ID: 954792929

View in Genome Browser
Species Human (GRCh38)
Location 3:53146280-53146302
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954792929_954792940 11 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792940 3:53146314-53146336 AATCCATGTGTTTGAATGGCTGG No data
954792929_954792938 7 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data
954792929_954792942 16 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792942 3:53146319-53146341 ATGTGTTTGAATGGCTGGAAAGG No data
954792929_954792943 17 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792929_954792944 22 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792944 3:53146325-53146347 TTGAATGGCTGGAAAGGGCAAGG No data
954792929_954792945 23 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954792929 Original CRISPR GGTACCAGAGCCCTTGGGAG GGG (reversed) Intergenic