:32190216-32190238 GCCGGGCGGCGGGCGCGCCGCGG + Intergenic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172083220 20:32358681-32358703 CTGGGGCGGCGGCGGCGGTGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172277230 20:33686292-33686314 GACAGGCGGCGGCGGCGGCGCGG + Exonic
1172408145 20:34704389-34704411 CGGGGGAGGCGGCGGGGCCGCGG - Exonic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172482245 20:35277893-35277915 AAGCGGCGGCCGCGGCGCCCCGG - Intergenic
1172618721 20:36306448-36306470 GAGAGGCGGCGGCGGCGCAGCGG + Exonic
1172662047 20:36574441-36574463 GGGGGGGGGGGGCGGCGCGGAGG + Intronic
1172684911 20:36746123-36746145 GAGGGGCGGGGGAGGTGCTGCGG + Intergenic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1173221968 20:41138173-41138195 GAGTGGTGGCGGCGTCGGCGAGG + Intronic
1173279814 20:41618197-41618219 GAGGGGCTGCGGCGGCGTCCAGG - Intronic
1173548132 20:43914744-43914766 GCGGGGCGGGGGCGGGGGCGGGG + Intergenic
1173880211 20:46406353-46406375 GAGGGGTGGCGGCCCTGCCGGGG - Intronic
1174133217 20:48360172-48360194 GCGGGGCGGGGGCGGGGGCGGGG + Intergenic
1174258697 20:49277944-49277966 GCGGGTCGGCGCGGGCGCCGGGG + Intronic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174386664 20:50191524-50191546 GGCGGGCGGCGGCGGCGGCGGGG - Exonic
1175057163 20:56208895-56208917 GAGTGGCGGTGGCGGGGCGGGGG - Intergenic
1175057176 20:56208950-56208972 GAGTGGCGGTGGCGGGGCGGGGG - Intergenic
1175349842 20:58309879-58309901 GTGCGGCGGCAGCGGCGCCAGGG + Exonic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175789237 20:61731279-61731301 GAGGGGCCGCCGGGGGGCCGAGG - Intronic
1175831103 20:61965892-61965914 GAGGGCTGGGGGCGGGGCCGGGG - Intronic
1175859715 20:62143656-62143678 GAGGCGCGGCGACGGCGACGGGG + Intergenic
1175945027 20:62554683-62554705 GAGTGGTGGCGGCGGCTCTGGGG + Intronic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176125060 20:63471586-63471608 GAGGGGCGTCGGCGCCGAGGGGG + Intronic
1176128963 20:63488213-63488235 GCGGGGCGGGGGCGGGGCGGGGG + Exonic
1176159694 20:63641924-63641946 CAGGGGCCGGGGCGGGGCCGGGG - Intronic
1176159747 20:63642049-63642071 CAGGGGCCGGGGCGGGGCCGGGG - Intronic
1176159764 20:63642088-63642110 AAGGTGCGGGGGCGGGGCCGGGG - Exonic
1176178880 20:63740474-63740496 CGGGGGCGGCGGCGGGGCCCCGG + Exonic
1176194623 20:63831423-63831445 GAGGGGCGGGGCCGGCGGCCGGG - Intergenic
1176286801 21:5022826-5022848 AGCGGGCGGCGGAGGCGCCGGGG + Intronic
1176374531 21:6080548-6080570 GAGGGGCTGCTGCGGGACCGGGG - Intergenic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176549734 21:8216030-8216052 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176550171 21:8217375-8217397 GGCGGGCGGCGGAGGGGCCGCGG + Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176557625 21:8260259-8260281 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176568659 21:8399064-8399086 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176577013 21:8444645-8444667 GGCGGGCGGCGGAGGGGCCGCGG + Intergenic
1177011302 21:15733124-15733146 GGGGGGGGGGGGGGGCGCCGTGG - Intronic
1177166875 21:17613005-17613027 GAGGGGCGGTGCCGGGGGCGGGG + Intergenic
1178351164 21:31873722-31873744 TGGGGGCGGCGGCGGCGCGGAGG + Exonic
1178446188 21:32645701-32645723 GCGGGGCGGCGGCGGCCGCTTGG + Exonic
1178544176 21:33479644-33479666 AAGGGGCGGCGGGGGCTCCGCGG + Intronic
1178906889 21:36643957-36643979 GAGGGGCGGCTGTGCCTCCGTGG - Intergenic
1178914474 21:36699029-36699051 GAGGGACCGCGGCGGGGGCGGGG - Intergenic
1178922423 21:36747576-36747598 GAGGGGTGGTGGCTGCGCCCGGG + Intronic
1179422452 21:41247649-41247671 GAGGCGGGGCGGCGGGGCCGTGG + Intronic
1179511812 21:41878798-41878820 GCCGGGCGGCGTCGTCGCCGAGG - Exonic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179748944 21:43457697-43457719 GAGGGGCTGCTGCGGGACCGGGG + Intergenic
1179836061 21:44034337-44034359 GAGGGGCGGCGGGGGTGGGGGGG - Intronic
1179870380 21:44240649-44240671 AGCGGGCGGCGGAGGCGCCGGGG - Intronic
1179882665 21:44300037-44300059 GCGGGGCGGGGACGGCGACGCGG + Exonic
1179953935 21:44727497-44727519 GAGGGGAGGCTGCGGCGGAGGGG - Intergenic
1179953941 21:44727514-44727536 GAGGGGAGGCTGCGGCGGAGGGG - Intergenic
1180095858 21:45555154-45555176 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180095873 21:45555187-45555209 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180095925 21:45555297-45555319 AGGGGGCGGCGGGGGCGGCGGGG + Intergenic
1180101818 21:45590975-45590997 GAGAGGCGGAGGCGGGGGCGGGG + Intergenic
1180235829 21:46458921-46458943 GCGGGGCAGCGGCGGCGCGGCGG + Intronic
1180559059 22:16601410-16601432 GAGTGGCAGCGGCGGCGCGCGGG + Intergenic
1180614770 22:17120230-17120252 CGGGGGCGCCGGCGGCGCGGGGG - Exonic
1180649977 22:17369589-17369611 GGCGGGGGGCGGCGGCGCGGGGG - Exonic
1180876665 22:19178104-19178126 AGGGGGAGGCCGCGGCGCCGCGG - Intronic
1180937397 22:19634701-19634723 GAGGGGAGGCCGCGGCCTCGGGG + Intergenic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1180960668 22:19760998-19761020 GTAGCGCGGCGGCGGCGGCGGGG - Exonic
1180960675 22:19761023-19761045 CGGGGGCGGCGGCGGCGCACGGG - Exonic
1181024042 22:20117623-20117645 GCGCGGCGGCGGCGGCGGCTCGG - Exonic
1181057846 22:20268296-20268318 CGAGGGCGGCGGCGGCGCGGGGG + Exonic
1181592722 22:23894960-23894982 GAGGGGCGGGGGAGGGGCGGCGG + Exonic
1181747853 22:24968196-24968218 GAAGGGGGGCGGCGGGGCAGGGG + Intronic
1181902677 22:26169317-26169339 GAGGGGCCGCGGCGGCGCCGGGG - Intergenic
1182294921 22:29307013-29307035 GCGGGGCGGAGACGGCGGCGAGG + Exonic
1182296254 22:29312399-29312421 GAGGGGCGGCGGGGGCCCCGAGG - Exonic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182475523 22:30574594-30574616 GCGGCGCGGCAGCGGCGGCGGGG - Intergenic
1182576471 22:31276565-31276587 GGGCGGCGGCGGGGGCGCCCGGG - Intronic
1182903702 22:33919952-33919974 GAGTCGCCGCGGGGGCGCCGTGG - Intronic
1183160260 22:36108563-36108585 GAGGGGAGGAGGGGGCGCTGTGG + Intergenic
1183370128 22:37427490-37427512 GAGGCGCGGCGGCGGGGAGGAGG - Intergenic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183429665 22:37757935-37757957 GAGGGGCCGCGCCGGGGCCTGGG + Exonic
1183452859 22:37906269-37906291 GAGGGGCGGAGGCGGGGCCGCGG - Intronic
