ID: 954782788

View in Genome Browser
Species Human (GRCh38)
Location 3:53073276-53073298
Sequence GATGCTGGTGCGCAGTCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954782788_954782796 5 Left 954782788 3:53073276-53073298 CCGTCAGACTGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 954782796 3:53073304-53073326 GTGAGGAGAGAACCTGGGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 380
954782788_954782800 21 Left 954782788 3:53073276-53073298 CCGTCAGACTGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 954782800 3:53073320-53073342 GGCTGGGGCTTGACACAAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 173
954782788_954782795 4 Left 954782788 3:53073276-53073298 CCGTCAGACTGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 954782795 3:53073303-53073325 GGTGAGGAGAGAACCTGGGCTGG 0: 1
1: 0
2: 5
3: 43
4: 428
954782788_954782793 -1 Left 954782788 3:53073276-53073298 CCGTCAGACTGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 954782793 3:53073298-53073320 CTGTGGGTGAGGAGAGAACCTGG 0: 1
1: 0
2: 3
3: 34
4: 342
954782788_954782799 20 Left 954782788 3:53073276-53073298 CCGTCAGACTGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 954782799 3:53073319-53073341 GGGCTGGGGCTTGACACAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 187
954782788_954782797 6 Left 954782788 3:53073276-53073298 CCGTCAGACTGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 954782797 3:53073305-53073327 TGAGGAGAGAACCTGGGCTGGGG 0: 1
1: 0
2: 5
3: 54
4: 640
954782788_954782801 22 Left 954782788 3:53073276-53073298 CCGTCAGACTGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 954782801 3:53073321-53073343 GCTGGGGCTTGACACAAAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 172
954782788_954782794 0 Left 954782788 3:53073276-53073298 CCGTCAGACTGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 954782794 3:53073299-53073321 TGTGGGTGAGGAGAGAACCTGGG 0: 1
1: 0
2: 1
3: 35
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954782788 Original CRISPR GATGCTGGTGCGCAGTCTGA CGG (reversed) Intronic
900251940 1:1675420-1675442 GATGGTGGGGCGCAGGCGGAGGG + Intronic
900262351 1:1738277-1738299 GATGGTGGGGCGCAGGCGGAGGG + Intronic
902112961 1:14098585-14098607 GATGCTGGAGGGCATTTTGAAGG - Intergenic
902747782 1:18484705-18484727 GCTGCTGGTGCCCAGGCTGTGGG + Exonic
905304993 1:37011619-37011641 GAGGCTGGTGTGAAGTCTAAGGG + Intronic
905883456 1:41479174-41479196 GAGGCTGCTCCGCAGTCTGGAGG + Exonic
907308042 1:53524529-53524551 GGAGCTGGTGGGCAGTCTGTGGG + Intronic
910345418 1:86231142-86231164 GCTGCTGGTGCACAGTCCTAAGG + Intergenic
915759527 1:158296240-158296262 GAAGCAGGTGCTCAGTCTCAAGG + Intergenic
920458487 1:206118204-206118226 GCTGCTGCTGCGCTGTCAGAAGG - Intergenic
921834624 1:219765107-219765129 GGTGCCTGTGCTCAGTCTGATGG - Intronic
923548297 1:234940939-234940961 GATGCTGCTGCTCAGACTGGAGG - Intergenic
1062978632 10:1703405-1703427 GATGCTGGTGAGCAGTGAGGAGG + Intronic
1065854284 10:29816979-29817001 GATGCTGGGGCGCAGGGTGCTGG + Intergenic
1070775681 10:79108469-79108491 GAGGGTGGTGCTCAGGCTGATGG + Intronic
1072525381 10:96266654-96266676 GATGCAGGTAGGCAGTGTGAGGG + Intronic
