ID: 954792931

View in Genome Browser
Species Human (GRCh38)
Location 3:53146282-53146304
Sequence TGGGTACCAGAGCCCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954792931_954792943 15 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792931_954792944 20 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792944 3:53146325-53146347 TTGAATGGCTGGAAAGGGCAAGG No data
954792931_954792942 14 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792942 3:53146319-53146341 ATGTGTTTGAATGGCTGGAAAGG No data
954792931_954792945 21 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792931_954792940 9 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792940 3:53146314-53146336 AATCCATGTGTTTGAATGGCTGG No data
954792931_954792938 5 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954792931 Original CRISPR TGGGTACCAGAGCCCTTGGG AGG (reversed) Intergenic
No off target data available for this crispr