1183486402 22:38089492-38089514 GAACGGCGGCGGGGGCGCCCAGG + Intronic
1183601707 22:38843895-38843917 CAGGCGCGGCGGCGGGGTCGGGG + Exonic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1183702345 22:39457576-39457598 GAGGGGCCGCGGCGCCCCCCAGG - Intronic
1183739479 22:39662090-39662112 GGAGCGCGGCGGCGGCGCCCGGG + Exonic
1183912949 22:41092442-41092464 CCGGTGCGGCGGCGGCGGCGCGG + Exonic
1184085935 22:42264260-42264282 GTGGGGCGGGGGCGGGGCGGGGG + Intronic
1184162416 22:42704880-42704902 GGGGGGGGGCGGCGGAGGCGGGG + Intronic
1184164569 22:42720140-42720162 GAGGGGCGCCTGCGGATCCGAGG + Intronic
1184337537 22:43862528-43862550 GACGCGCGGCGGAGGCTCCGCGG + Intergenic
1184361944 22:44024221-44024243 CAGGGGCGGGGGCGGGACCGGGG + Intronic
1184557393 22:45240748-45240770 CGGGGGCGGCGGCGGCGGGGAGG + Intronic
1184557423 22:45240890-45240912 CGCGGGCGGCGGCGGCGCGGAGG - Intergenic
1184593858 22:45502815-45502837 GCGCGGCGGAGGCGGGGCCGCGG - Intronic
1184620425 22:45672254-45672276 GCGAGGCGGGGGCGGCGCCTGGG - Intronic
1184680919 22:46071728-46071750 GGGCGGGGACGGCGGCGCCGCGG + Intronic
1184711289 22:46250772-46250794 GAGGGGCGCCGCAGGCGACGTGG - Intergenic
1184759591 22:46537107-46537129 GCAGGGCGGCGGCGGCGGCCAGG + Exonic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184766915 22:46576989-46577011 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1184766935 22:46577051-46577073 GCGGGGCGGCGGCTGCGCAACGG + Intronic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185038122 22:48490066-48490088 GAGGGCGGGCGGCGCTGCCGGGG + Intronic
1185055270 22:48575877-48575899 CGGTGGCGGCGGCGGCGCGGCGG + Intronic
1185077875 22:48692938-48692960 GAAGGGCATCGGCGGCGCCTTGG + Intronic
1185271046 22:49929450-49929472 GAGGGGCGCCTGCGGGGCTGGGG + Intergenic
1185278857 22:49961380-49961402 CACGGGCGGCGGCGGCGGCGGGG + Intronic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
1185317867 22:50186476-50186498 GAGGGTCAGCGGCGGCCTCGCGG + Intronic
1185335163 22:50268070-50268092 GAGCTGGGGCGGCGGGGCCGGGG - Intronic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203255066 22_KI270733v1_random:133713-133735 GGCGGGCGGCGGAGGGGCCGCGG + Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203263122 22_KI270733v1_random:178792-178814 GGCGGGCGGCGGAGGGGCCGCGG + Intergenic
950008002 3:9703920-9703942 TAGGGGCGACGGCAGCGGCGGGG - Exonic
950024264 3:9809938-9809960 GAGAGGAGGCGGCGACGCGGAGG + Intronic
950153844 3:10708046-10708068 GGCGGGCGGCGGCGGGGCCGCGG - Intergenic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950487782 3:13283023-13283045 GCGGCGGGGCGGCGGCGGCGCGG + Intergenic
950549090 3:13655490-13655512 CAGGGGCCGCTGCGGCGCCGGGG + Intergenic
950650206 3:14402532-14402554 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
950729789 3:14947615-14947637 CGGCGGCGGCGGCGGCACCGGGG + Intronic
950821880 3:15768654-15768676 GGGGGGCGGCGGTGGGGCAGGGG + Intronic
950902998 3:16513710-16513732 GACGCGCGGCGGCGGCGGCGGGG - Intronic
951543632 3:23806119-23806141 GAGGCCCGGCGGCGCGGCCGGGG - Intronic
951611379 3:24495299-24495321 GATGGCTGGCGGCGGCGGCGGGG - Intergenic
952744452 3:36764222-36764244 CGGGGGCGGCGGCGGCTGCGGGG + Intergenic
952816785 3:37453108-37453130 GGGGGGGGGGGGGGGCGCCGGGG - Intronic
952942280 3:38454050-38454072 GGGGGGCGGCGGCGGGGCACGGG - Exonic
953033078 3:39190635-39190657 GAGGGGCGGGGGTGTAGCCGGGG - Intronic
953705149 3:45225520-45225542 CGGTGGCGGCGGCGGCGCTGGGG + Exonic
953748702 3:45594054-45594076 GAGGGGCGGGGACGGCGCGCGGG - Intronic
953801085 3:46023125-46023147 GGGTCGCGGCGGCGGCGCAGGGG + Intronic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954004018 3:47578317-47578339 GCGGGGCCGGGGCGGGGCCGGGG - Intronic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954223082 3:49166295-49166317 GAGCAGCGGAGGCGGCGCAGAGG - Exonic
954265936 3:49470365-49470387 GAGCGGCGGTGGCGGCGTCCTGG + Exonic
954389230 3:50260242-50260264 GTGAGGCGGCGACGGCTCCGCGG + Intergenic
954389249 3:50260296-50260318 GCGGGCCGGGGTCGGCGCCGCGG + Intergenic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954540627 3:51391247-51391269 GCGGGGCGGGAGCGGCGCCGAGG - Exonic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
954909029 3:54087782-54087804 GAGGGGCCCCCGCGGCGGCGGGG - Intergenic
955060460 3:55488229-55488251 GGGCGGCGGAGGCGGCTCCGTGG + Intronic
955195517 3:56801889-56801911 GCCGGGCGGCGGCGGCGACACGG + Intronic
955356593 3:58237471-58237493 GCGGGGCGGGGGCGGGGGCGGGG + Intergenic
955769235 3:62372520-62372542 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
956290309 3:67654306-67654328 GTGGGGCAGGGGCGGCGCGGCGG - Intronic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956678144 3:71754070-71754092 GGGTGGCAGCGGCGGCGGCGAGG + Exonic
956818309 3:72929006-72929028 GAGAGGCGGCGGTGGCTGCGCGG - Intronic
957939793 3:86990764-86990786 GAGCGGCGGCGGCAGCTCGGGGG - Exonic
958026891 3:88059269-88059291 CGGCGGCGGCGGCGGCGCAGGGG + Exonic
960884931 3:122384157-122384179 GAAGGACGCAGGCGGCGCCGGGG - Intronic
961012910 3:123448125-123448147 GGGCGGCGGCGGCGGCTCGGCGG - Exonic
961186245 3:124917742-124917764 GTGGGGCGGGGGCGGGGGCGGGG + Intronic
961446289 3:126983215-126983237 GGCGGACGGCGGCGGCGGCGCGG + Intergenic
961646191 3:128394001-128394023 GTGGGGCGGTGGCGGGGGCGGGG + Intronic
961688221 3:128650334-128650356 CGGGGGCAGCGGAGGCGCCGGGG + Intronic
961688267 3:128650454-128650476 GAGGGGCGCGGGCGGAGTCGGGG + Intronic
961735932 3:129002163-129002185 GGCGGGCGGCGGCGGCGGCGCGG - Exonic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
962156820 3:132956817-132956839 CAGGGGCGGGGGGGGCGGCGCGG - Intergenic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
962919139 3:139935428-139935450 GAGCGGCAGCGGCGGTGGCGGGG + Exonic
962971008 3:140402016-140402038 GAGGGGTGGCGGCGGGGGAGTGG + Intronic
963091393 3:141486919-141486941 GGGGGGCGGGGGCGGGGCCGCGG + Intergenic
963514688 3:146293615-146293637 GAGGGGCGGCAGCGAGGCTGGGG - Intergenic
963827502 3:149970923-149970945 AGCGGGCGGCGGCGGCGCGGGGG + Exonic
963888123 3:150603518-150603540 GAGGCGCGGCGGGGTGGCCGGGG - Intronic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