1072619177 10:97068385-97068407 GATGTTGGTGCCCACTCTGTGGG - Intronic
1074313757 10:112344052-112344074 GATGATGGTGCCCCTTCTGAAGG - Intergenic
1074983915 10:118641135-118641157 GATGCTGCTGTGCCCTCTGAGGG - Intergenic
1082822638 11:57554576-57554598 GAAGCTGATGCGCAGGTTGAAGG + Exonic
1083395925 11:62391905-62391927 GATGCTAGGGCGCTGTCTCAGGG + Intronic
1085259815 11:75198037-75198059 GATGCTGATGCCCAGCATGAGGG - Intronic
1089574616 11:119432544-119432566 GATGCTGCTGCCCAGTCGGCAGG - Intergenic
1090266756 11:125358285-125358307 GATTCTGGTGTGCCCTCTGAAGG + Intronic
1096491831 12:52016836-52016858 GATGGCGATGCACAGTCTGATGG - Intergenic
1110499355 13:76208842-76208864 GATGGTGGTGCTCAGGCTGGAGG - Intergenic
1110973998 13:81806355-81806377 GATGATGGTGCACAGTCTTTAGG - Intergenic
1113472190 13:110555036-110555058 GATGCTGCTTCCCAGTCTGTAGG + Intronic
1116012568 14:39367953-39367975 GTTGTTGGTGAGAAGTCTGAAGG + Intronic
1116209940 14:41924717-41924739 GATTCTGGTGCTCAGTCAGATGG + Intergenic
1122787558 14:104171007-104171029 GAGGCTGGGGGGCAGGCTGAGGG - Intronic
1124199506 15:27666238-27666260 GATGCTTTGGCTCAGTCTGAAGG - Intergenic
1125511930 15:40296784-40296806 GATACTGGTGGGGAGGCTGAGGG - Exonic
1130411757 15:83653937-83653959 GGTGCCGGCGCGCAGGCTGACGG + Intergenic
1132908270 16:2295441-2295463 GCTGATGGTGCCCAGGCTGAGGG + Intronic
1140045433 16:71437573-71437595 GATGCTGGTCCCCAGCCTGGTGG - Intergenic
1142720950 17:1775445-1775467 CATGTGGGTGCCCAGTCTGAGGG - Intronic
1143794316 17:9324424-9324446 GCTCCTGGTGCGCAGTGTGATGG + Intronic
1144725166 17:17498208-17498230 GAAGGCGGTGCTCAGTCTGAAGG - Intergenic
1145772570 17:27504258-27504280 GAGGCTGGTCCGCAGTCAGCCGG + Intronic
1145907370 17:28523915-28523937 GATGCTGGTCCTCACTCTCATGG + Intronic
1153877464 18:9386827-9386849 GATACTGATGAGAAGTCTGATGG - Intronic
1154430528 18:14304799-14304821 GATGCTGGTGGGCAGTAGAAAGG + Intergenic
1157570713 18:48710282-48710304 GCTGCTGGAGAGCAGTCAGAGGG - Intronic
1158558287 18:58492969-58492991 GAGGCTGGAGGGAAGTCTGAAGG - Intronic
1161382068 19:3970819-3970841 GATGCTGGAGCGGAGCCTTAGGG - Intronic
1163597220 19:18227184-18227206 GTTTCTGGTGCGCTGTTTGATGG - Intronic
1163703581 19:18799344-18799366 GATGGTGGAGCTCAGTCTGATGG - Intergenic
1168724243 19:58572098-58572120 GATGCTGATGCCCAGGCTGTAGG - Intronic
925548588 2:5044117-5044139 GATGCTGGAGCAGAGCCTGAAGG + Intergenic
925561521 2:5201225-5201247 GATGCTGGGGCTCAGTCTCAAGG + Intergenic
926731357 2:16038147-16038169 GAGCCTGGTGGGCAGTCTGCCGG + Intergenic
929921603 2:46175941-46175963 GATTCTGGTGGGCAGCCTGGTGG - Intronic
936626879 2:114157963-114157985 CATTCTGGGGCTCAGTCTGAAGG + Intergenic
946519184 2:220447074-220447096 GATGAGGGTGAGAAGTCTGATGG - Intergenic
947575766 2:231272992-231273014 GATGCTGGAGGGAAGGCTGAAGG + Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177829596 21:26122522-26122544 CATGCTGGTGGGAAGTCAGATGG - Intronic
1179765934 21:43573223-43573245 AATGCTGCTGCCCAGTGTGACGG + Intronic
1182705080 22:32271917-32271939 GATGCAGGTGCACAGTGTGTTGG - Intergenic
1183251012 22:36730353-36730375 GATGCTCGTGCGGCGTCAGATGG + Intergenic
950092381 3:10305051-10305073 GGTGCTGGTGGGCAGGCCGATGG + Exonic
952409507 3:33034509-33034531 GGTGCTGGTGGGCAGGCTGATGG - Intronic
952923611 3:38306131-38306153 GATGCTGTTACGCAGATTGAGGG + Exonic
954782788 3:53073276-53073298 GATGCTGGTGCGCAGTCTGACGG - Intronic
962236541 3:133711949-133711971 GATGCTGGTCCCCTGTCTGGAGG + Intergenic
964027865 3:152099619-152099641 GAGGCTGGAGTGCAGTCTTACGG - Intergenic
968833611 4:2946941-2946963 GAAGCTGGTGTGCACTCTCATGG + Intronic
975650759 4:76590331-76590353 GTTGCGGGTGAGCCGTCTGAAGG + Intronic
989973788 5:50556707-50556729 GAGGCTGGAGCTCAGTGTGAAGG - Intergenic
990511403 5:56492537-56492559 CATGCTGGTGGGCTGTCTCATGG + Intergenic
1002643372 5:180641068-180641090 GAGGCTGGTGCTCAGGGTGATGG - Intronic
1002772885 6:304359-304381 AGTGCTGGTGGGCATTCTGAGGG - Intronic
1004474383 6:15957592-15957614 GCTGCTGGTGCCTGGTCTGAAGG - Intergenic
1006031170 6:31177702-31177724 GAAGCTGGTTCTCAGACTGAAGG - Intronic
1006186456 6:32184171-32184193 GGTGCTGGTCCTCAGTCTGTGGG - Exonic
1006408211 6:33857180-33857202 GATGCAGGTGCCCAGACTGGGGG - Intergenic
1011261808 6:85477540-85477562 CAGGCTGGTGCATAGTCTGATGG + Intronic
1017183583 6:151577665-151577687 GGTGCGGGTGCGCAGCCAGAGGG - Intronic
1023919359 7:44615279-44615301 GTTGCTGGTGCGGTGTCTGGGGG + Intronic
1032012727 7:128357474-128357496 GATGCTGGCTGGCAGTCTGTCGG - Intronic
1035477630 7:159154567-159154589 GCTGCTGCTGCTCATTCTGATGG + Intergenic
1035918515 8:3651895-3651917 GATGATGGTAAGCACTCTGATGG - Intronic
1035918574 8:3652313-3652335 GATGGTGGTGAGCACTCCGATGG - Intronic
1037906507 8:22718775-22718797 GCTGGTGGGGGGCAGTCTGAGGG + Intronic
1041144073 8:54853448-54853470 GCTCCTGGTGCCCAGTCTGGTGG - Intergenic
1042346814 8:67736027-67736049 GATGCTGGTGATCCCTCTGAAGG + Intronic
1044145490 8:88709024-88709046 GATGATGGTGCAAGGTCTGATGG - Intergenic
1048458770 8:134602288-134602310 GATGTGGGTGCGCAGCCTGATGG + Exonic
1048474991 8:134734829-134734851 GGTGCAGCTGCTCAGTCTGAGGG + Intergenic
1049044520 8:140138903-140138925 GACCCAGGTGTGCAGTCTGAGGG + Intronic
1049671921 8:143873723-143873745 GATGCCGGTGCCCAGGCTGAGGG - Intronic
1050276239 9:4003761-4003783 GATGATGGTGAGCTGTCTCATGG + Intronic
1055932014 9:81568739-81568761 TATGCTGGTGTGCATTCTGTGGG + Intergenic
1059635415 9:116165582-116165604 GATGTTGGTGGGCAGGTTGAAGG - Intronic
1060480032 9:124012348-124012370 GATGCTGTTCCACAGTCTGTCGG + Exonic
1060536102 9:124389502-124389524 GATGCAGGAGGTCAGTCTGAGGG - Intronic
1062377181 9:136267490-136267512 GATGCTGGAGCGGAGCCTGCGGG - Intergenic
1185623140 X:1465531-1465553 GAGGCCGGTGCGCACCCTGAAGG - Exonic
1185814125 X:3138280-3138302 GTTGGTGTTGCGCATTCTGAGGG + Intergenic
1186917724 X:14241832-14241854 GATGCTGGTTGGCAGTATGGTGG - Intergenic
1190686862 X:52882379-52882401 GATTCTGATGAGAAGTCTGATGG + Intergenic
1190699121 X:52973412-52973434 GATTCTGATGAGAAGTCTGATGG - Intronic
1191758557 X:64622555-64622577 GATGCTGGGGCGGAGTGTGGTGG - Intergenic
1194376838 X:93146365-93146387 GATGTTGGTAAGGAGTCTGATGG - Intergenic
1197706637 X:129639083-129639105 GAGGCCGGTGCGCAGGCTCAGGG + Intergenic
1201267582 Y:12223201-12223223 GTTGGTGGTGTGCATTCTGAGGG - Intergenic