965473887 3:169130455-169130477 GAGGGCTGGCGGCGGGGGCGGGG - Intronic
965590507 3:170357195-170357217 GTGGGGCGGGGGCGGGGCGGTGG + Intergenic
965757391 3:172040197-172040219 GAGGGCGGGCGGCGAGGCCGAGG + Intronic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966182244 3:177197687-177197709 GCCGGGAGGCGGCGGCGGCGCGG + Intergenic
966182246 3:177197690-177197712 GGGAGGCGGCGGCGGCGCGGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966449869 3:180045994-180046016 GGGGGGCGGCGGGGGCGGGGGGG + Intergenic
966696288 3:182793545-182793567 GCCGGGCGGGGGCGGCGCCGGGG + Exonic
966743389 3:183254061-183254083 GCGGGGCGGGGGCGGGGCGGAGG - Intronic
967054920 3:185823711-185823733 GCGGGGCGGCGGCGAGGCCAAGG - Intronic
967272635 3:187743799-187743821 AAGGCGCGGCGGCGGCGGCCCGG - Intronic
967491772 3:190100234-190100256 GGGGGGCGGCGGGGGGGGCGGGG - Intronic
967685278 3:192409907-192409929 CTGGGGAGGCGGCGGCGCGGCGG - Intronic
967904008 3:194486527-194486549 GCGGGTGGGCAGCGGCGCCGGGG - Intronic
968479300 4:826435-826457 GGGGGGCGGGGGCGGGGGCGGGG + Intergenic
968514737 4:1011395-1011417 GCGGGGCGGGGGCGGGGGCGGGG + Intronic
968534140 4:1113112-1113134 GAGGGGCCGCGGGGGCGCGTGGG - Intronic
968542052 4:1172725-1172747 AAGGGGCTGCGGGGGCGGCGGGG + Intronic
968583014 4:1403615-1403637 GGGAGGCGGCGGCGGCCTCGGGG - Exonic
968659508 4:1793296-1793318 GCGCGGTGGCGGCGGCGTCGCGG + Exonic
968701209 4:2059101-2059123 CACGGGCGGGGGCGGCGGCGCGG - Intergenic
968729147 4:2261608-2261630 GGCGCGCGGCGGCGGCGCTGAGG + Intronic
968775435 4:2536963-2536985 GCGGGGCGGCGGCGGCGGCTCGG + Intronic
968820218 4:2844157-2844179 GGGAGGCCGCTGCGGCGCCGAGG + Intronic
968930679 4:3577019-3577041 TAGGGGCGTTGGCGACGCCGGGG - Exonic
968965544 4:3767480-3767502 GCCGAGAGGCGGCGGCGCCGGGG + Exonic
968985385 4:3871885-3871907 GAAGGACGGCGGCGGGGGCGGGG + Intergenic
969063916 4:4461982-4462004 CAGGGGCTGCGGCTGCGCAGTGG + Intronic
969295660 4:6269589-6269611 GCGGGGCGGGGGCGGGGCCGGGG + Intergenic
969436632 4:7192711-7192733 GCGCGGCGGCGGCGGAGCCCCGG - Exonic
969715743 4:8867406-8867428 GGGGGGTGGCCGTGGCGCCGGGG + Exonic
970332652 4:15002351-15002373 GAGGGGCGACGGGGACGCGGTGG + Intergenic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970441464 4:16083820-16083842 GAGGGGCTCAGGCGGCGCTGCGG + Intronic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971372282 4:26028814-26028836 GAGGGGCAGCGTCGGGGCGGCGG + Intergenic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
972586043 4:40437879-40437901 CAGGGGCGGCGGCGCGGCTGAGG - Exonic
972765862 4:42151958-42151980 GAAGGGCGGCGGGGGCGGCGGGG + Exonic
972770986 4:42196870-42196892 CAGGGGCGGGGGCGGGGGCGGGG - Intergenic
973279219 4:48341712-48341734 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
973613592 4:52659007-52659029 CTGGGGCGGCGGGGGCGGCGGGG - Intronic
974047140 4:56907872-56907894 CGGTGGCGGCGGCGGCGGCGCGG + Intronic
974386091 4:61202534-61202556 TCCGGGCGGCCGCGGCGCCGGGG + Intronic
975118464 4:70704821-70704843 CGGTGGCGGCGGCGGCGCAGCGG + Intronic
975701916 4:77075447-77075469 GAGGGGCGGGGGCGGGGGCGGGG - Intronic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
975870690 4:78776093-78776115 CCGGGGCGGCGGCGGCGCGACGG + Intergenic
976297250 4:83484870-83484892 GAGGAGGCGCGGCGGCGTCGGGG + Intronic
976874450 4:89836865-89836887 GAAGGGCGGAGGCGGCACCCGGG + Intronic
977257651 4:94758272-94758294 GTGGGGCGGTGGCGGCGGCGGGG + Intronic
977607225 4:98995555-98995577 GCGGGGCGGGGGCGGGGCCGGGG + Intergenic
978072588 4:104491457-104491479 CGGGGGCGGGGGCGGCGGCGGGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978620143 4:110629392-110629414 GAGGCGCGGGGGCGGGGCGGCGG + Intronic
978749619 4:112232060-112232082 GAGGAGGAGCGGCGGCGCCTGGG + Exonic
979785677 4:124712790-124712812 GCGGGGCGGGGGCGGGGGCGGGG - Intergenic
980827379 4:138089048-138089070 GAGCGGCGGCAACGGCGCGGCGG - Intergenic
980827380 4:138089051-138089073 GAGGAGCGGCGGCAACGGCGCGG - Intergenic
982042401 4:151409121-151409143 GGGGGGCGGGGGCGGGGGCGGGG - Intergenic
982357993 4:154490567-154490589 GAGAGGAGGCGGCGGCGCACCGG - Intronic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
983495939 4:168442426-168442448 GAGGGGCGGCAGCGAGGCTGGGG + Intronic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
984667996 4:182448823-182448845 GTGAGGCGGCGGCCGAGCCGGGG + Intronic
984772034 4:183444581-183444603 GAGGGCGCGCGGCGGCGGCGAGG + Exonic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985068384 4:186144813-186144835 GAGGGGAGGCGGCGCCGGCGCGG + Intronic
986152487 5:5140282-5140304 GAGTGGCAGCCGCGGCGGCGGGG - Intergenic
986330433 5:6713380-6713402 GAGGGGCGGGGGAGGGGGCGGGG - Intergenic
986330498 5:6713591-6713613 AAGGGCGGGCGGCGGGGCCGAGG - Intergenic
986330696 5:6714192-6714214 GCCGGGCGGCGGGGGCGACGCGG - Intergenic
986608624 5:9546177-9546199 GCGGCGCGGCGGCGGGGGCGGGG - Intergenic
986693739 5:10333961-10333983 GAGGGGCAGCGGCGACCCAGGGG + Intergenic
986748018 5:10761086-10761108 GCGGGGCCGAGGCGGCGGCGCGG + Exonic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987050402 5:14143562-14143584 GGGGGGCGGCGGCGGCGGCTCGG - Intergenic
987087994 5:14487543-14487565 TGGGGGCAGCGGCGGCGGCGGGG + Exonic
988369286 5:30346021-30346043 GGGGGGCGGGGGGGGGGCCGGGG - Intergenic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
991900533 5:71455710-71455732 GAGAGGAGGAGGCGGCGGCGGGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992105826 5:73448367-73448389 GTGGCGCGGCGGCGGCGGGGCGG + Intergenic
992228395 5:74640678-74640700 GCGGTGCGGCGGTGGCGCTGCGG - Exonic
992312074 5:75511359-75511381 CAGGCGCGGCGGCGGCGCGGCGG - Exonic
992473112 5:77077231-77077253 GAGCGGCGGCGGCGCAGCGGGGG + Exonic
992716221 5:79513942-79513964 AAGAGGCGGCGGCGGGGCCCGGG - Exonic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
993900935 5:93584153-93584175 CCGGGACAGCGGCGGCGCCGCGG + Exonic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
996329290 5:122311856-122311878 GAGGGGCGTGGGCCGAGCCGGGG + Intronic
996738479 5:126777902-126777924 GAGGGGCGGGGGCGCAACCGCGG + Intronic
997652888 5:135535464-135535486 CAGGAGAGGCGGCGGCGCCGCGG - Exonic
997980696 5:138465905-138465927 CTGGGGCCCCGGCGGCGCCGAGG - Exonic
998128017 5:139637428-139637450 GAGGGGCGGCGGGGCCGGCAGGG - Intergenic
998128286 5:139638411-139638433 CAGGGGAGGAGGCGGCTCCGCGG + Intergenic
998166673 5:139848286-139848308 GCGCGGCCGCGGCGGCGGCGGGG + Exonic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
998352189 5:141508884-141508906 GAGGGGAGGGGGCGGGGCGGTGG + Intronic
998374569 5:141682235-141682257 GAGGGGAGGCGGGGCCGGCGCGG - Intergenic
998583558 5:143403957-143403979 GGGTGGCGGCGGCAGCGGCGGGG + Intronic
998957624 5:147453703-147453725 GGCGGGCGGAGGCGGCGGCGCGG - Intronic
999300239 5:150486234-150486256 AGGAGGCGGCGGCGGCGGCGTGG + Intronic
999767926 5:154755268-154755290 GAGGGGAGGGGACGGCGCAGCGG - Intronic
1001065073 5:168529582-168529604 CCGAGGCGGCGGCGGCGGCGCGG + Exonic
1001506392 5:172283788-172283810 GGGGGGCGGAGGCTGGGCCGCGG - Exonic
1001639134 5:173232899-173232921 GGCAGGCGGCGGCGGCGGCGGGG + Exonic
1001688743 5:173616412-173616434 GGCGGACGGCGGCGGCGGCGGGG - Exonic
1002085152 5:176770123-176770145 GAGGGGCAGCGGCTGCTCCCTGG - Intergenic
1002093550 5:176818057-176818079 GCGGGGCGGAGGCGGCCGCGCGG - Intronic
1002160580 5:177312003-177312025 GAGGGTGGGCTGCGGCTCCGTGG - Exonic
1002168710 5:177363309-177363331 GAGGGGCGGGGCCGGAGACGGGG + Intronic
1002184223 5:177446854-177446876 GGGAGGCGGCGGCGGCCCGGGGG - Exonic
1002184226 5:177446857-177446879 GGGGGGAGGCGGCGGCGGCCCGG - Exonic
1002291774 5:178205123-178205145 GAGGGGCGGCGGCCTGGCCCGGG + Intronic
1002580873 5:180208939-180208961 GAGGGCTGCCGGCGGCGCGGCGG - Intronic
1002591055 5:180291932-180291954 GCGGGCCGGCGGCGGAGCCGGGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002646509 5:180659177-180659199 GGGGGGTGGCGGCGGGGACGCGG - Intergenic
1002646522 5:180659203-180659225 GGGGGGTGGCGGCGGGGACGCGG - Intergenic
1002691351 5:181052921-181052943 GCGGGGCGAGGGCGGCGCTGCGG + Intronic
1002889005 6:1317547-1317569 GAGGGTTGGCGGCGGCTGCGGGG - Intergenic
1002897996 6:1390169-1390191 GAGCGCGGGCGGCGGCGGCGCGG + Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003995801 6:11538190-11538212 GGGGGGCGGCGGCGGGTGCGCGG - Intergenic
1003995811 6:11538216-11538238 GGGCGGCGGCGGCGGCTGCGAGG - Intergenic
1004044686 6:12012442-12012464 CGGCGGCGGCGGCGGCGCCTGGG - Exonic
1004216774 6:13711233-13711255 GGGAGGCGGGGGCGGCGGCGGGG + Exonic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004492394 6:16129166-16129188 GAGTGGCGGCCGCGGGGCCCCGG + Exonic
1004529369 6:16439349-16439371 GGGGGGGGGGGGCGGGGCCGGGG + Intronic
1004614958 6:17281079-17281101 GGGGCGCGGCGGCGGGGCCAGGG - Intergenic
1004650251 6:17600891-17600913 CTGCGGGGGCGGCGGCGCCGCGG - Exonic
1004924457 6:20403672-20403694 GAGGGAGGGTGGCGGTGCCGGGG - Intronic
1005040369 6:21595281-21595303 GGTGGTCGGCGGCGGCGCCCAGG - Exonic
1005465437 6:26108197-26108219 AAGGGGCGGGGGCGGTGCCTAGG - Intergenic
1005826259 6:29633093-29633115 GAGGGAAGGAGGCGGCGCCGGGG + Exonic
1006043223 6:31271717-31271739 GAGGGGAGCCGCGGGCGCCGTGG - Exonic
1006193496 6:32223366-32223388 GAGGGGCGGAGGTGGCTCCCGGG + Intronic
1006304120 6:33208647-33208669 GAGGGGCAGTGCCGGCGCGGGGG + Intronic
1006320680 6:33317664-33317686 GAGGGGCGGGGGGGGCCCGGGGG - Exonic
1006337429 6:33427981-33428003 TGGGGGCGGCGGCGGGGCCCGGG - Intronic
1006369183 6:33633747-33633769 CGGGGGCGGGGGCGGGGCCGGGG + Intronic
1006414063 6:33893050-33893072 GAGGGGCCGGGGCGGGGCCGGGG + Intergenic
1006512136 6:34527187-34527209 GGGGGGCGGGGGCGGGGGCGGGG + Intronic
1006814323 6:36840049-36840071 CAGGGGCCGGGGCGGGGCCGCGG + Intergenic
1006826923 6:36941941-36941963 AAGGGGTGGCGGCGGGGCAGAGG - Intergenic
1007451047 6:41940767-41940789 GAGGGGAGGAGGCCGCGCAGAGG - Intronic
1007631404 6:43275353-43275375 GCGGGGCGACGGGGGCGGCGGGG - Intronic
1007775730 6:44223485-44223507 GTGGGCCGGGGGCGGGGCCGCGG + Intronic
1007779832 6:44246466-44246488 AAGGCGCGGCGGCGGCACTGCGG - Intronic
1007784261 6:44270962-44270984 GCGGGGCGCCGGCCGCGCTGCGG - Intronic
1007795439 6:44343126-44343148 GAGGGGAGACGGCAGCCCCGTGG - Exonic
1008160349 6:48068722-48068744 GTGGGGAGGCGGCGGCGGTGGGG - Intergenic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1009905631 6:69867351-69867373 CGGGGACGGCGGCGGCGCTGTGG - Intronic
1010001939 6:70956891-70956913 GAGGGCGGGCGGCGGCGCTGGGG + Exonic
1010083064 6:71886624-71886646 GCGGGGCGGGGGCGGGGCTGGGG - Intergenic
1010569965 6:77464126-77464148 GGGTGGCGGTGGCGGCGGCGCGG - Intergenic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1010703304 6:79077778-79077800 GGAGGGAGGCGGCGGCGGCGGGG - Intronic
1010815795 6:80356936-80356958 GGGGGGCGGGGGCGGGGGCGGGG - Intergenic
1011226609 6:85114972-85114994 GTGGGGCGGGGGCGGGGGCGGGG + Intergenic
1011226613 6:85114981-85115003 GGGCGGGGGCGGGGGCGCCGGGG + Intergenic
1011277456 6:85643813-85643835 GCGGGGCGGTGGCAGCGGCGTGG - Intergenic
1011607331 6:89117982-89118004 GAGGGGTGGGGGTCGCGCCGGGG - Exonic
1012400005 6:98835086-98835108 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1012400018 6:98835107-98835129 GGGGGGCGGGGGCGGCGGCGGGG + Exonic
1013117563 6:107114734-107114756 GGCGGGCGGCGGCGGCGGCGCGG + Intronic
1013117768 6:107115417-107115439 GACCGGCGGCGGCGGCGCTCGGG + Intergenic
1013230563 6:108158011-108158033 GCGGGGGGGCGGCGCGGCCGCGG - Intronic
1013273258 6:108561084-108561106 AGGCGGCGGCGGCGGCGCCCGGG + Exonic
1013359632 6:109382229-109382251 GAGGGACGTCACCGGCGCCGAGG + Exonic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014098129 6:117482381-117482403 GAGGGGCGGGTCCGGCGGCGAGG + Intronic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014569966 6:122996595-122996617 GAGGGGTGGCGGCGGGGACCCGG - Exonic
1014632506 6:123803792-123803814 GTCGGGCGGCGGCCGCGCTGGGG + Intergenic
1014724952 6:124962568-124962590 GAGCGGCGGCGGCGGGCCCCAGG + Exonic
1014798176 6:125749134-125749156 GTGGGGCGGCCGAGGAGCCGCGG + Intronic
1014925643 6:127267069-127267091 GAGGGGCGGCGGCGGGGTCAGGG + Intronic
1014947564 6:127515978-127516000 GAGGGGCGGCAGCGGCGGGGAGG - Exonic
1015024901 6:128520620-128520642 GAGGGACGGGGGCGGAGCCGGGG + Intronic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1015315016 6:131807938-131807960 GAGGGGCGGGCGCGGCGGGGAGG + Intergenic
1015440372 6:133241043-133241065 GCGGGGTGGGGGCGGCGCGGAGG + Intronic
1015654127 6:135497836-135497858 GAGGCGCGGGGACGGGGCCGCGG - Intergenic
1015773540 6:136792282-136792304 GAGAGGAGGCGGCGGCGCGGCGG - Exonic
1015776823 6:136822823-136822845 GGGGGGCGGAGGCGGAGGCGGGG + Intronic
1016340901 6:143060788-143060810 GCGGGGCGGGGGCGGGGGCGGGG - Intronic
1016378718 6:143450808-143450830 GAGCGGCGGCGGCTGCGCGGCGG + Intronic
1017164139 6:151391487-151391509 CAGAGGCGGCGGCGGCGGGGAGG - Exonic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017497719 6:154995827-154995849 GATGGGAGGAGGCGGCGCCCCGG + Intronic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017672207 6:156778583-156778605 CGGGGGCGGCGGCGGCCCGGCGG + Exonic
1017738124 6:157381642-157381664 GAGGCGCGGCCGGGGAGCCGGGG + Exonic
1017793703 6:157823303-157823325 GAGGAGCGGCCGCCGCGCCGGGG + Exonic
1017793772 6:157823502-157823524 GAGGGTCGGGGCCGGGGCCGCGG + Intronic
1017954814 6:159169279-159169301 CAGGGGCGACGGGGGCGGCGGGG - Intergenic
1018330922 6:162727295-162727317 GAGGGGCGGCGGCGGGGCGAAGG + Intronic
1018330931 6:162727319-162727341 GAGGGGCGGCGGCGGGGAGAAGG + Intronic
1018613056 6:165662158-165662180 CCGGGGCGGCGGCGGCGGCCGGG + Intronic
1018613189 6:165662605-165662627 GAGGGGCGGGCGCGGGGGCGCGG + Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1018669615 6:166167885-166167907 GAGCCGCGGCGGCAGCGCTGGGG + Intronic
1018769021 6:166956282-166956304 GAGGGAGCGCGGCGGCGCGGGGG - Exonic
1018876504 6:167826803-167826825 GAGGTGCGGCGGCGCCGCGCGGG + Intergenic
1019179030 6:170175803-170175825 CAGGGGCGGGGGCGGGGGCGGGG - Intergenic
1019294069 7:264724-264746 GTGGGGCGGCAGAGGCCCCGGGG + Intergenic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019343704 7:519898-519920 GGGGGGCGGGGGCGGGGGCGGGG - Intronic
1019421750 7:954132-954154 GAGGGGAGGCGGCGGCAGGGGGG + Intronic
1019531204 7:1504339-1504361 GGGTGGCGGCGGCGGCGCTCCGG - Exonic
1019544976 7:1569883-1569905 CCGGGGCGGCGGCGAGGCCGAGG - Exonic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019828333 7:3301616-3301638 CGGTGGCGGCGGCGGCGGCGCGG + Exonic
1020204744 7:6105459-6105481 GGGGGGCGGCGGGCGGGCCGGGG - Intronic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020278310 7:6637517-6637539 CGGGGGCGGCGGCGGCGGCGGGG + Intronic
1020278335 7:6637575-6637597 GCGGGGAGGCGGCGGGGCCGGGG + Intronic
1020418222 7:7969476-7969498 TGCGGGCGGCGGCGGCGGCGTGG + Exonic
1020445432 7:8262332-8262354 GGGAGGCAGCGGCGGCGCCCAGG - Intronic
1021313150 7:19117060-19117082 CTGTGGCGGCGGCGGCGGCGCGG - Exonic
1021431247 7:20560697-20560719 GAGTGGCAGCAGCCGCGCCGGGG + Intergenic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022207581 7:28179727-28179749 GAGGGGCCCGGGCGGGGCCGGGG - Intronic
1022375231 7:29806432-29806454 GCGGGGCGGCGGCGGCTCCCAGG + Intergenic
1022410315 7:30134926-30134948 GCGGGGCGGAGGAGGAGCCGCGG + Exonic
1022923420 7:35037699-35037721 GGGCGGCGGGGGCGGGGCCGCGG - Intronic
1023842235 7:44104229-44104251 GAGGGGCTGCGGGGGGGCGGGGG - Intergenic
1023875830 7:44285818-44285840 GAGGCGCGGCGGAGGGGGCGCGG + Intronic
1024043821 7:45574463-45574485 GGGCGCGGGCGGCGGCGCCGGGG - Intronic
1024085427 7:45888522-45888544 GGAGGGTGGCGGCGGCGCGGCGG - Exonic
1024516897 7:50266957-50266979 GAGGGGGTGAGGCGGGGCCGCGG + Intergenic
1024639377 7:51316918-51316940 GCGGGGCGGGGGCGGCGCTCCGG - Intergenic
1024953322 7:54888607-54888629 GAGGGTCCGAGGCGGGGCCGCGG + Intergenic
1025236744 7:57239715-57239737 GAGGGGCGTCGGGAGCGCCATGG + Intergenic
1026360433 7:69598052-69598074 GGGGGGCGGGGGCGGGGGCGTGG - Intergenic
1026482403 7:70790221-70790243 GTTGGGAGGCGGCGGCTCCGAGG - Exonic
1026837380 7:73647824-73647846 GGCGGGCGGCGGGGGCGCTGCGG + Intergenic
1028160103 7:87475720-87475742 GGGGGGCGGGGGCGGGGGCGGGG - Exonic
1028173567 7:87628289-87628311 GAGGGGCGGGGCCGGCCGCGCGG - Intronic
1028762314 7:94509848-94509870 GAGCAGCGGCGGCGGGGCTGGGG + Exonic
1029110551 7:98211370-98211392 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
1029123188 7:98281717-98281739 GGGACGCGGCGGCGGCGGCGGGG - Exonic
1029123245 7:98281896-98281918 GGGCGGCGGCGGGGGCGCGGCGG - Exonic
1029123246 7:98281899-98281921 GTAGGGCGGCGGCGGGGGCGCGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029629914 7:101743826-101743848 GGGGGGCGGGGGCGGATCCGGGG - Intergenic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029730140 7:102433511-102433533 GCGGGGTGGAGGCGGGGCCGGGG + Exonic
1029834762 7:103297496-103297518 GCGGCGCGGCGGCGGCTCTGGGG + Exonic
1030033302 7:105388466-105388488 GAGGGGCGGCGGCGGGGGAGGGG - Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1030138702 7:106284567-106284589 GGCGCGCGGCGGCGGCGGCGCGG - Intronic
1031134811 7:117873272-117873294 GCGGGCCGGGGGCGGCGCCGGGG - Intronic
1031134886 7:117873541-117873563 GAGGGGCGGAGGGAGTGCCGCGG - Intronic
1031361829 7:120857370-120857392 GCGGGGCGGGGGCGGGGGCGGGG + Intronic
1032021662 7:128409986-128410008 GAGGAGGGGCGGGGCCGCCGGGG + Exonic
1032119318 7:129144956-129144978 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1032391253 7:131556670-131556692 GAGGGGCGGGGGCGGGGGCGGGG - Intronic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033159086 7:138981241-138981263 GGGGCGCGGCGCCGACGCCGAGG - Exonic
1033299973 7:140176830-140176852 CGGGGGCGGCGGAGGCGCCGAGG + Exonic
1033390722 7:140924831-140924853 GAGCGGCCCGGGCGGCGCCGCGG + Intergenic
1033654318 7:143362670-143362692 GAGCGGCTGGGGCGGCGGCGCGG - Exonic
1033662063 7:143408893-143408915 GGGGGGCGGGGCCAGCGCCGGGG + Intergenic
1034182124 7:149147338-149147360 GAGGGGCGGAGGCGACGCGGGGG + Intronic
1034188173 7:149195327-149195349 GAGAGGCGGCGGCCTCGCCCAGG - Intergenic
1034223086 7:149460451-149460473 GAGGGGCGGCGCGCGGGCCGGGG - Intronic
1034251240 7:149692632-149692654 CAGGGGAGGCTGCGGCGGCGCGG - Intergenic
1034253996 7:149714685-149714707 GAGGGGAGGGGGCGGGGACGAGG + Intergenic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034441061 7:151086358-151086380 GAGGGGCGGGGGCGGCGGGGAGG + Intronic
1034469714 7:151248736-151248758 GCGGGCGGGCGGCGGCGGCGTGG - Exonic
1034568364 7:151933754-151933776 GCGGGGGGGCGGGGGGGCCGTGG - Intergenic
1034618259 7:152436597-152436619 GAGTGGCAGCGGCGGCGCGCGGG - Intergenic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1034809831 7:154122285-154122307 GAGGGGCGGCAGTGGTGACGTGG + Intronic
1034977674 7:155457781-155457803 GCGGGGCGGCGGCCGCGAGGAGG + Intergenic
1035153213 7:156892630-156892652 GCGGGGCGGGGGCGGGGTCGGGG + Intronic
1035168598 7:157005765-157005787 GAAGGGCGGCGGCGGGGGCGCGG - Exonic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1035169605 7:157010203-157010225 AGGTGGCGGCGGCGGCGGCGGGG - Exonic
1035573342 8:688287-688309 GCGGGGCGGCGGAAGGGCCGGGG - Intronic
1036432324 8:8702370-8702392 CAGGGGCGCCGTCGGCGCGGCGG + Exonic
1036664797 8:10731128-10731150 CAGGGGCGGCGGGGGCGTCGAGG - Intronic
1036701576 8:11016676-11016698 CAGAGGCGGAGGCGGGGCCGGGG - Intronic
1037262795 8:17027214-17027236 GAGGGGCGGGGGCGGGGGGGGGG - Intergenic
1037262881 8:17027451-17027473 TGGAGGCGGCGGCGGCGCTGGGG + Exonic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1038304157 8:26383613-26383635 GACGTGCGGCGGGGACGCCGGGG + Intronic
1038632995 8:29263112-29263134 GGGGGCCGGGGGCGGAGCCGGGG + Intronic
1038828505 8:31033013-31033035 GACGGGCGGCGGCGGCGTGCGGG - Exonic
1038883505 8:31639660-31639682 CGGGCGCGGCGGCGGCGCGGGGG + Intronic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1039618236 8:38974159-38974181 GGCCGGCGGAGGCGGCGCCGTGG + Exonic
1040014802 8:42691523-42691545 GAGGAACGGTGGCGGCGGCGAGG + Intergenic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1040512171 8:48105393-48105415 AAGGGGCCGCGGCGGCCCTGTGG - Intergenic
1040951060 8:52939618-52939640 GAGGGGTGGGGGTGGCGCCGCGG - Exonic
1041040712 8:53843351-53843373 GAGGGGCGGGCGCTGCGGCGGGG + Intronic
1041552604 8:59118809-59118831 GAGCGGCGGTGGCCGGGCCGCGG - Intronic
1041552842 8:59119807-59119829 GAGGGCCGGGGGCGGGGCTGCGG - Intergenic
1041673649 8:60516956-60516978 GAGGCGGGGCGGAGGCGCCGCGG + Exonic
1041673650 8:60516959-60516981 GCGGGGCGGAGGCGCCGCGGCGG + Exonic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041690145 8:60679618-60679640 GAGCAGCGGCGGCGGCGGCTCGG + Intronic
1041690373 8:60680361-60680383 GCGGGGCGGGCGCGGCGGCGCGG + Intronic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042040221 8:64581387-64581409 CCTGGGCGGCGGCGGCGGCGGGG + Exonic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1042902792 8:73746239-73746261 GAGGCGGAGCGGCGGGGCCGGGG - Intronic
1043053343 8:75407903-75407925 GAGATGCGGCGGCGGCCGCGCGG + Intronic
1043296128 8:78665979-78666001 GCGGGGCCGCGGCGGAGGCGAGG - Intergenic
1043388141 8:79767964-79767986 GAGGGGCGGGAGCGAGGCCGAGG + Intergenic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1044306354 8:90645605-90645627 GAGTGGCGGCGGCGGCGTGGTGG - Exonic
1044761157 8:95519047-95519069 GGGGGGCGGCGGTGGGGGCGCGG + Intergenic
1044821913 8:96160833-96160855 GAGGGGGCGTGGCGGGGCCGGGG - Intergenic
1045137294 8:99234458-99234480 GCGGGGCGGCGGCGAGGCCAAGG - Intronic
1045336130 8:101205679-101205701 CAGGCGGGGCGGGGGCGCCGAGG - Intronic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1045571339 8:103371665-103371687 GCGGGGAGGCGGCGGGGCCCTGG - Exonic
1046103922 8:109644786-109644808 CAGTGGCGGCGGCGGCGCGTTGG - Intronic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047100167 8:121667544-121667566 GCGGGGCGGGGGCGACGACGAGG + Intergenic
1047381878 8:124372079-124372101 GGGGCGCGGCGGCGGCGGCCGGG + Exonic
1047732383 8:127737720-127737742 GAGGGGCTGCGGTGCCGGCGGGG + Intronic
1047998621 8:130358731-130358753 GCGGGGCGGGGGCCGGGCCGGGG - Intronic
1048214083 8:132480304-132480326 GGAGGGCGGCGGCCGCGACGAGG - Exonic
1048214124 8:132480460-132480482 CGGGGGCGGCGGAGGCGGCGGGG - Exonic
1048214132 8:132480478-132480500 GGCTGGCGGCGGCGGCGACGGGG - Exonic
1048308061 8:133297287-133297309 GAGGCGCGGGGGCGGGGCCGCGG - Exonic
1048971767 8:139649085-139649107 GAGGGGAGGCCACGGCGTCGGGG - Intronic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049166369 8:141128541-141128563 GAGGGGCGGGGCCCGAGCCGAGG - Intronic
1049405533 8:142450384-142450406 GGGAGGAGGCGGCGGCGCCGAGG - Intronic
1049411523 8:142475797-142475819 TAGGGGCGGGGCCGGGGCCGGGG + Intronic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049585415 8:143430527-143430549 GGCGCGGGGCGGCGGCGCCGAGG + Intergenic
1049585442 8:143430634-143430656 GCGGGGAGGAGGCGGCGACGCGG - Intergenic
1049620933 8:143597995-143598017 GGGGGGCGGCGGCCGTGCAGCGG - Exonic
1049653665 8:143788439-143788461 GAGAGGCAGCGGCGGCCCCAGGG + Intergenic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049693678 8:143973565-143973587 GCGGGGCGGGGGCGGGGCGGGGG - Intronic
1049747680 8:144269921-144269943 GAGGGCTGGCGTGGGCGCCGTGG - Intronic
1049762070 8:144336251-144336273 GAGGAGCGGCGGAGGCAGCGCGG + Exonic
1049891269 9:73092-73114 GAGAGGGCGCGGCGGCGGCGCGG + Intergenic
1049891270 9:73095-73117 AGGGCGCGGCGGCGGCGCGGCGG + Intergenic
1049936439 9:504973-504995 GAGAGGTGGCGTCGGCCCCGCGG + Intronic
1050183309 9:2943446-2943468 GAGGGGAGGCGGCGGCAGTGAGG - Intergenic
1050744160 9:8857792-8857814 GCTGGGCGGCGGCGGCGACCAGG - Intronic
1050874042 9:10613177-10613199 CGGCGGCGGCGGCGGCGCTGCGG + Intergenic
1051079711 9:13279721-13279743 GCGGGGCGGCGGGCGCGCCTTGG + Intergenic
1051146207 9:14030209-14030231 GGGGGGGGGTGGCGGCGGCGGGG + Intergenic
1051146209 9:14030215-14030237 GGGTGGCGGCGGCGGGGCCAGGG + Intergenic
1051170563 9:14315350-14315372 AAGAGGCGGCGGCGGCGGCTCGG - Intronic
1051218984 9:14828637-14828659 GCGGGGCGGGGGAGGTGCCGGGG + Intronic
1051876758 9:21802169-21802191 GCGGGGCGGCCGCCGCGGCGGGG - Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052871440 9:33511181-33511203 GTGGGCCGGAGGCGCCGCCGCGG + Intergenic
1052871443 9:33511189-33511211 GAGGCGCCGCCGCGGCGCGGAGG + Intergenic
1053001154 9:34577954-34577976 GCGGGGCGGGGGCGTCGCGGCGG + Intronic
1053034108 9:34810010-34810032 GGGCGGCGGCGGCGGCGCGTGGG - Intergenic
1053055157 9:34989673-34989695 GCGGCGCGGAGGCGGAGCCGTGG + Exonic
1053138277 9:35665241-35665263 GAGCCGCGGAGGCGGGGCCGGGG + Exonic
1053239952 9:36487424-36487446 GGGGGGCGCGGGCGGCGCGGGGG + Intronic
1053240025 9:36487690-36487712 AAGCGGCGGCGGCGGCGGAGGGG + Intergenic
1053690454 9:40584295-40584317 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690460 9:40584313-40584335 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1053690466 9:40584331-40584353 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1053690474 9:40584357-40584379 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690482 9:40584383-40584405 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053690491 9:40584412-40584434 GGCGGGCGGCGGCGGCGGCGCGG - Intergenic
1053690499 9:40584438-40584460 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690507 9:40584464-40584486 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690515 9:40584490-40584512 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054274300 9:63053003-63053025 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054274307 9:63053029-63053051 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054274314 9:63053055-63053077 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054274323 9:63053084-63053106 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054274330 9:63053110-63053132 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054274338 9:63053136-63053158 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054274344 9:63053154-63053176 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054301697 9:63385220-63385242 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054301702 9:63385238-63385260 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054301708 9:63385256-63385278 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054301716 9:63385282-63385304 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301724 9:63385308-63385330 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301732 9:63385334-63385356 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301740 9:63385360-63385382 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301748 9:63385386-63385408 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301756 9:63385412-63385434 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301764 9:63385438-63385460 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054301771 9:63385464-63385486 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054400479 9:64711774-64711796 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400485 9:64711792-64711814 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054400491 9:64711810-64711832 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054400499 9:64711836-64711858 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400507 9:64711862-64711884 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400533 9:64711940-64711962 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054400540 9:64711966-64711988 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054434065 9:65196018-65196040 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434071 9:65196036-65196058 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434077 9:65196054-65196076 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434083 9:65196072-65196094 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054434089 9:65196090-65196112 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054434098 9:65196119-65196141 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434107 9:65196148-65196170 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434116 9:65196177-65196199 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054434123 9:65196203-65196225 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054434139 9:65196255-65196277 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054434146 9:65196281-65196303 GGCGGTCGGCGGCGGCGCGGCGG - Intergenic
1054459439 9:65454895-65454917 TAGGGGCGTTGGCGACGCCGGGG + Intergenic
1054496243 9:65825399-65825421 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054496250 9:65825425-65825447 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054496257 9:65825451-65825473 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054496277 9:65825511-65825533 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054496284 9:65825537-65825559 GGCGGTCGGCGGCGGCGCGGCGG + Intergenic
1054496293 9:65825566-65825588 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054496302 9:65825595-65825617 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054496308 9:65825613-65825635 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054496314 9:65825631-65825653 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054496320 9:65825649-65825671 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054496325 9:65825667-65825689 GGCGGACGGCGGCGGCGCGGCGG + Intergenic
1055030577 9:71768749-71768771 CAGGGGAGGAGGCGGCGGCGCGG + Exonic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055308200 9:74952236-74952258 GGGGGGCGGTGGCGACGACGGGG - Exonic
1055514158 9:77020142-77020164 GGGCGGCGGCGGCGGCGGCTGGG - Exonic
1056576094 9:87857225-87857247 GAGGGGCGGTGGCAGGGCAGAGG + Intergenic
1056799517 9:89681436-89681458 GAGGGGGGGCGGCGGCTGCTGGG - Intergenic
1056799527 9:89681460-89681482 GGGGGGCGGCGGCGGTGGGGTGG - Intergenic
1057245595 9:93451863-93451885 GGCGGGGGGCGGCGGGGCCGGGG - Exonic
1057259662 9:93576655-93576677 GCGGGGCGCAGGCGGCGCCGCGG - Exonic
1057259665 9:93576672-93576694 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1057494960 9:95553505-95553527 GGGGGGCCGCGGCGGGGCGGCGG - Intergenic
1057600043 9:96450116-96450138 GGCGGACGGCGGCGGCGCCGCGG + Intergenic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1058005148 9:99906587-99906609 GCGGGGCGGGGGCGGGGGCGGGG + Intergenic
1058058771 9:100473986-100474008 GTGGGGAGGCGGTGGGGCCGGGG + Intronic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1059268886 9:113060372-113060394 GAGTGGCGTCGGCGGCGCTTTGG + Intergenic
1059270022 9:113065821-113065843 GAGTGGCGTCGGCGGCGCTTTGG + Intergenic
1059271156 9:113071269-113071291 GAGTGGCGTCGGCGGCGCTTTGG + Intergenic
1059272289 9:113076715-113076737 GAGTGGCGTCGGCGGCGCTTTGG + Intergenic
1059273424 9:113082157-113082179 GAGTGGCGTCGGCGGCGCTTTGG + Intergenic
1059274560 9:113087603-113087625 GAGTGGCGTCGGCGGCGCTTTGG + Intergenic
1059405836 9:114098086-114098108 GAGCGCCGGCGGCGCCCCCGCGG - Intronic
1059470932 9:114504711-114504733 GGCGGGCGGCGGCGGGGGCGCGG - Exonic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060106715 9:120877228-120877250 GGGGCGGGGCGGGGGCGCCGCGG + Exonic
1060114440 9:120929113-120929135 CGGTGGCGGAGGCGGCGCCGAGG - Intronic
1060300258 9:122370966-122370988 GAGGAGCGGGGGTGGAGCCGGGG + Intronic
1060468703 9:123930051-123930073 TGGAGGCGGCGGCGGCGGCGAGG - Exonic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1060966700 9:127715768-127715790 GAGGGGCGGAAGCGGCGAGGCGG + Exonic
1060979885 9:127785875-127785897 TAGTGGCGGCGGCGGAGGCGGGG + Intronic
1060979960 9:127786118-127786140 TGGGGGCGGCGGCGGCGCGTTGG + Exonic
1061089928 9:128420806-128420828 GAGGGGAGGGGGCGGGGCCTGGG - Exonic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061207672 9:129174119-129174141 GAGGCTCGGCGGAGGCGGCGGGG - Intergenic
1061208312 9:129176910-129176932 GAGCGGCGGCGGCTGCTCCGAGG + Exonic
1061262629 9:129488535-129488557 GAGAGGCGGCCGCGGGGCGGGGG - Intergenic
1061272257 9:129550177-129550199 GAAAGGCTGCGGCGGCGGCGCGG - Intergenic
1061321825 9:129835638-129835660 GAGGGGCGGCGGCGGCCGGGGGG - Intronic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1061859463 9:133460462-133460484 GCGGGGGGGCGGCGGGGGCGGGG + Intronic
1061961934 9:133992896-133992918 GGGGGGCGGGGGCGGCGCTTGGG - Intergenic
1062022522 9:134326236-134326258 GCGGGGCGGCGGCGGCGGAGGGG + Intronic
1062022739 9:134326870-134326892 GCGGGCGGGCGGCGGGGCCGGGG + Intronic
1062084519 9:134641872-134641894 GCGGGGCGGCGGCGGCGAGGAGG + Exonic
1062230508 9:135479557-135479579 GCGGGGCGGGGGCGTCCCCGGGG + Intronic
1062272237 9:135714816-135714838 GAAGGGCGCCGGCGGCTGCGGGG - Intronic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062325008 9:136008705-136008727 GTGGGGCGGGGGCGGCGGCCCGG - Exonic
1062500420 9:136849690-136849712 GCGGGGCGGGGGCGGGGCTGCGG + Intronic
1062517734 9:136944609-136944631 GCAGGGCGGGGGCGGCGCAGCGG - Exonic
1062535042 9:137017722-137017744 GAGGGGCGGCGTCCTCCCCGGGG - Intronic
1062560406 9:137139191-137139213 CGGCGGCGGCGGCGGCTCCGCGG - Intronic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062574634 9:137200486-137200508 GCGGCGCGGCGGGGGCGCGGCGG - Exonic
1062587391 9:137255436-137255458 GGGTGTCTGCGGCGGCGCCGGGG + Exonic
1062595112 9:137295875-137295897 GAGGGGCGAGGGCAGAGCCGAGG - Intergenic
1062656362 9:137606040-137606062 GAGGGGCGGCGGGGTCCCGGCGG + Intronic
1062659103 9:137619092-137619114 CAGCGGCGGAGGCGGCGCGGGGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062696217 9:137877650-137877672 GAGGGGCCGGGGCGGGGCGGGGG + Intergenic
1062696222 9:137877661-137877683 GCGGGGCGGGGGCGGCCGCGGGG + Intergenic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203773591 EBV:61239-61261 CAGCGGTGGCGGCGGCCCCGCGG - Intergenic
1203773622 EBV:61314-61336 GAGGGCCGGAGCCGGGGCCGGGG + Intergenic
1203782390 EBV:107926-107948 GAGCGGCGGCGGTTGCGCCCGGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1185621494 X:1453423-1453445 GAGGGGCGGGGCGAGCGCCGGGG - Intronic
1185736644 X:2500931-2500953 AAGCGGCGGCGGCGCGGCCGGGG - Exonic
1186426125 X:9465289-9465311 GCGGGGCGGGGGCGGCCCGGGGG + Exonic
1186466249 X:9786372-9786394 GCGGGGAGGGGGCGGGGCCGGGG - Intergenic
1187181355 X:16946571-16946593 GGGAGGCGGGGGCGGGGCCGGGG + Intergenic
1187363690 X:18649973-18649995 GCGGGGCGGCGGCGGCGGGTGGG - Intronic
1187403658 X:18984142-18984164 GAGGCGCGGGGGCGGGGACGGGG + Exonic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187464568 X:19515536-19515558 GAGGGGCGGGGAGGGGGCCGGGG + Intergenic
1187507284 X:19887784-19887806 GAGGGGCGGGGCCGGGGCCGGGG + Intergenic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1187873485 X:23783546-23783568 GCGGGGTGGCGGCCGAGCCGGGG - Intronic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1188004083 X:25005488-25005510 GAAGGGCGGCCGCGGCGGCGCGG - Intronic
1189310625 X:40014930-40014952 GCGGGGCGGGGGCGGGGGCGGGG - Intergenic
1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG + Intronic
1189323073 X:40097811-40097833 GGCGGGCGGCGGCGGCGGAGGGG - Intronic
1189323261 X:40098419-40098441 CTTGGGCGGCGGCGGCGGCGAGG + Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1189382808 X:40513843-40513865 GAGGGGCGGGGGTGGGGCTGGGG - Intergenic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1190061682 X:47215684-47215706 CTGGGGCGGCGGCAGGGCCGGGG - Intergenic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1194421056 X:93673377-93673399 GAGTGGCGGCGGCGGAGGCCCGG + Exonic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic
1195022299 X:100841779-100841801 GAGAGGAGGAGGCGGCGGCGCGG - Intergenic
1195100622 X:101551354-101551376 GAGGGCCGGGGGCGGGGACGGGG + Intronic
1195108655 X:101623917-101623939 GAGGGACGGGGGTGGCGGCGGGG + Intronic
1195668350 X:107449918-107449940 GCGCGGCAGCGGCGGCGCAGCGG - Intergenic
1195716840 X:107826301-107826323 TAGCGGCGGCGGCGGCGACCGGG + Exonic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1196819567 X:119692457-119692479 GGCGGGCGGCGGCGGCGCCGGGG - Intronic
1197202991 X:123765040-123765062 GAGCGGCGGAGGCGGCTCAGCGG + Intergenic
1197749882 X:129957228-129957250 GAGGGGCGGGGGCGGGGGCCGGG - Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198871049 X:141177246-141177268 GTGGGGGGGCCGCGGCGGCGTGG + Intergenic
1198871052 X:141177249-141177271 GGGGGGCCGCGGCGGCGTGGGGG + Intergenic
1199757071 X:150874559-150874581 GGGGGGCGGGGGCGGGGGCGGGG + Intronic
1199772656 X:150984185-150984207 GAGGGCCGGGGGCGCCGCTGCGG + Intronic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic
1200000317 X:153056673-153056695 GAGGGGCGGCGGAGTCTCCCGGG - Intronic
1200003237 X:153072641-153072663 GAGGGGCGGCGGAGTCTCCCGGG - Intronic
1200004486 X:153077368-153077390 GAGGGGCGGCGGAGTCTCCCGGG + Intergenic
1200058740 X:153474700-153474722 GAGAGGCGGGGGCGGGGGCGGGG + Intronic
1200100825 X:153688489-153688511 GGGGGGCACCGGCGGCACCGGGG - Exonic
1200173654 X:154097310-154097332 CAGGGGCGCCCGCGGGGCCGGGG + Intronic